Incidental Mutation 'R1220:Anks6'
ID99987
Institutional Source Beutler Lab
Gene Symbol Anks6
Ensembl Gene ENSMUSG00000066191
Gene Nameankyrin repeat and sterile alpha motif domain containing 6
Synonymsb2b1801.1Clo, LOC269533, 2210417J20Rik, SamCystin, Samd6
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1220 (G1)
Quality Score176
Status Validated
Chromosome4
Chromosomal Location47015669-47057427 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 47025767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084616] [ENSMUST00000107747] [ENSMUST00000229609]
Predicted Effect probably benign
Transcript: ENSMUST00000084616
SMART Domains Protein: ENSMUSP00000081665
Gene: ENSMUSG00000066191

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 539 575 N/A INTRINSIC
low complexity region 619 673 N/A INTRINSIC
SAM 700 766 2.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107747
SMART Domains Protein: ENSMUSP00000103376
Gene: ENSMUSG00000066191

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 607 643 N/A INTRINSIC
low complexity region 687 741 N/A INTRINSIC
low complexity region 748 768 N/A INTRINSIC
Blast:SAM 769 796 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152479
Predicted Effect probably benign
Transcript: ENSMUST00000229609
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart defects including TGA, DORV and septal defects associated with heterotaxy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Anks6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Anks6 APN 4 47046054 missense probably damaging 0.98
IGL01886:Anks6 APN 4 47044850 missense probably damaging 1.00
IGL02903:Anks6 APN 4 47045004 missense probably damaging 1.00
PIT4131001:Anks6 UTSW 4 47027109 missense probably damaging 1.00
R0632:Anks6 UTSW 4 47033167 missense possibly damaging 0.95
R1398:Anks6 UTSW 4 47044926 missense possibly damaging 0.75
R1479:Anks6 UTSW 4 47044874 missense probably damaging 1.00
R1519:Anks6 UTSW 4 47027152 missense probably damaging 0.99
R1713:Anks6 UTSW 4 47039726 missense probably benign 0.00
R1781:Anks6 UTSW 4 47043639 missense possibly damaging 0.87
R1853:Anks6 UTSW 4 47049387 missense probably benign 0.00
R2364:Anks6 UTSW 4 47027248 missense possibly damaging 0.93
R3790:Anks6 UTSW 4 47049212 missense probably damaging 0.97
R4432:Anks6 UTSW 4 47044905 nonsense probably null
R4700:Anks6 UTSW 4 47033127 missense possibly damaging 0.86
R4847:Anks6 UTSW 4 47033266 missense probably benign
R4876:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4877:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4878:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4879:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4961:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4962:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4968:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4970:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R4971:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5092:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5113:Anks6 UTSW 4 47030795 missense probably damaging 1.00
R5389:Anks6 UTSW 4 47038900 splice site probably benign
R5569:Anks6 UTSW 4 47045007 missense probably damaging 1.00
R5857:Anks6 UTSW 4 47039736 missense possibly damaging 0.92
R5977:Anks6 UTSW 4 47035748 missense probably benign 0.11
R5978:Anks6 UTSW 4 47049252 missense probably damaging 1.00
R6933:Anks6 UTSW 4 47049164 missense probably benign 0.25
R7175:Anks6 UTSW 4 47046268 intron probably null
R7454:Anks6 UTSW 4 47038919 missense unknown
R7874:Anks6 UTSW 4 47049275 missense unknown
R8146:Anks6 UTSW 4 47043605 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGAGACATTTCATGCGAAAGCCC -3'
(R):5'- ACAGGCAGGTTTTATTCCCAGTAGC -3'

Sequencing Primer
(F):5'- GCGAAAGCCCTTGCTTTAATG -3'
(R):5'- GCTGGAACTTCAGAATCTACTGC -3'
Posted On2014-01-15