Incidental Mutation 'R1218:Exosc10'
ID99812
Institutional Source Beutler Lab
Gene Symbol Exosc10
Ensembl Gene ENSMUSG00000017264
Gene Nameexosome component 10
SynonymsPmscl2, PM-Scl, p3, p2, PM/Scl-100, RRP6, p4
MMRRC Submission 039287-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1218 (G1)
Quality Score103
Status Not validated
Chromosome4
Chromosomal Location148558429-148582401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148570401 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 551 (I551N)
Ref Sequence ENSEMBL: ENSMUSP00000095388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017408] [ENSMUST00000076022] [ENSMUST00000097781]
Predicted Effect probably damaging
Transcript: ENSMUST00000017408
AA Change: I551N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017408
Gene: ENSMUSG00000017264
AA Change: I551N

DomainStartEndE-ValueType
Pfam:PMC2NT 44 133 2.7e-26 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 745 760 N/A INTRINSIC
coiled coil region 769 800 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076022
AA Change: I551N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075401
Gene: ENSMUSG00000017264
AA Change: I551N

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 5.1e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 720 735 N/A INTRINSIC
coiled coil region 744 775 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097781
AA Change: I551N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095388
Gene: ENSMUSG00000017264
AA Change: I551N

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 1.4e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173767
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.9%
  • 10x: 93.3%
  • 20x: 80.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C T 15: 82,064,152 T750I probably benign Het
5330417H12Rik T C 7: 107,624,817 probably benign Het
5730559C18Rik A T 1: 136,214,402 V653E probably damaging Het
9230109A22Rik C T 15: 25,138,938 noncoding transcript Het
Ahnak A G 19: 9,015,619 K4756E probably damaging Het
Ano5 A T 7: 51,570,421 probably null Het
Bmp6 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 13: 38,346,250 probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cbfa2t2 A T 2: 154,523,919 M350L probably benign Het
Ceacam20 A T 7: 19,976,097 M349L probably benign Het
Chd1 G T 17: 15,725,312 G33C probably damaging Het
Dhx40 A G 11: 86,799,484 V237A probably benign Het
Dlst G T 12: 85,123,864 D256Y probably damaging Het
Dmxl1 T A 18: 49,893,611 S1929T probably damaging Het
Faap100 T C 11: 120,378,340 D91G probably benign Het
Fbn1 T G 2: 125,412,749 Q198P possibly damaging Het
Flrt2 A G 12: 95,778,953 I22V probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Hist1h2bb A G 13: 23,747,159 Y122C probably benign Het
Kcnn1 T C 8: 70,852,688 I293V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Maats1 A G 16: 38,298,133 V768A probably benign Het
Mcpt9 G T 14: 56,028,668 Y34* probably null Het
Mepe A T 5: 104,327,073 M7L probably benign Het
Mprip A G 11: 59,743,814 Y383C probably damaging Het
Myh2 A T 11: 67,192,525 D1438V probably damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2l A G 3: 145,148,932 D510G probably damaging Het
Olfml2b A G 1: 170,649,782 D162G probably damaging Het
Oscp1 T C 4: 126,058,739 V20A probably benign Het
Pcdhb10 T C 18: 37,413,161 L430P probably damaging Het
Polq A G 16: 37,029,446 D354G possibly damaging Het
Rims1 C A 1: 22,483,175 V481F probably damaging Het
Ryr1 A G 7: 29,086,109 I1719T possibly damaging Het
Skiv2l2 G A 13: 112,917,622 A159V probably damaging Het
Smtn T C 11: 3,530,021 H400R probably benign Het
Snx33 A G 9: 56,925,985 Y267H probably damaging Het
Sstr1 T A 12: 58,213,620 M343K possibly damaging Het
Stx6 T C 1: 155,201,991 V248A probably benign Het
Tbx5 C T 5: 119,838,720 L58F probably damaging Het
Tmem241 A G 18: 12,064,214 Y186H probably damaging Het
Tnfaip8l3 T C 9: 54,027,476 K72E probably damaging Het
Trrap T A 5: 144,816,409 I1848N probably damaging Het
Xrcc6 G A 15: 82,022,941 V155I probably benign Het
Zfp458 T C 13: 67,256,209 E722G probably damaging Het
Zfyve1 G T 12: 83,548,051 H722Q possibly damaging Het
Other mutations in Exosc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Exosc10 APN 4 148565271 missense probably damaging 1.00
IGL01591:Exosc10 APN 4 148562887 unclassified probably benign
IGL01990:Exosc10 APN 4 148566410 missense possibly damaging 0.83
IGL02137:Exosc10 APN 4 148561133 missense probably damaging 0.97
IGL02186:Exosc10 APN 4 148565298 missense probably damaging 0.96
IGL02412:Exosc10 APN 4 148568392 missense probably benign 0.15
IGL02880:Exosc10 APN 4 148576183 missense probably damaging 1.00
R0172:Exosc10 UTSW 4 148565357 missense probably benign 0.02
R0267:Exosc10 UTSW 4 148562756 missense probably damaging 1.00
R0592:Exosc10 UTSW 4 148581113 missense probably benign
R1122:Exosc10 UTSW 4 148566364 missense possibly damaging 0.86
R1498:Exosc10 UTSW 4 148581786 missense possibly damaging 0.66
R1591:Exosc10 UTSW 4 148568383 missense probably benign 0.04
R1719:Exosc10 UTSW 4 148568503 missense probably damaging 1.00
R1760:Exosc10 UTSW 4 148578469 nonsense probably null
R3727:Exosc10 UTSW 4 148565277 missense probably damaging 1.00
R3842:Exosc10 UTSW 4 148563865 nonsense probably null
R3876:Exosc10 UTSW 4 148572919 missense probably benign 0.00
R4476:Exosc10 UTSW 4 148565324 missense probably damaging 0.98
R4750:Exosc10 UTSW 4 148562394 missense possibly damaging 0.69
R5306:Exosc10 UTSW 4 148562392 missense probably benign 0.13
R5438:Exosc10 UTSW 4 148566342 nonsense probably null
R5835:Exosc10 UTSW 4 148565387 missense probably damaging 1.00
R5925:Exosc10 UTSW 4 148573362 missense probably benign 0.01
R6116:Exosc10 UTSW 4 148573353 missense probably benign 0.08
R6217:Exosc10 UTSW 4 148582311 splice site probably null
R6365:Exosc10 UTSW 4 148561105 missense probably benign 0.13
R6495:Exosc10 UTSW 4 148562872 missense probably benign 0.45
R6498:Exosc10 UTSW 4 148573338 missense probably benign
R6772:Exosc10 UTSW 4 148581134 missense probably damaging 1.00
R7297:Exosc10 UTSW 4 148580377 missense probably damaging 1.00
R7523:Exosc10 UTSW 4 148563842 critical splice acceptor site probably null
R7698:Exosc10 UTSW 4 148558498 missense probably benign
R7967:Exosc10 UTSW 4 148564664 missense probably damaging 1.00
R8225:Exosc10 UTSW 4 148565204 missense possibly damaging 0.86
R8477:Exosc10 UTSW 4 148565390 missense possibly damaging 0.71
R8510:Exosc10 UTSW 4 148564189 missense probably damaging 1.00
Z1177:Exosc10 UTSW 4 148565386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATCCCATGTCCAGGTGTCAGG -3'
(R):5'- TCCTCAGGATGACTGAGAACAGGAG -3'

Sequencing Primer
(F):5'- tctgaccctcctgcttctg -3'
(R):5'- AGAGCAGCTCAGGGCTTTC -3'
Posted On2014-01-15