Incidental Mutation 'R1219:Mybpc2'
ID99915
Institutional Source Beutler Lab
Gene Symbol Mybpc2
Ensembl Gene ENSMUSG00000038670
Gene Namemyosin binding protein C, fast-type
SynonymsFast-type C-protein
MMRRC Submission 039288-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1219 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44501699-44524656 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 44516034 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165208]
PDB Structure
Solution structure of the fibronectin type-III domain of mouse myosin-binding protein C, Fast-type homolog [SOLUTION NMR]
Solution structure of the Ig-like domain(433- 525) of murine myosin-binding protein C, fast-type [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000165208
SMART Domains Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
IG 54 150 6.26e-5 SMART
PDB:2LHU|A 160 236 7e-9 PDB
low complexity region 237 252 N/A INTRINSIC
IG 258 337 5.21e-2 SMART
IG 347 430 1.2e-1 SMART
IG 440 526 2.72e-5 SMART
IG 546 631 1.68e-5 SMART
FN3 634 717 3.29e-11 SMART
FN3 732 815 1.23e-10 SMART
IG 842 925 6.07e-3 SMART
FN3 928 1010 2.08e-8 SMART
IGc2 1055 1122 6.91e-7 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. This family includes the fast-, slow- and cardiac-type isoforms, each of which is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The protein encoded by this locus is referred to as the fast-type isoform. Mutations in the related but distinct genes encoding the slow-type and cardiac-type isoforms have been associated with distal arthrogryposis, type 1 and hypertrophic cardiomyopathy, respectively. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,946,470 L1266* probably null Het
Atad2 A G 15: 58,134,911 S22P probably benign Het
Atrn A T 2: 131,021,007 T1336S possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc113 T C 8: 95,538,267 probably benign Het
Ccdc155 A G 7: 45,189,408 probably benign Het
Ccdc158 A G 5: 92,654,181 probably benign Het
Dcun1d3 G T 7: 119,859,408 Q135K probably damaging Het
Dnah7b A C 1: 46,340,120 E3671D probably benign Het
Eea1 A G 10: 96,010,761 probably benign Het
Fam189b T C 3: 89,183,848 V42A probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm5111 A G 6: 48,590,394 probably benign Het
Golga3 G T 5: 110,184,349 E50* probably null Het
Junb T C 8: 84,977,639 E264G probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Krt18 T C 15: 102,031,288 probably benign Het
Man1a G A 10: 53,919,153 probably benign Het
Mapkbp1 G T 2: 120,019,350 G768* probably null Het
Narfl T C 17: 25,775,101 I41T probably damaging Het
Nectin3 A T 16: 46,454,679 C238* probably null Het
Ntf3 G T 6: 126,102,211 R98S possibly damaging Het
Nup153 T G 13: 46,687,219 Q971P probably benign Het
Nup155 A G 15: 8,117,338 T221A possibly damaging Het
Ppp2r1b T C 9: 50,867,321 probably benign Het
Prkd1 A T 12: 50,388,342 V534E probably damaging Het
Rabep2 A G 7: 126,429,627 E26G probably damaging Het
Rnf213 C A 11: 119,436,177 N1663K probably damaging Het
Slc1a1 G A 19: 28,904,746 probably benign Het
Slc36a4 T C 9: 15,723,536 Y125H probably damaging Het
Slc6a11 G A 6: 114,225,811 probably benign Het
Stab1 C T 14: 31,140,621 probably null Het
Sumf2 G T 5: 129,854,772 A164S probably benign Het
Sv2b T C 7: 75,136,412 D420G probably benign Het
Ube2v1 T C 2: 167,617,911 D56G probably benign Het
Ung A G 5: 114,132,167 probably benign Het
Vcan T C 13: 89,679,904 Y2181C probably damaging Het
Vmn1r238 G A 18: 3,123,135 T93I possibly damaging Het
Vmn2r14 A C 5: 109,224,574 S17A probably benign Het
Vmn2r25 A G 6: 123,839,323 V433A probably benign Het
Zfp36l2 A G 17: 84,187,642 probably null Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp839 A G 12: 110,868,273 D654G possibly damaging Het
Other mutations in Mybpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Mybpc2 APN 7 44505405 unclassified probably benign
