Incidental Mutation 'R1220:Slamf9'
ID 99979
Institutional Source Beutler Lab
Gene Symbol Slamf9
Ensembl Gene ENSMUSG00000026548
Gene Name SLAM family member 9
Synonyms CD2F-10, Cd2f10, CD84-H1, SF2001, 2310026I04Rik
MMRRC Submission 039289-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1220 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 172302927-172305976 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 172304898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 171 (Q171K)
Ref Sequence ENSEMBL: ENSMUSP00000027830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027830] [ENSMUST00000052629] [ENSMUST00000111235] [ENSMUST00000127052] [ENSMUST00000127482] [ENSMUST00000135267]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027830
AA Change: Q171K

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027830
Gene: ENSMUSG00000026548
AA Change: Q171K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 25 128 2.68e-4 SMART
Blast:IG_like 139 198 7e-8 BLAST
low complexity region 199 216 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052629
SMART Domains Protein: ENSMUSP00000058275
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111235
SMART Domains Protein: ENSMUSP00000106866
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127052
SMART Domains Protein: ENSMUSP00000123401
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 26 109 6e-55 BLAST
SCOP:d1biha2 28 108 6e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127482
SMART Domains Protein: ENSMUSP00000117854
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132141
Predicted Effect probably benign
Transcript: ENSMUST00000135267
SMART Domains Protein: ENSMUSP00000116948
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
IG_like 4 68 3.29e1 SMART
IGc2 86 148 3.03e-12 SMART
low complexity region 156 168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192784
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signaling lymphocytic activation molecule family. The encoded protein is a cell surface molecule that consists of two extracellular immunoglobulin domains, a transmembrane domain and a short cytoplasmic tail that lacks the signal transduction motifs found in other family members. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,257,537 (GRCm39) S407R probably benign Het
Add2 A T 6: 86,063,982 (GRCm39) M94L possibly damaging Het
Anks6 A T 4: 47,025,767 (GRCm39) probably benign Het
Atxn1 A G 13: 45,710,899 (GRCm39) S678P probably benign Het
Ccnc A G 4: 21,732,491 (GRCm39) Y76C probably damaging Het
Col1a1 G T 11: 94,841,957 (GRCm39) A1335S unknown Het
Col25a1 G T 3: 130,182,574 (GRCm39) probably benign Het
Commd10 C A 18: 47,220,107 (GRCm39) Q195K probably damaging Het
Cps1 G A 1: 67,243,862 (GRCm39) probably null Het
Cramp1 A T 17: 25,201,211 (GRCm39) V757D probably damaging Het
Cttn T C 7: 144,017,699 (GRCm39) T13A probably benign Het
Eftud2 A G 11: 102,742,573 (GRCm39) probably benign Het
Eif4enif1 A G 11: 3,189,493 (GRCm39) probably benign Het
Exoc3l2 T A 7: 19,225,709 (GRCm39) probably benign Het
Fam118b T C 9: 35,134,969 (GRCm39) S213G possibly damaging Het
Katnal1 G A 5: 148,831,061 (GRCm39) A171V probably benign Het
Lrig3 A G 10: 125,832,945 (GRCm39) N273S probably damaging Het
Lrriq1 G A 10: 102,906,990 (GRCm39) R1577W probably benign Het
Or1e26 A C 11: 73,480,203 (GRCm39) Y120* probably null Het
Or5p70 T A 7: 107,994,539 (GRCm39) S71T probably benign Het
Pmel A G 10: 128,549,929 (GRCm39) D30G probably benign Het
Ppp1r15a T C 7: 45,173,293 (GRCm39) Y505C probably damaging Het
Prpf40b C T 15: 99,214,229 (GRCm39) R830C probably benign Het
Rabgap1l A T 1: 160,566,479 (GRCm39) D106E probably damaging Het
Rad18 C A 6: 112,626,625 (GRCm39) E141* probably null Het
Ros1 C T 10: 51,974,966 (GRCm39) V1540M probably damaging Het
Secisbp2 G A 13: 51,810,941 (GRCm39) R201H probably damaging Het
Shisa6 A G 11: 66,110,836 (GRCm39) S302P probably damaging Het
Sox6 T A 7: 115,261,677 (GRCm39) T180S probably damaging Het
Ttn T C 2: 76,553,998 (GRCm39) S30902G possibly damaging Het
Xirp1 A G 9: 119,846,982 (GRCm39) F634L possibly damaging Het
Yrdc T A 4: 124,748,329 (GRCm39) S278T possibly damaging Het
Other mutations in Slamf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0020:Slamf9 UTSW 1 172,303,082 (GRCm39) missense possibly damaging 0.84
R1646:Slamf9 UTSW 1 172,304,907 (GRCm39) missense probably benign 0.00
R2321:Slamf9 UTSW 1 172,304,980 (GRCm39) missense probably damaging 1.00
R4124:Slamf9 UTSW 1 172,303,808 (GRCm39) missense probably damaging 1.00
R4826:Slamf9 UTSW 1 172,304,008 (GRCm39) missense probably benign 0.01
R4831:Slamf9 UTSW 1 172,304,831 (GRCm39) nonsense probably null
R5010:Slamf9 UTSW 1 172,303,780 (GRCm39) missense possibly damaging 0.80
R5223:Slamf9 UTSW 1 172,303,799 (GRCm39) missense possibly damaging 0.89
R5864:Slamf9 UTSW 1 172,304,033 (GRCm39) missense probably benign 0.25
R7480:Slamf9 UTSW 1 172,305,040 (GRCm39) missense probably damaging 1.00
R8145:Slamf9 UTSW 1 172,303,942 (GRCm39) missense probably benign 0.37
R9045:Slamf9 UTSW 1 172,304,938 (GRCm39) missense probably damaging 0.96
R9747:Slamf9 UTSW 1 172,305,782 (GRCm39) missense unknown
X0054:Slamf9 UTSW 1 172,305,668 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGCTCTCGAAGCCTTTATTCCC -3'
(R):5'- TTGCACAGGCTCAGGAATGGTG -3'

Sequencing Primer
(F):5'- GCCACATTGAATCTACTTTGGG -3'
(R):5'- CAGGAATGGTGTCTTGGGC -3'
Posted On 2014-01-15