Incidental Mutation 'R1218:Zfyve1'
ID99844
Institutional Source Beutler Lab
Gene Symbol Zfyve1
Ensembl Gene ENSMUSG00000042628
Gene Namezinc finger, FYVE domain containing 1
Synonyms
MMRRC Submission 039287-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1218 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location83546558-83597222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83548051 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 722 (H722Q)
Ref Sequence ENSEMBL: ENSMUSP00000152501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048319] [ENSMUST00000221919] [ENSMUST00000222448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048319
AA Change: H722Q

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042224
Gene: ENSMUSG00000042628
AA Change: H722Q

DomainStartEndE-ValueType
low complexity region 429 436 N/A INTRINSIC
FYVE 590 660 8.36e-13 SMART
FYVE 707 776 1.15e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221228
Predicted Effect possibly damaging
Transcript: ENSMUST00000221919
AA Change: H722Q

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000222448
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.9%
  • 10x: 93.3%
  • 20x: 80.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The FYVE domain mediates the recruitment of proteins involved in membrane trafficking and cell signaling to phosphatidylinositol 3-phosphate-containing membranes. This protein contains two zinc-binding FYVE domains in tandem and is reported to localize to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C T 15: 82,064,152 T750I probably benign Het
5330417H12Rik T C 7: 107,624,817 probably benign Het
5730559C18Rik A T 1: 136,214,402 V653E probably damaging Het
9230109A22Rik C T 15: 25,138,938 noncoding transcript Het
Ahnak A G 19: 9,015,619 K4756E probably damaging Het
Ano5 A T 7: 51,570,421 probably null Het
Bmp6 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG 13: 38,346,250 probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cbfa2t2 A T 2: 154,523,919 M350L probably benign Het
Ceacam20 A T 7: 19,976,097 M349L probably benign Het
Chd1 G T 17: 15,725,312 G33C probably damaging Het
Dhx40 A G 11: 86,799,484 V237A probably benign Het
Dlst G T 12: 85,123,864 D256Y probably damaging Het
Dmxl1 T A 18: 49,893,611 S1929T probably damaging Het
Exosc10 T A 4: 148,570,401 I551N probably damaging Het
Faap100 T C 11: 120,378,340 D91G probably benign Het
Fbn1 T G 2: 125,412,749 Q198P possibly damaging Het
Flrt2 A G 12: 95,778,953 I22V probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Hist1h2bb A G 13: 23,747,159 Y122C probably benign Het
Kcnn1 T C 8: 70,852,688 I293V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Maats1 A G 16: 38,298,133 V768A probably benign Het
Mcpt9 G T 14: 56,028,668 Y34* probably null Het
Mepe A T 5: 104,327,073 M7L probably benign Het
Mprip A G 11: 59,743,814 Y383C probably damaging Het
Myh2 A T 11: 67,192,525 D1438V probably damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2l A G 3: 145,148,932 D510G probably damaging Het
Olfml2b A G 1: 170,649,782 D162G probably damaging Het
Oscp1 T C 4: 126,058,739 V20A probably benign Het
Pcdhb10 T C 18: 37,413,161 L430P probably damaging Het
Polq A G 16: 37,029,446 D354G possibly damaging Het
Rims1 C A 1: 22,483,175 V481F probably damaging Het
Ryr1 A G 7: 29,086,109 I1719T possibly damaging Het
Skiv2l2 G A 13: 112,917,622 A159V probably damaging Het
Smtn T C 11: 3,530,021 H400R probably benign Het
Snx33 A G 9: 56,925,985 Y267H probably damaging Het
Sstr1 T A 12: 58,213,620 M343K possibly damaging Het
Stx6 T C 1: 155,201,991 V248A probably benign Het
Tbx5 C T 5: 119,838,720 L58F probably damaging Het
Tmem241 A G 18: 12,064,214 Y186H probably damaging Het
Tnfaip8l3 T C 9: 54,027,476 K72E probably damaging Het
Trrap T A 5: 144,816,409 I1848N probably damaging Het
Xrcc6 G A 15: 82,022,941 V155I probably benign Het
Zfp458 T C 13: 67,256,209 E722G probably damaging Het
Other mutations in Zfyve1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Zfyve1 APN 12 83574798 missense probably benign 0.09
IGL00475:Zfyve1 APN 12 83555711 critical splice acceptor site probably null
IGL01291:Zfyve1 APN 12 83555005 missense probably benign 0.04
IGL01380:Zfyve1 APN 12 83552507 missense probably damaging 1.00
IGL02037:Zfyve1 APN 12 83547920 missense probably damaging 1.00
IGL02184:Zfyve1 APN 12 83558693 missense probably benign 0.29
IGL02619:Zfyve1 APN 12 83550944 unclassified probably benign
IGL03031:Zfyve1 APN 12 83574821 missense probably damaging 0.99
IGL03105:Zfyve1 APN 12 83558639 missense probably damaging 1.00
sasso UTSW 12 83575056 missense probably damaging 1.00
ANU05:Zfyve1 UTSW 12 83555005 missense probably benign 0.04
R0123:Zfyve1 UTSW 12 83555073 splice site probably benign
R0225:Zfyve1 UTSW 12 83555073 splice site probably benign
R0468:Zfyve1 UTSW 12 83555274 splice site probably benign
R1896:Zfyve1 UTSW 12 83555614 missense probably damaging 0.99
R2291:Zfyve1 UTSW 12 83547931 missense probably damaging 0.99
R4023:Zfyve1 UTSW 12 83594522 missense probably benign
R4026:Zfyve1 UTSW 12 83594522 missense probably benign
R4209:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4211:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4780:Zfyve1 UTSW 12 83558647 missense probably damaging 1.00
R4907:Zfyve1 UTSW 12 83574872 missense probably damaging 0.96
R4908:Zfyve1 UTSW 12 83551571 missense probably damaging 1.00
R4998:Zfyve1 UTSW 12 83548065 missense possibly damaging 0.69
R5076:Zfyve1 UTSW 12 83555647 missense probably damaging 1.00
R5303:Zfyve1 UTSW 12 83575056 missense probably damaging 1.00
R5628:Zfyve1 UTSW 12 83574889 missense probably benign 0.00
R5739:Zfyve1 UTSW 12 83575136 missense possibly damaging 0.61
R6007:Zfyve1 UTSW 12 83558704 missense probably damaging 1.00
R6355:Zfyve1 UTSW 12 83594641 missense probably benign 0.01
R6641:Zfyve1 UTSW 12 83594496 missense probably benign
R6735:Zfyve1 UTSW 12 83594844 missense possibly damaging 0.90
R7222:Zfyve1 UTSW 12 83555005 missense probably benign
R7278:Zfyve1 UTSW 12 83551540 missense probably damaging 1.00
R7464:Zfyve1 UTSW 12 83551487 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTCAGTGAGACTTCTGTTTCTAACCC -3'
(R):5'- AGAAGAACACAGCACAGTAATGGTTCTG -3'

Sequencing Primer
(F):5'- CTGTTTCTAACCCTGAGAACCTAAGG -3'
(R):5'- GTGTGCGGTTGGGATGG -3'
Posted On2014-01-15