phenotypic_id pedigree_tag chromosome coordinate assembly_version ref_amino_acid var_amino_acid polyphen_score predicted_effect mgi_accession_id gene_symbol gene_name ref_base var_base mutation_type phenotypes 83 13 94451087 GRCm38 probably benign MGI:1333879 Ap3b1 adaptor-related protein complex 3, beta 1 subunit G T critical splice donor site immune system, MCMV susceptibility, pigmentation, skin/coat/nails 85 19 5747688 GRCm38 C R 0.999 probably damaging MGI:1101355 Ltbp3 latent transforming growth factor beta binding protein 3 T C missense craniofacial, growth/size, limbs/digits/tail phenotype, skeleton phenotype 88 18 45561253 GRCm38 silent MGI:2153182 Kcnn2 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 T C synonymous behavior/neurological 90 17 56271576 GRCm38 MGI:2147032 Ticam1 toll-like receptor adaptor molecule 1 TC T small deletion DSS: sensitive day 7, immune system, MCMV susceptibility, TLR signaling defect: TNF production by macrophages 96 11 99322635 GRCm38 L Q 1.000 probably damaging MGI:1918060 Krt25 keratin 25 A T missense skin/coat/nails 99 7 56324680 GRCm38 P L 0.999 probably damaging MGI:97454 Oca2 oculocutaneous albinism II C T missense pigmentation, skin/coat/nails 103 X 106088407 GRCm38 E V 0.041 probably benign MGI:99400 Atp7a ATPase, Cu++ transporting, alpha polypeptide G T missense growth/size, lethality-embryonic/perinatal, lethality-postnatal, pigmentation, skin/coat/nails 105 15 101013504 GRCm38 W L 1.000 probably damaging MGI:103169 Scn8a sodium channel, voltage-gated, type VIII, alpha G T missense behavior/neurological 107 7 56414431 GRCm38 W R 0.998 probably damaging MGI:97454 Oca2 oculocutaneous albinism II T A missense pigmentation, skin/coat/nails 109 4 101764872 GRCm38 F I 1.000 probably damaging MGI:104993 Lepr leptin receptor T A missense adipose tissue, behavior/neurological, Body Weight - increased, growth/size, homeostasis/metabolism, reproductive system 111 9 106225007 GRCm38 L P 1.000 probably damaging MGI:1932389 Tlr9 toll-like receptor 9 T C missense immune system, MCMV susceptibility, response to injected CpG DNA - decreased, TLR signaling defect: TNF production by macrophages 112 11 98637573 GRCm38 K I 0.982 probably damaging MGI:3044668 Gsdma3 gasdermin A3 A T missense skin/coat/nails 113 9 75164195 GRCm38 S I 1.000 probably damaging MGI:105976 Myo5a myosin VA G T missense behavior/neurological, lethality-postnatal, life span-post-weaning/aging, nervous system, pigmentation, skin/coat/nails 115 15 MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 unclassified pigmentation, skin/coat/nails 116 17 57444063 GRCm38 Y C 1.000 probably damaging MGI:106912 Adgre1 adhesion G protein-coupled receptor E1 A G missense immune system, normal phenotype 118 6 64395280 GRCm38 probably benign MGI:95813 Grid2 glutamate receptor, ionotropic, delta 2 T A synonymous behavior/neurological 124 15 11012667 GRCm38 Q L probably benign MGI:2153040 Slc45a2 solute carrier family 45, member 2 C T missense pigmentation, skin/coat/nails 125 11 100011939 GRCm38 I N 1.000 probably damaging MGI:1919138 Krt33a keratin 33A A T missense skin/coat/nails 128 5 64954583 GRCm38 V A 0.815 possibly damaging MGI:1341296 Tlr6 toll-like receptor 6 A G missense immune system, TLR signaling defect: TNF production by macrophages 130 10 82712061 GRCm38 W R 1.000 probably damaging MGI:1915183 Hcfc2 host cell factor C2 T C missense immune system, MCMV susceptibility, TLR signaling defect: TNF production by macrophages 137 15 94326699 GRCm38 probably benign MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 G T intron pigmentation, skin/coat/nails 143 X 106105250 GRCm38 A V 1.000 probably damaging MGI:99400 Atp7a ATPase, Cu++ transporting, alpha polypeptide C T missense lethality-embryonic/perinatal, pigmentation, skin/coat/nails 144 11 99388818 GRCm38 E V 0.989 probably damaging MGI:96685 Krt10 keratin 10 T A missense skin/coat/nails 145 7 56316405 GRCm38 T A 1.000 probably damaging MGI:97454 Oca2 oculocutaneous albinism II A G missense pigmentation, skin/coat/nails 149 12 21340750 GRCm38 F I 1.000 probably damaging MGI:1096335 Adam17 a disintegrin and metallopeptidase domain 17 A T missense skin/coat/nails, vision/eye 156 5 147366918 GRCm38 probably null MGI:95559 Flt3 FMS-like tyrosine kinase 3 C T critical splice donor site FACS CD4:CD8 - increased, FACS NK cells - decreased, growth/size, hematopoietic system, immune system, MCMV susceptibility, NK cell response - decreased 163 7 87472495 GRCm38 H R 1.000 probably damaging MGI:98880 Tyr tyrosinase T C missense pigmentation, skin/coat/nails 167 10 71027954 GRCm38 T I 0.994 probably damaging MGI:1933388 