IGL00586:Mybpc2 APN 7 44505382 missense probably damaging 0.96
IGL00976:Mybpc2 APN 7 44522317 splice site probably null
IGL01099:Mybpc2 APN 7 44516167 missense probably damaging 0.99
IGL01348:Mybpc2 APN 7 44515928 missense probably benign
IGL01625:Mybpc2 APN 7 44516913 missense possibly damaging 0.65
IGL01733:Mybpc2 APN 7 44506198 missense probably benign 0.03
IGL01946:Mybpc2 APN 7 44509898 unclassified probably benign
IGL02078:Mybpc2 APN 7 44503780 missense probably damaging 1.00
IGL02314:Mybpc2 APN 7 44522388 missense possibly damaging 0.82
IGL02341:Mybpc2 APN 7 44514930 missense probably benign 0.00
IGL02904:Mybpc2 APN 7 44522341 missense probably benign 0.05
IGL03034:Mybpc2 APN 7 44511897 missense possibly damaging 0.87
IGL03296:Mybpc2 APN 7 44506884 missense probably damaging 1.00
R0094:Mybpc2 UTSW 7 44516904 missense probably damaging 1.00
R0329:Mybpc2 UTSW 7 44509029 missense possibly damaging 0.94
R0330:Mybpc2 UTSW 7 44509029 missense possibly damaging 0.94
R0336:Mybpc2 UTSW 7 44505616 missense probably damaging 1.00
R0503:Mybpc2 UTSW 7 44512570 unclassified probably benign
R0821:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0822:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0823:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0854:Mybpc2 UTSW 7 44517002 missense probably benign 0.06
R0938:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0939:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0940:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0941:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R1166:Mybpc2 UTSW 7 44505025 missense possibly damaging 0.84
R1559:Mybpc2 UTSW 7 44513687 missense probably benign 0.01
R1732:Mybpc2 UTSW 7 44513675 missense probably benign
R1802:Mybpc2 UTSW 7 44512470 missense possibly damaging 0.81
R2157:Mybpc2 UTSW 7 44509845 missense possibly damaging 0.93
R2216:Mybpc2 UTSW 7 44512500 splice site probably null
R2406:Mybpc2 UTSW 7 44521725 missense possibly damaging 0.62
R2411:Mybpc2 UTSW 7 44506238 missense probably damaging 1.00
R3079:Mybpc2 UTSW 7 44506081 missense probably damaging 1.00
R4663:Mybpc2 UTSW 7 44505642 missense probably damaging 0.99
R4736:Mybpc2 UTSW 7 44512547 missense probably damaging 1.00
R5316:Mybpc2 UTSW 7 44520382 nonsense probably null
R5426:Mybpc2 UTSW 7 44509829 missense probably benign 0.01
R5498:Mybpc2 UTSW 7 44516265 missense probably damaging 1.00
R5539:Mybpc2 UTSW 7 44514893 missense probably benign 0.17
R5644:Mybpc2 UTSW 7 44507053 missense probably benign 0.13
R5909:Mybpc2 UTSW 7 44507091 missense probably damaging 1.00
R6435:Mybpc2 UTSW 7 44506057 missense possibly damaging 0.73
R6662:Mybpc2 UTSW 7 44506166 missense probably benign
R6901:Mybpc2 UTSW 7 44505355 missense probably damaging 0.99
R7188:Mybpc2 UTSW 7 44506193 missense probably benign 0.06
R7389:Mybpc2 UTSW 7 44505604 missense probably benign 0.11
R7405:Mybpc2 UTSW 7 44507194 missense probably damaging 1.00
R7553:Mybpc2 UTSW 7 44506147 missense possibly damaging 0.51
R7597:Mybpc2 UTSW 7 44509799 missense probably damaging 1.00
R7772:Mybpc2 UTSW 7 44515924 critical splice donor site probably null
R7824:Mybpc2 UTSW 7 44504860 splice site probably null
R8003:Mybpc2 UTSW 7 44509064 missense probably damaging 0.99
R8179:Mybpc2 UTSW 7 44509830 missense probably benign 0.01
R8187:Mybpc2 UTSW 7 44512470 missense possibly damaging 0.81
X0052:Mybpc2 UTSW 7 44507142 missense probably benign 0.23
X0065:Mybpc2 UTSW 7 44505385 missense probably benign 0.01
Z1088:Mybpc2 UTSW 7 44516503 missense possibly damaging 0.47
Z1176:Mybpc2 UTSW 7 44521696 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATCTGTGCTCAGCTCAGAAACC -3'
(R):5'- GTTGTGCCCTCTATAATGGCTGCTC -3'

Sequencing Primer
(F):5'- TCAGCTCAGAAACCAAAGCTC -3'
(R):5'- AATGGCTGCTCTCATACTAGG -3'
Posted On2014-01-15