Incidental Mutation 'R1220:Ccnc'
ID99985
Institutional Source Beutler Lab
Gene Symbol Ccnc
Ensembl Gene ENSMUSG00000028252
Gene Namecyclin C
Synonyms
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location21727701-21759922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21732491 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 76 (Y76C)
Ref Sequence ENSEMBL: ENSMUSP00000103875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065928] [ENSMUST00000102997] [ENSMUST00000108240] [ENSMUST00000120679]
Predicted Effect probably damaging
Transcript: ENSMUST00000065928
AA Change: Y76C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069076
Gene: ENSMUSG00000028252
AA Change: Y76C

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102997
AA Change: Y76C

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100062
Gene: ENSMUSG00000028252
AA Change: Y76C

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108240
AA Change: Y76C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103875
Gene: ENSMUSG00000028252
AA Change: Y76C

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120679
AA Change: Y76C

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113682
Gene: ENSMUSG00000028252
AA Change: Y76C

DomainStartEndE-ValueType
CYCLIN 46 144 2.41e-13 SMART
CYCLIN 157 236 4.11e-7 SMART
low complexity region 258 264 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145288
Meta Mutation Damage Score 0.1302 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin family of proteins. The encoded protein interacts with cyclin-dependent kinase 8 and induces the phophorylation of the carboxy-terminal domain of the large subunit of RNA polymerase II. The level of mRNAs for this gene peaks in the G1 phase of the cell cycle. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die prenatally and exhibit growth retardation and placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Ccnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ccnc APN 4 21742642 nonsense probably null
IGL01536:Ccnc APN 4 21732505 missense probably benign 0.01
IGL03083:Ccnc APN 4 21742683 missense possibly damaging 0.83
R1237:Ccnc UTSW 4 21730457 missense probably benign
R1558:Ccnc UTSW 4 21742671 missense probably benign 0.31
R2012:Ccnc UTSW 4 21741955 missense possibly damaging 0.65
R4901:Ccnc UTSW 4 21727894 missense probably damaging 0.96
R6427:Ccnc UTSW 4 21747578 critical splice donor site probably null
R6509:Ccnc UTSW 4 21740642 missense probably benign 0.27
R7421:Ccnc UTSW 4 21743291 missense probably damaging 1.00
R7563:Ccnc UTSW 4 21732220 missense probably damaging 0.99
R7842:Ccnc UTSW 4 21730480 missense probably damaging 0.99
R7925:Ccnc UTSW 4 21730480 missense probably damaging 0.99
R8023:Ccnc UTSW 4 21747578 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTCAGAAAGTGTCAAAGTGTGCCTA -3'
(R):5'- TGGCCCTTTTACCCAAAATGGATTCTAC -3'

Sequencing Primer
(F):5'- GCTACTGCTACAGTCTATTTCAAGAG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-01-15