Incidental Mutation 'R1220:Katnal1'
ID99991
Institutional Source Beutler Lab
Gene Symbol Katnal1
Ensembl Gene ENSMUSG00000041298
Gene Namekatanin p60 subunit A-like 1
Synonyms
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location148871584-148929320 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148894251 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 171 (A171V)
Ref Sequence ENSEMBL: ENSMUSP00000120502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047257] [ENSMUST00000110509] [ENSMUST00000147473]
Predicted Effect probably benign
Transcript: ENSMUST00000047257
AA Change: A171V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043210
Gene: ENSMUSG00000041298
AA Change: A171V

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 3e-19 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
AAA 238 380 3.01e-20 SMART
Pfam:Vps4_C 437 486 2.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110508
Predicted Effect probably benign
Transcript: ENSMUST00000110509
AA Change: A171V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106136
Gene: ENSMUSG00000041298
AA Change: A171V

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 3e-20 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Blast:AAA 159 229 8e-7 BLAST
PDB:4L16|A 184 234 3e-8 PDB
SCOP:d1iqpa2 185 234 4e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147473
AA Change: A171V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120502
Gene: ENSMUSG00000106892
AA Change: A171V

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 1e-20 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU induced mutation display male infertility with decreased testis weight and premature exfoliation of spermatids from the seminiferous epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Katnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Katnal1 APN 5 148893797 splice site probably benign
IGL02369:Katnal1 APN 5 148878927 missense probably benign 0.04
R0001:Katnal1 UTSW 5 148921275 missense probably damaging 0.98
R0230:Katnal1 UTSW 5 148918650 missense possibly damaging 0.60
R0308:Katnal1 UTSW 5 148878924 missense possibly damaging 0.95
R0591:Katnal1 UTSW 5 148892516 missense probably damaging 1.00
R1448:Katnal1 UTSW 5 148904676 missense probably benign 0.37
R2163:Katnal1 UTSW 5 148888936 missense probably damaging 1.00
R4791:Katnal1 UTSW 5 148904650 missense probably damaging 1.00
R5168:Katnal1 UTSW 5 148921322 missense possibly damaging 0.91
R6182:Katnal1 UTSW 5 148904597 missense possibly damaging 0.83
R6542:Katnal1 UTSW 5 148876206 missense probably benign 0.01
R6836:Katnal1 UTSW 5 148894164 missense probably damaging 1.00
R7077:Katnal1 UTSW 5 148891737 missense probably benign 0.00
R7490:Katnal1 UTSW 5 148891682 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- GTTGCACACTTATTCAAGCCACACC -3'
(R):5'- TGGACCCACATGCACACATTCG -3'

Sequencing Primer
(F):5'- CGAGCAAACTCTATCAGTGTGTC -3'
(R):5'- GTTGTCACTGGCCATAACTTCTC -3'
Posted On2014-01-15