Incidental Mutation 'R1220:Exoc3l2'
ID99997
Institutional Source Beutler Lab
Gene Symbol Exoc3l2
Ensembl Gene ENSMUSG00000011263
Gene Nameexocyst complex component 3-like 2
Synonyms
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1220 (G1)
Quality Score141
Status Validated
Chromosome7
Chromosomal Location19463331-19496762 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 19491784 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011407] [ENSMUST00000137613]
Predicted Effect probably benign
Transcript: ENSMUST00000011407
SMART Domains Protein: ENSMUSP00000011407
Gene: ENSMUSG00000011263

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137613
SMART Domains Protein: ENSMUSP00000123025
Gene: ENSMUSG00000011263

DomainStartEndE-ValueType
Pfam:Sec6 1 177 7.7e-29 PFAM
low complexity region 186 222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Exoc3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02858:Exoc3l2 APN 7 19495184 missense probably benign 0.05
Thumbelina UTSW 7 19480032 missense unknown
R1482:Exoc3l2 UTSW 7 19495359 missense probably damaging 0.99
R2109:Exoc3l2 UTSW 7 19489134 start gained probably benign
R2117:Exoc3l2 UTSW 7 19494982 missense possibly damaging 0.92
R3963:Exoc3l2 UTSW 7 19495256 missense probably benign
R4870:Exoc3l2 UTSW 7 19495192 missense unknown
R5982:Exoc3l2 UTSW 7 19480032 missense unknown
R6151:Exoc3l2 UTSW 7 19491745 nonsense probably null
R6351:Exoc3l2 UTSW 7 19469708 missense possibly damaging 0.66
R6376:Exoc3l2 UTSW 7 19469710 missense possibly damaging 0.90
R7087:Exoc3l2 UTSW 7 19469657 missense
R7256:Exoc3l2 UTSW 7 19484703 missense unknown
R7493:Exoc3l2 UTSW 7 19469888 missense
X0064:Exoc3l2 UTSW 7 19494972 missense probably benign 0.27
Z1176:Exoc3l2 UTSW 7 19480061 missense not run
Z1177:Exoc3l2 UTSW 7 19480028 missense not run
Predicted Primers PCR Primer
(F):5'- GCTTGCATTGGGTGACCCTGAAAC -3'
(R):5'- AGATTTGGACGTGCCTGCTACTG -3'

Sequencing Primer
(F):5'- GGTGACCCTGAAACCCTTG -3'
(R):5'- ACATGCCCGTGTGTGTC -3'
Posted On2014-01-15