Incidental Mutation 'R1220:Yrdc'
ID99989
Institutional Source Beutler Lab
Gene Symbol Yrdc
Ensembl Gene ENSMUSG00000028889
Gene NameyrdC domain containing (E.coli)
SynonymsIRIP
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location124850679-124855242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124854536 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 278 (S278T)
Ref Sequence ENSEMBL: ENSMUSP00000099688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030723] [ENSMUST00000064444] [ENSMUST00000102628] [ENSMUST00000106190] [ENSMUST00000137769] [ENSMUST00000144851] [ENSMUST00000163946] [ENSMUST00000185036]
Predicted Effect probably benign
Transcript: ENSMUST00000030723
SMART Domains Protein: ENSMUSP00000030723
Gene: ENSMUSG00000028890

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064444
SMART Domains Protein: ENSMUSP00000066000
Gene: ENSMUSG00000042763

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
low complexity region 55 79 N/A INTRINSIC
Pfam:Glyco_hydro_99 95 445 8.7e-160 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102628
AA Change: S278T

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099688
Gene: ENSMUSG00000028889
AA Change: S278T

DomainStartEndE-ValueType
low complexity region 32 63 N/A INTRINSIC
Pfam:Sua5_yciO_yrdC 76 256 1.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106190
SMART Domains Protein: ENSMUSP00000101796
Gene: ENSMUSG00000078570

DomainStartEndE-ValueType
Pfam:DUF4726 10 110 2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125776
Predicted Effect probably benign
Transcript: ENSMUST00000137769
Predicted Effect probably benign
Transcript: ENSMUST00000144851
SMART Domains Protein: ENSMUSP00000114150
Gene: ENSMUSG00000028889

DomainStartEndE-ValueType
Pfam:Sua5_yciO_yrdC 1 103 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184704
Predicted Effect probably benign
Transcript: ENSMUST00000185036
SMART Domains Protein: ENSMUSP00000139121
Gene: ENSMUSG00000078570

DomainStartEndE-ValueType
low complexity region 66 89 N/A INTRINSIC
low complexity region 123 137 N/A INTRINSIC
Meta Mutation Damage Score 0.1021 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Other mutations in Yrdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Yrdc APN 4 124853961 missense probably damaging 1.00
IGL01142:Yrdc APN 4 124853994 missense probably damaging 0.98
R0525:Yrdc UTSW 4 124851766 missense probably damaging 1.00
R1162:Yrdc UTSW 4 124854461 unclassified probably benign
R1952:Yrdc UTSW 4 124851946 missense probably benign 0.00
R3829:Yrdc UTSW 4 124851761 start codon destroyed probably null 0.92
R7121:Yrdc UTSW 4 124850955 missense probably benign 0.06
R7272:Yrdc UTSW 4 124851027 missense probably benign 0.23
Z1176:Yrdc UTSW 4 124851497 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCTGCCACAGAGAGGTGTTAAGTG -3'
(R):5'- ACTTTGCTGCGTTGGTCCTAAGAC -3'

Sequencing Primer
(F):5'- CTGGGACTAAATTTGCTGGTATAG -3'
(R):5'- TGTCACTGTTCCCCAGAAAG -3'
Posted On2014-01-15