Incidental Mutation 'R1220:Ppp1r15a'
ID99998
Institutional Source Beutler Lab
Gene Symbol Ppp1r15a
Ensembl Gene ENSMUSG00000040435
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 15A
SynonymsMyd116, Gadd34
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45522916-45526268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45523869 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 505 (Y505C)
Ref Sequence ENSEMBL: ENSMUSP00000128497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000051810] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000167273] [ENSMUST00000210813] [ENSMUST00000210868] [ENSMUST00000211212] [ENSMUST00000211227]
Predicted Effect probably benign
Transcript: ENSMUST00000024233
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042105
AA Change: Y505C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435
AA Change: Y505C

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051810
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085331
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107758
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107762
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167273
AA Change: Y505C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435
AA Change: Y505C

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210813
Predicted Effect probably benign
Transcript: ENSMUST00000210868
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Predicted Effect probably benign
Transcript: ENSMUST00000211227
Meta Mutation Damage Score 0.2500 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The induction of this gene by ionizing radiation occurs in certain cell lines regardless of p53 status, and its protein response is correlated with apoptosis following ionizing radiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice show abnormal cellular responses to either ER- or oxidative- stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Ppp1r15a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Ppp1r15a APN 7 45524379 unclassified probably benign
IGL02410:Ppp1r15a APN 7 45524055 missense probably damaging 1.00
IGL02658:Ppp1r15a APN 7 45524667 missense probably benign 0.02
IGL03156:Ppp1r15a APN 7 45525171 missense possibly damaging 0.82
R0179:Ppp1r15a UTSW 7 45525000 missense probably damaging 0.98
R0350:Ppp1r15a UTSW 7 45523018 missense probably damaging 0.99
R4296:Ppp1r15a UTSW 7 45523749 nonsense probably null
R4436:Ppp1r15a UTSW 7 45524779 missense probably damaging 1.00
R4854:Ppp1r15a UTSW 7 45525373 missense probably benign 0.01
R5822:Ppp1r15a UTSW 7 45523303 missense probably damaging 1.00
R6216:Ppp1r15a UTSW 7 45524022 missense probably damaging 1.00
R6574:Ppp1r15a UTSW 7 45524109 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTCATATGCAAGAAGTCGCAACCC -3'
(R):5'- CACATACAAGTCCCTTCCTGAAGGC -3'

Sequencing Primer
(F):5'- ttaaagaaaaaaaaaaGGCAGTGTGG -3'
(R):5'- TATCGCCCAGGAGAGGACAC -3'
Posted On2014-01-15