Incidental Mutation 'R1219:Zfp646'
ID99925
Institutional Source Beutler Lab
Gene Symbol Zfp646
Ensembl Gene ENSMUSG00000049739
Gene Namezinc finger protein 646
Synonyms
MMRRC Submission 039288-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1219 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127876221-127885996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127883120 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 1490 (G1490S)
Ref Sequence ENSEMBL: ENSMUSP00000052641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050383] [ENSMUST00000121394] [ENSMUST00000131000] [ENSMUST00000205300]
Predicted Effect probably benign
Transcript: ENSMUST00000050383
AA Change: G1490S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052641
Gene: ENSMUSG00000049739
AA Change: G1490S

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
ZnF_C2H2 566 588 2.32e-1 SMART
ZnF_C2H2 606 628 6.32e-3 SMART
ZnF_C2H2 633 655 1.53e-1 SMART
low complexity region 737 750 N/A INTRINSIC
low complexity region 786 797 N/A INTRINSIC
ZnF_C2H2 806 828 2.17e-1 SMART
ZnF_C2H2 833 855 3.69e-4 SMART
ZnF_C2H2 866 889 1.16e-1 SMART
low complexity region 890 911 N/A INTRINSIC
ZnF_C2H2 941 961 9.31e1 SMART
ZnF_C2H2 1035 1057 1.95e-3 SMART
ZnF_C2H2 1062 1084 3.39e-3 SMART
low complexity region 1149 1163 N/A INTRINSIC
ZnF_C2H2 1170 1192 1.58e-3 SMART
ZnF_C2H2 1197 1219 5.42e-2 SMART
ZnF_C2H2 1225 1247 3.69e-4 SMART
ZnF_C2H2 1266 1286 5.12e1 SMART
ZnF_C2H2 1293 1315 3.69e-4 SMART
ZnF_C2H2 1333 1355 3.11e-2 SMART
ZnF_C2H2 1550 1572 5.9e-3 SMART
ZnF_C2H2 1640 1662 1.08e-1 SMART
ZnF_C2H2 1667 1689 4.11e-2 SMART
ZnF_C2H2 1695 1717 4.11e-2 SMART
ZnF_C2H2 1724 1746 1.45e-2 SMART
low complexity region 1751 1764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121394
SMART Domains Protein: ENSMUSP00000112972
Gene: ENSMUSG00000044139

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 38 268 3.91e-45 SMART
Tryp_SPc 300 520 9.95e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126662
SMART Domains Protein: ENSMUSP00000123566
Gene: ENSMUSG00000030804

DomainStartEndE-ValueType
VKc 1 111 8.84e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131000
SMART Domains Protein: ENSMUSP00000115499
Gene: ENSMUSG00000049739

