Incidental Mutation 'R1219:Zfp839'
ID99943
Institutional Source Beutler Lab
Gene Symbol Zfp839
Ensembl Gene ENSMUSG00000021271
Gene Namezinc finger protein 839
Synonyms2810455K09Rik
MMRRC Submission 039288-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1219 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location110850253-110869996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110868273 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 654 (D654G)
Ref Sequence ENSEMBL: ENSMUSP00000131841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043716] [ENSMUST00000170060] [ENSMUST00000220607] [ENSMUST00000222460]
Predicted Effect probably benign
Transcript: ENSMUST00000043716
SMART Domains Protein: ENSMUSP00000035245
Gene: ENSMUSG00000021276

DomainStartEndE-ValueType
low complexity region 54 78 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170060
AA Change: D654G

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131841
Gene: ENSMUSG00000021271
AA Change: D654G

DomainStartEndE-ValueType
low complexity region 271 278 N/A INTRINSIC
ZnF_C2H2 295 320 3.02e0 SMART
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220607
Predicted Effect probably benign
Transcript: ENSMUST00000222460
AA Change: D578G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,946,470 L1266* probably null Het
Atad2 A G 15: 58,134,911 S22P probably benign Het
Atrn A T 2: 131,021,007 T1336S possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc113 T C 8: 95,538,267 probably benign Het
Ccdc155 A G 7: 45,189,408 probably benign Het
Ccdc158 A G 5: 92,654,181 probably benign Het
Dcun1d3 G T 7: 119,859,408 Q135K probably damaging Het
Dnah7b A C 1: 46,340,120 E3671D probably benign Het
Eea1 A G 10: 96,010,761 probably benign Het
Fam189b T C 3: 89,183,848 V42A probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm5111 A G 6: 48,590,394 probably benign Het
Golga3 G T 5: 110,184,349 E50* probably null Het
Junb T C 8: 84,977,639 E264G probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Krt18 T C 15: 102,031,288 probably benign Het
Man1a G A 10: 53,919,153 probably benign Het
Mapkbp1 G T 2: 120,019,350 G768* probably null Het
Mybpc2 A C 7: 44,516,034 probably null Het
Narfl T C 17: 25,775,101 I41T probably damaging Het
Nectin3 A T 16: 46,454,679 C238* probably null Het
Ntf3 G T 6: 126,102,211 R98S possibly damaging Het
Nup153 T G 13: 46,687,219 Q971P probably benign Het
Nup155 A G 15: 8,117,338 T221A possibly damaging Het
Ppp2r1b T C 9: 50,867,321 probably benign Het
Prkd1 A T 12: 50,388,342 V534E probably damaging Het
Rabep2 A G 7: 126,429,627 E26G probably damaging Het
Rnf213 C A 11: 119,436,177 N1663K probably damaging Het
Slc1a1 G A 19: 28,904,746 probably benign Het
Slc36a4 T C 9: 15,723,536 Y125H probably damaging Het
Slc6a11 G A 6: 114,225,811 probably benign Het
Stab1 C T 14: 31,140,621 probably null Het
Sumf2 G T 5: 129,854,772 A164S probably benign Het
Sv2b T C 7: 75,136,412 D420G probably benign Het
Ube2v1 T C 2: 167,617,911 D56G probably benign Het
Ung A G 5: 114,132,167 probably benign Het
Vcan T C 13: 89,679,904 Y2181C probably damaging Het
Vmn1r238 G A 18: 3,123,135 T93I possibly damaging Het
Vmn2r14 A C 5: 109,224,574 S17A probably benign Het
Vmn2r25 A G 6: 123,839,323 V433A probably benign Het
Zfp36l2 A G 17: 84,187,642 probably null Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Other mutations in Zfp839
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Zfp839 APN 12 110865007 critical splice donor site probably null
IGL00941:Zfp839 APN 12 110860948 missense probably damaging 1.00
R0013:Zfp839 UTSW 12 110868386 missense possibly damaging 0.66
R0013:Zfp839 UTSW 12 110868386 missense possibly damaging 0.66
R0109:Zfp839 UTSW 12 110860874 missense possibly damaging 0.92
R0116:Zfp839 UTSW 12 110858769 intron probably benign
R1406:Zfp839 UTSW 12 110866310 missense probably damaging 0.99
R1406:Zfp839 UTSW 12 110866310 missense probably damaging 0.99
R1434:Zfp839 UTSW 12 110860899 missense probably benign 0.08
R1653:Zfp839 UTSW 12 110855250 missense probably benign 0.02
R1754:Zfp839 UTSW 12 110855457 missense probably damaging 0.98
R2182:Zfp839 UTSW 12 110868338 missense probably damaging 1.00
R3765:Zfp839 UTSW 12 110855163 missense probably benign 0.22
R3981:Zfp839 UTSW 12 110866331 missense probably damaging 0.97
R4756:Zfp839 UTSW 12 110855201 missense possibly damaging 0.92
R5088:Zfp839 UTSW 12 110868176 missense probably damaging 0.99
R5394:Zfp839 UTSW 12 110855586 missense probably benign 0.05
R5619:Zfp839 UTSW 12 110864036 missense probably damaging 1.00
R6856:Zfp839 UTSW 12 110866761 nonsense probably null
R7661:Zfp839 UTSW 12 110868792 missense probably benign 0.32
R7860:Zfp839 UTSW 12 110855626 missense probably damaging 1.00
R8022:Zfp839 UTSW 12 110855098 missense probably damaging 1.00
Z1177:Zfp839 UTSW 12 110866784 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCCCTGCTAAACTCTCTTGGAATG -3'
(R):5'- ACGGCCCCAGAATCCTGATACATAG -3'

Sequencing Primer
(F):5'- GGAAGCCCATTTTGAACAGC -3'
(R):5'- CCAGAATCCTGATACATAGTGTGTTC -3'
Posted On2014-01-15