Incidental Mutation 'R1220:Rabgap1l'
ID99977
Institutional Source Beutler Lab
Gene Symbol Rabgap1l
Ensembl Gene ENSMUSG00000026721
Gene NameRAB GTPase activating protein 1-like
SynonymsHh1, 8430421H08Rik, 5830411O09Rik, 9630005B12Rik
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location160219174-160793211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 160738909 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 106 (D106E)
Ref Sequence ENSEMBL: ENSMUSP00000141749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028049] [ENSMUST00000193810] [ENSMUST00000195442]
Predicted Effect probably benign
Transcript: ENSMUST00000028049
AA Change: D106E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028049
Gene: ENSMUSG00000026721
AA Change: D106E

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
PTB 127 260 4.47e-20 SMART
Pfam:DUF3694 290 421 8.1e-41 PFAM
low complexity region 483 496 N/A INTRINSIC
TBC 535 747 5.13e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193810
AA Change: D106E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141749
Gene: ENSMUSG00000026721
AA Change: D106E

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
Blast:PTB 127 147 6e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195442
AA Change: D78E

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141666
Gene: ENSMUSG00000026721
AA Change: D78E

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
PTB 99 232 4.47e-20 SMART
Pfam:DUF3694 262 394 1.4e-42 PFAM
Meta Mutation Damage Score 0.0823 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion are viable, fertile and overtly normal with no alterations in hematopoietic progenitor cell numbers or types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Rabgap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Rabgap1l APN 1 160738969 missense probably benign 0.02
IGL01309:Rabgap1l APN 1 160700798 missense probably benign 0.00
IGL01448:Rabgap1l APN 1 160740745 splice site probably benign
IGL01886:Rabgap1l APN 1 160342042 missense probably damaging 1.00
IGL02010:Rabgap1l APN 1 160472071 missense probably damaging 0.99
IGL02079:Rabgap1l APN 1 160738970 missense probably benign 0.00
IGL02800:Rabgap1l APN 1 160472053 missense possibly damaging 0.73
IGL03343:Rabgap1l APN 1 160443283 missense probably benign
IGL03388:Rabgap1l APN 1 160733523 splice site probably null
IGL03406:Rabgap1l APN 1 160722169 missense probably damaging 1.00
amerigo UTSW 1 160724036 missense probably damaging 1.00
hispaniola UTSW 1 160645307 critical splice donor site probably null
R0047:Rabgap1l UTSW 1 160231789 splice site probably benign
R0047:Rabgap1l UTSW 1 160231789 splice site probably benign
R0048:Rabgap1l UTSW 1 160627369 splice site probably benign
R0099:Rabgap1l UTSW 1 160682116 missense possibly damaging 0.89
R0201:Rabgap1l UTSW 1 160453745 splice site probably benign
R0432:Rabgap1l UTSW 1 160722205 missense probably benign 0.10
R1104:Rabgap1l UTSW 1 160231875 splice site probably benign
R1485:Rabgap1l UTSW 1 160733680 missense probably benign 0.06
R1569:Rabgap1l UTSW 1 160702390 missense probably benign 0.08
R1907:Rabgap1l UTSW 1 160645310 missense probably benign 0.07
R2128:Rabgap1l UTSW 1 160738957 missense probably benign 0.00
R2129:Rabgap1l UTSW 1 160738957 missense probably benign 0.00
R2177:Rabgap1l UTSW 1 160724062 missense possibly damaging 0.89
R4636:Rabgap1l UTSW 1 160342090 splice site probably null
R4722:Rabgap1l UTSW 1 160342164 missense possibly damaging 0.81
R4743:Rabgap1l UTSW 1 160453783 missense probably damaging 1.00
R4913:Rabgap1l UTSW 1 160238541 missense probably damaging 1.00
R4915:Rabgap1l UTSW 1 160441842 missense probably benign 0.01
R5035:Rabgap1l UTSW 1 160724036 missense probably damaging 1.00
R5087:Rabgap1l UTSW 1 160722239 missense probably damaging 1.00
R5437:Rabgap1l UTSW 1 160722147 missense probably damaging 1.00
R5507:Rabgap1l UTSW 1 160351328 missense possibly damaging 0.83
R5619:Rabgap1l UTSW 1 160238572 missense probably benign 0.00
R5691:Rabgap1l UTSW 1 160735684 missense probably damaging 1.00
R5837:Rabgap1l UTSW 1 160307222 utr 3 prime probably benign
R5881:Rabgap1l UTSW 1 160342113 missense probably damaging 1.00
R6045:Rabgap1l UTSW 1 160645323 missense probably benign 0.00
R6243:Rabgap1l UTSW 1 160645307 critical splice donor site probably null
R6294:Rabgap1l UTSW 1 160231849 missense probably benign 0.14
R6452:Rabgap1l UTSW 1 160453761 missense probably damaging 1.00
R6802:Rabgap1l UTSW 1 160733680 missense probably benign 0.06
R6945:Rabgap1l UTSW 1 160682182 missense probably benign 0.29
R7014:Rabgap1l UTSW 1 160342072 missense probably damaging 1.00
R7062:Rabgap1l UTSW 1 160226650 missense probably benign
R7089:Rabgap1l UTSW 1 160724172 nonsense probably null
R7170:Rabgap1l UTSW 1 160645365 missense probably damaging 1.00
R7172:Rabgap1l UTSW 1 160733586 missense probably benign 0.05
R7303:Rabgap1l UTSW 1 160682097 missense probably benign 0.01
R7357:Rabgap1l UTSW 1 160342038 missense probably damaging 1.00
R7466:Rabgap1l UTSW 1 160226484 critical splice donor site probably null
R7501:Rabgap1l UTSW 1 160700788 missense probably damaging 0.98
R7565:Rabgap1l UTSW 1 160251417 missense
R7582:Rabgap1l UTSW 1 160682084 missense probably benign
R7740:Rabgap1l UTSW 1 160682103 missense probably benign 0.01
R7978:Rabgap1l UTSW 1 160251268 missense
R7993:Rabgap1l UTSW 1 160700854 missense probably damaging 1.00
R8116:Rabgap1l UTSW 1 160702442 missense probably benign 0.22
R8672:Rabgap1l UTSW 1 160443276 missense probably damaging 1.00
Z1177:Rabgap1l UTSW 1 160739073 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAGGCCCTTCTGAATGGCACTG -3'
(R):5'- TGCTCTGCCTTTAGATAGCTTCCAATG -3'

Sequencing Primer
(F):5'- cacccaaatgccaacttgac -3'
(R):5'- TAGCTTCCAATGGTGATGAGCAG -3'
Posted On2014-01-15