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205364
Predicted Effect unknown
Transcript: ENSMUST00000206340
AA Change: G1270S
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,946,470 L1266* probably null Het
Atad2 A G 15: 58,134,911 S22P probably benign Het
Atrn A T 2: 131,021,007 T1336S possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc113 T C 8: 95,538,267 probably benign Het
Ccdc155 A G 7: 45,189,408 probably benign Het
Ccdc158 A G 5: 92,654,181 probably benign Het
Dcun1d3 G T 7: 119,859,408 Q135K probably damaging Het
Dnah7b A C 1: 46,340,120 E3671D probably benign Het
Eea1 A G 10: 96,010,761 probably benign Het
Fam189b T C 3: 89,183,848 V42A probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm5111 A G 6: 48,590,394 probably benign Het
Golga3 G T 5: 110,184,349 E50* probably null Het
Junb T C 8: 84,977,639 E264G probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Krt18 T C 15: 102,031,288 probably benign Het
Man1a G A 10: 53,919,153 probably benign Het
Mapkbp1 G T 2: 120,019,350 G768* probably null Het
Mybpc2 A C 7: 44,516,034 probably null Het
Narfl T C 17: 25,775,101 I41T probably damaging Het
Nectin3 A T 16: 46,454,679 C238* probably null Het
Ntf3 G T 6: 126,102,211 R98S possibly damaging Het
Nup153 T G 13: 46,687,219 Q971P probably benign Het
Nup155 A G 15: 8,117,338 T221A possibly damaging Het
Ppp2r1b T C 9: 50,867,321 probably benign Het
Prkd1 A T 12: 50,388,342 V534E probably damaging Het
Rabep2 A G 7: 126,429,627 E26G probably damaging Het
Rnf213 C A 11: 119,436,177 N1663K probably damaging Het
Slc1a1 G A 19: 28,904,746 probably benign Het
Slc36a4 T C 9: 15,723,536 Y125H probably damaging Het
Slc6a11 G A 6: 114,225,811 probably benign Het
Stab1 C T 14: 31,140,621 probably null Het
Sumf2 G T 5: 129,854,772 A164S probably benign Het
Sv2b T C 7: 75,136,412 D420G probably benign Het
Ube2v1 T C 2: 167,617,911 D56G probably benign Het
Ung A G 5: 114,132,167 probably benign Het
Vcan T C 13: 89,679,904 Y2181C probably damaging Het
Vmn1r238 G A 18: 3,123,135 T93I possibly damaging Het
Vmn2r14 A C 5: 109,224,574 S17A probably benign Het
Vmn2r25 A G 6: 123,839,323 V433A probably benign Het
Zfp36l2 A G 17: 84,187,642 probably null Het
Zfp839 A G 12: 110,868,273 D654G possibly damaging Het
Other mutations in Zfp646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Zfp646 APN 7 127879130 missense possibly damaging 0.91
IGL01669:Zfp646 APN 7 127878965 missense probably benign
IGL02571:Zfp646 APN 7 127879412 missense probably damaging 1.00
R0009:Zfp646 UTSW 7 127880731 missense probably damaging 0.96
R0084:Zfp646 UTSW 7 127881304 missense possibly damaging 0.86
R0140:Zfp646 UTSW 7 127883506 missense probably benign 0.41
R0394:Zfp646 UTSW 7 127883262 missense possibly damaging 0.85
R0571:Zfp646 UTSW 7 127881966 missense probably damaging 0.96
R0924:Zfp646 UTSW 7 127883810 nonsense probably null
R0930:Zfp646 UTSW 7 127883810 nonsense probably null
R1221:Zfp646 UTSW 7 127883120 missense probably benign
R1351:Zfp646 UTSW 7 127883511 missense probably benign
R1370:Zfp646 UTSW 7 127879864 missense probably damaging 1.00
R1503:Zfp646 UTSW 7 127880136 missense probably damaging 1.00
R1605:Zfp646 UTSW 7 127880187 splice site probably null
R1817:Zfp646 UTSW 7 127883120 missense probably benign
R1818:Zfp646 UTSW 7 127883120 missense probably benign
R1819:Zfp646 UTSW 7 127883120 missense probably benign
R1838:Zfp646 UTSW 7 127879739 missense probably damaging 1.00
R1870:Zfp646 UTSW 7 127883849 missense possibly damaging 0.85
R2100:Zfp646 UTSW 7 127882187 missense probably damaging 1.00
R2763:Zfp646 UTSW 7 127880038 nonsense probably null
R4346:Zfp646 UTSW 7 127879509 missense probably damaging 1.00
R4770:Zfp646 UTSW 7 127883477 missense possibly damaging 0.83
R4824:Zfp646 UTSW 7 127883735 missense probably benign 0.00
R4936:Zfp646 UTSW 7 127881761 missense possibly damaging 0.93
R4937:Zfp646 UTSW 7 127879182 missense probably benign 0.01
R5062:Zfp646 UTSW 7 127880499 missense probably damaging 0.99
R5424:Zfp646 UTSW 7 127882703 missense possibly damaging 0.72
R5610:Zfp646 UTSW 7 127879358 missense probably damaging 1.00
R5729:Zfp646 UTSW 7 127885454 missense probably damaging 0.99
R6112:Zfp646 UTSW 7 127879018 missense possibly damaging 0.71
R6161:Zfp646 UTSW 7 127878725 missense probably damaging 1.00
R6310:Zfp646 UTSW 7 127883907 missense probably benign 0.13
R6331:Zfp646 UTSW 7 127883681 missense probably damaging 0.99
R6436:Zfp646 UTSW 7 127879941 missense probably benign 0.00
R6814:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6872:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6903:Zfp646 UTSW 7 127880720 missense possibly damaging 0.91
R7018:Zfp646 UTSW 7 127882322 missense probably benign
R7049:Zfp646 UTSW 7 127880027 missense possibly damaging 0.93
R7121:Zfp646 UTSW 7 127879772 missense possibly damaging 0.95
R7405:Zfp646 UTSW 7 127878796 nonsense probably null
R8345:Zfp646 UTSW 7 127883910 missense probably benign 0.12
Z1177:Zfp646 UTSW 7 127880632 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GACAAATGAACCACAATGGTGCCTG -3'
(R):5'- GACCTGACATCTGACTGTGCTCAAC -3'

Sequencing Primer
(F):5'- ACACTGTCTCCAGGAATCCT -3'
(R):5'- TGTGCTCAACAGCATGAGTC -3'
Posted On2014-01-15