Incidental Mutation 'R1220:Add2'
ID99993
Institutional Source Beutler Lab
Gene Symbol Add2
Ensembl Gene ENSMUSG00000030000
Gene Nameadducin 2 (beta)
Synonyms
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86028681-86124409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86087000 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 94 (M94L)
Ref Sequence ENSEMBL: ENSMUSP00000145034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032069] [ENSMUST00000203196] [ENSMUST00000203279] [ENSMUST00000203366] [ENSMUST00000203445] [ENSMUST00000203724] [ENSMUST00000203786] [ENSMUST00000204059] [ENSMUST00000205034]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032069
AA Change: M94L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032069
Gene: ENSMUSG00000030000
AA Change: M94L

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203196
AA Change: M94L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145104
Gene: ENSMUSG00000030000
AA Change: M94L

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203279
AA Change: M94L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145452
Gene: ENSMUSG00000030000
AA Change: M94L

DomainStartEndE-ValueType
Aldolase_II 135 289 1.77e-20 SMART
coiled coil region 310 337 N/A INTRINSIC
low complexity region 439 477 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203366
AA Change: M94L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144849
Gene: ENSMUSG00000030000
AA Change: M94L

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203445
AA Change: M94L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145494
Gene: ENSMUSG00000030000
AA Change: M94L

DomainStartEndE-ValueType
Pfam:Aldolase_II 135 184 7.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203624
Predicted Effect possibly damaging
Transcript: ENSMUST00000203724
AA Change: M94L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145296
Gene: ENSMUSG00000030000
AA Change: M94L

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203786
AA Change: M94L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144694
Gene: ENSMUSG00000030000
AA Change: M94L

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204059
AA Change: M94L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145160
Gene: ENSMUSG00000030000
AA Change: M94L

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205034
AA Change: M94L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145034
Gene: ENSMUSG00000030000
AA Change: M94L

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the adducin family. Adducins, encoded by alpha, beta and gamma genes, are heteromeric proteins that crosslink actin filaments with spectrin at the cytoskeletal membrane. This protein, primarily found in the brain and hematopoietic cells, is regulated by phosphorylation and calmodulin interactions as it promotes spectrin assembly onto actin filaments, bundles actin and caps barbed ends of actin filaments. In mouse, deficiency of this gene can lead to mild hemolytic anemia and impaired synaptic plasticity. Mutations of this gene in mouse serve as a pathophysiological model for hereditary spherocytosis and hereditary elliptocytosis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display mild anemia with compensated hemolysis, marked alteration in osmotic fragility, predominant presence of elliptocytes in the blood and increased blood pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Add2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:Add2 APN 6 86107406 missense possibly damaging 0.94
IGL02799:Add2 UTSW 6 86106252 missense possibly damaging 0.65
R0012:Add2 UTSW 6 86098628 missense probably damaging 0.98
R0448:Add2 UTSW 6 86092919 missense probably benign 0.05
R0452:Add2 UTSW 6 86104629 nonsense probably null
R0834:Add2 UTSW 6 86086917 missense probably damaging 0.99
R1598:Add2 UTSW 6 86098646 missense probably benign 0.03
R1806:Add2 UTSW 6 86118657 missense probably damaging 0.96
R1837:Add2 UTSW 6 86118558 missense probably damaging 1.00
R1959:Add2 UTSW 6 86096756 missense probably damaging 1.00
R1961:Add2 UTSW 6 86096756 missense probably damaging 1.00
R2152:Add2 UTSW 6 86098598 missense probably damaging 1.00
R2309:Add2 UTSW 6 86096801 missense probably damaging 1.00
R4744:Add2 UTSW 6 86110888 missense probably damaging 1.00
R4789:Add2 UTSW 6 86118770 missense probably benign 0.04
R4896:Add2 UTSW 6 86096746 missense probably benign 0.03
R4989:Add2 UTSW 6 86110858 missense probably benign 0.10
R5004:Add2 UTSW 6 86096746 missense probably benign 0.03
R5061:Add2 UTSW 6 86087047 splice site probably null
R5068:Add2 UTSW 6 86107458 missense probably damaging 0.97
R5405:Add2 UTSW 6 86101197 missense probably benign 0.09
R5418:Add2 UTSW 6 86110912 missense probably benign 0.00
R5576:Add2 UTSW 6 86107475 critical splice donor site probably null
R5952:Add2 UTSW 6 86109746 missense probably damaging 1.00
R6011:Add2 UTSW 6 86098625 missense probably damaging 1.00
R6031:Add2 UTSW 6 86098673 missense probably damaging 1.00
R6031:Add2 UTSW 6 86098673 missense probably damaging 1.00
R7026:Add2 UTSW 6 86086983 missense probably benign 0.39
R7158:Add2 UTSW 6 86085952 missense probably damaging 1.00
R7387:Add2 UTSW 6 86086015 missense probably damaging 1.00
R7393:Add2 UTSW 6 86098647 nonsense probably null
R7487:Add2 UTSW 6 86093450 missense possibly damaging 0.94
R7511:Add2 UTSW 6 86098615 missense probably benign
R7543:Add2 UTSW 6 86106225 missense probably damaging 1.00
R8186:Add2 UTSW 6 86108020 missense probably benign 0.44
R8205:Add2 UTSW 6 86086917 missense probably damaging 0.99
Z1088:Add2 UTSW 6 86085965 missense probably damaging 0.98
Z1176:Add2 UTSW 6 86098590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCGCTGTCTTGTGAAATCCTG -3'
(R):5'- CCCTGGCATCATGAGCAATTCTCC -3'

Sequencing Primer
(F):5'- CTTGTGAAATCCTGCTGGGC -3'
(R):5'- AGAGCCAGGCATCTCTTTG -3'
Posted On2014-01-15