Incidental Mutation 'R1219:Ccdc158'
ID99897
Institutional Source Beutler Lab
Gene Symbol Ccdc158
Ensembl Gene ENSMUSG00000050050
Gene Namecoiled-coil domain containing 158
Synonyms4932413O14Rik
MMRRC Submission 039288-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R1219 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92607954-92675271 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 92654181 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060930] [ENSMUST00000150359] [ENSMUST00000151180]
Predicted Effect probably benign
Transcript: ENSMUST00000060930
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150359
SMART Domains Protein: ENSMUSP00000123259
Gene: ENSMUSG00000050050

DomainStartEndE-ValueType
Pfam:CCDC158 1 346 1.5e-220 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151180
SMART Domains Protein: ENSMUSP00000117894
Gene: ENSMUSG00000050050

DomainStartEndE-ValueType
coiled coil region 71 105 N/A INTRINSIC
coiled coil region 127 166 N/A INTRINSIC
coiled coil region 244 343 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,946,470 L1266* probably null Het
Atad2 A G 15: 58,134,911 S22P probably benign Het
Atrn A T 2: 131,021,007 T1336S possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc113 T C 8: 95,538,267 probably benign Het
Ccdc155 A G 7: 45,189,408 probably benign Het
Dcun1d3 G T 7: 119,859,408 Q135K probably damaging Het
Dnah7b A C 1: 46,340,120 E3671D probably benign Het
Eea1 A G 10: 96,010,761 probably benign Het
Fam189b T C 3: 89,183,848 V42A probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm5111 A G 6: 48,590,394 probably benign Het
Golga3 G T 5: 110,184,349 E50* probably null Het
Junb T C 8: 84,977,639 E264G probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Krt18 T C 15: 102,031,288 probably benign Het
Man1a G A 10: 53,919,153 probably benign Het
Mapkbp1 G T 2: 120,019,350 G768* probably null Het
Mybpc2 A C 7: 44,516,034 probably null Het
Narfl T C 17: 25,775,101 I41T probably damaging Het
Nectin3 A T 16: 46,454,679 C238* probably null Het
Ntf3 G T 6: 126,102,211 R98S possibly damaging Het
Nup153 T G 13: 46,687,219 Q971P probably benign Het
Nup155 A G 15: 8,117,338 T221A possibly damaging Het
Ppp2r1b T C 9: 50,867,321 probably benign Het
Prkd1 A T 12: 50,388,342 V534E probably damaging Het
Rabep2 A G 7: 126,429,627 E26G probably damaging Het
Rnf213 C A 11: 119,436,177 N1663K probably damaging Het
Slc1a1 G A 19: 28,904,746 probably benign Het
Slc36a4 T C 9: 15,723,536 Y125H probably damaging Het
Slc6a11 G A 6: 114,225,811 probably benign Het
Stab1 C T 14: 31,140,621 probably null Het
Sumf2 G T 5: 129,854,772 A164S probably benign Het
Sv2b T C 7: 75,136,412 D420G probably benign Het
Ube2v1 T C 2: 167,617,911 D56G probably benign Het
Ung A G 5: 114,132,167 probably benign Het
Vcan T C 13: 89,679,904 Y2181C probably damaging Het
Vmn1r238 G A 18: 3,123,135 T93I possibly damaging Het
Vmn2r14 A C 5: 109,224,574 S17A probably benign Het
Vmn2r25 A G 6: 123,839,323 V433A probably benign Het
Zfp36l2 A G 17: 84,187,642 probably null Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp839 A G 12: 110,868,273 D654G possibly damaging Het
Other mutations in Ccdc158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ccdc158 APN 5 92657881 missense probably benign 0.01
IGL00926:Ccdc158 APN 5 92650767 missense probably damaging 0.98
IGL01533:Ccdc158 APN 5 92609956 splice site probably null
IGL01551:Ccdc158 APN 5 92666761 missense probably damaging 0.96
IGL01591:Ccdc158 APN 5 92662041 missense probably benign 0.28
IGL01722:Ccdc158 APN 5 92662739 missense possibly damaging 0.93
IGL02250:Ccdc158 APN 5 92608478 missense probably damaging 1.00
IGL02457:Ccdc158 APN 5 92650048 missense probably damaging 1.00
IGL02570:Ccdc158 APN 5 92649026 missense possibly damaging 0.81
IGL02951:Ccdc158 APN 5 92650006 missense probably damaging 1.00
IGL03275:Ccdc158 APN 5 92629632 missense probably benign 0.00
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0747:Ccdc158 UTSW 5 92633297 missense probably benign 0.00
R1480:Ccdc158 UTSW 5 92649044 missense probably damaging 1.00
R1926:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R2172:Ccdc158 UTSW 5 92632508 missense probably damaging 1.00
R2245:Ccdc158 UTSW 5 92609952 unclassified probably benign
R3004:Ccdc158 UTSW 5 92649070 missense probably damaging 1.00
R3147:Ccdc158 UTSW 5 92657963 missense probably damaging 1.00
R3693:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3694:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3735:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3736:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3912:Ccdc158 UTSW 5 92648935 missense possibly damaging 0.90
R4026:Ccdc158 UTSW 5 92643807 missense probably benign 0.07
R4080:Ccdc158 UTSW 5 92623396 missense probably benign 0.00
R4463:Ccdc158 UTSW 5 92634300 missense probably null 0.99
R4483:Ccdc158 UTSW 5 92633328 missense probably benign 0.01
R4859:Ccdc158 UTSW 5 92633403 missense probably damaging 0.99
R5016:Ccdc158 UTSW 5 92657892 missense probably benign 0.01
R5050:Ccdc158 UTSW 5 92666879 missense probably benign 0.01
R5372:Ccdc158 UTSW 5 92632560 missense possibly damaging 0.55
R5427:Ccdc158 UTSW 5 92648962 missense probably damaging 1.00
R5847:Ccdc158 UTSW 5 92627480 missense probably benign 0.00
R5966:Ccdc158 UTSW 5 92650049 missense probably damaging 1.00
R6106:Ccdc158 UTSW 5 92627466 missense probably benign
R6185:Ccdc158 UTSW 5 92666854 missense possibly damaging 0.73
R6562:Ccdc158 UTSW 5 92662722 missense probably damaging 0.99
R6743:Ccdc158 UTSW 5 92662146 missense probably benign 0.08
R6815:Ccdc158 UTSW 5 92612486 missense probably damaging 0.99
R6914:Ccdc158 UTSW 5 92662070 missense probably benign 0.00
R6975:Ccdc158 UTSW 5 92666720 nonsense probably null
R7252:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R7477:Ccdc158 UTSW 5 92650696 missense probably damaging 0.96
X0025:Ccdc158 UTSW 5 92662012 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCCATCTTCACTATGGACTAGGCAA -3'
(R):5'- CATGGTCTCCTTTGGTGTTTCAGTACA -3'

Sequencing Primer
(F):5'- TTCACTATGGACTAGGCAATCCAG -3'
(R):5'- tgggcagtaggagcagg -3'
Posted On2014-01-15