Bicc1 BicC family RNA binding protein 1 G A missense homeostasis/metabolism, life span-post-weaning/aging, renal/urinary system 168 9 106226465 GRCm38 Q L 0.997 probably damaging MGI:1932389 Tlr9 toll-like receptor 9 A T missense immune system, MCMV susceptibility, TLR signaling defect: TNF production by macrophages 169 19 44400330 GRCm38 T K 0.998 probably damaging MGI:98239 Scd1 stearoyl-Coenzyme A desaturase 1 G T missense endocrine/exocrine gland, immune system, skin/coat/nails 170 15 78464455 GRCm38 probably benign MGI:1919003 Tmprss6 transmembrane serine protease 6 T C intron embryogenesis, growth/size, hematopoietic system, homeostasis/metabolism, iron deficiency, reproductive system, skin/coat/nails 171 15 94561484 GRCm38 I T 0.995 probably damaging MGI:2182474 Irak4 interleukin-1 receptor-associated kinase 4 T C missense 125-03 Response - increased, immune system, response to injected CpG DNA - decreased, TLR signaling defect: TNF production by macrophages 172 6 MGI:1100508 Kcnj8 potassium inwardly-rectifying channel, subfamily J, member 8 large deletion cardiovascular system, homeostasis/metabolism, immune system, lethality-postnatal, MCMV susceptibility 195 15 11858647 GRCm38 I F 0.985 probably damaging MGI:97373 Npr3 natriuretic peptide receptor 3 T A missense growth/size, limbs/digits/tail phenotype, skeleton phenotype 196 13 59512323 GRCm38 probably benign MGI:2159437 Agtpbp1 ATP/GTP binding protein 1 A T critical splice donor site behavior/neurological 197 6 91365884 GRCm38 C S 1.000 probably damaging MGI:98961 Wnt7a wingless-type MMTV integration site family, member 7A A T missense limbs/digits/tail phenotype, reproductive system 198 10 77549849 GRCm38 probably benign MGI:96611 Itgb2 integrin beta 2 A T intron hematopoietic system, immune system, NK cell response - decreased 199 6 48752609 GRCm38 G C 1.000 probably damaging MGI:2442232 Gimap5 GTPase, IMAP family member 5 G T missense CTL killing - decreased, FACS B cells - decreased, FACS CD4+ T cells - decreased, FACS CD8+ T cells - decreased, FACS NK cells - decreased, FACS NK1.1+ T cells - decreased, hematopoietic system, immune system, inflammatory bowel disease phenotype, lethality-postnatal, life span-post-weaning/aging, liver/biliary system, MCMV susceptibility, NK cell response - decreased, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 200 6 124728559 GRCm38 Y N 0.999 probably damaging MGI:96055 Ptpn6 protein tyrosine phosphatase, non-receptor type 6 A T missense hematopoietic system, immune system 201 9 45006150 GRCm38 probably benign MGI:88332 Cd3e CD3 antigen, epsilon polypeptide G T intron hematopoietic system, immune system 202 8 119529030 GRCm38 Y C 1.000 probably damaging MGI:1927235 Mbtps1 membrane-bound transcription factor peptidase, site 1 T C missense Body Weight - decreased, Body Weight (Z-score) - decreased, DSS: sensitive day 7, embryogenesis, homeostasis/metabolism, immune system, lethality-embryonic/perinatal, pigmentation, reproductive system, skin/coat/nails 203 2 93675369 GRCm38 H R 1.000 probably damaging MGI:108359 Alx4 aristaless-like homeobox 4 A G missense craniofacial, limbs/digits/tail phenotype 204 5 98254746 GRCm38 E V 1.000 probably damaging MGI:95519 Fgf5 fibroblast growth factor 5 G T missense skin/coat/nails 205 19 3944168 GRCm38 H R 0.956 possibly damaging MGI:1859307 Unc93b1 unc-93 homolog B1 (C. elegans) A G missense DSS: sensitive day 7, immune system, MCMV susceptibility, response to injected CpG DNA - decreased, TLR signaling defect: hyposensitivity to CpG + IFNg, TLR signaling defect: hyposensitivity to poly I:C, TLR signaling defect: hyposensitivity to poly I:C + IFNg, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages 206 2 27752334 GRCm38 I N 0.978 probably damaging MGI:98214 Rxra retinoid X receptor alpha T A missense hematopoietic system, immune system, pigmentation, skeleton phenotype, skin/coat/nails, vision/eye 209 13 13683224 GRCm38 probably benign MGI:107448 Lyst lysosomal trafficking regulator T A unclassified hematopoietic system, immune system, MCMV susceptibility, NK cell response - decreased, pigmentation, skin/coat/nails 210 13 MGI:107448 Lyst lysosomal trafficking regulator unclassified hematopoietic system, immune system, MCMV susceptibility, NK cell response - decreased, pigmentation, skin/coat/nails 211 5 140612535 GRCm38 V A 0.995 probably damaging MGI:1095413 Lfng LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase T C missense immune system, limbs/digits/tail phenotype, skeleton phenotype 212 13 MGI:107448 Lyst lysosomal trafficking regulator unclassified hematopoietic system, immune system, MCMV susceptibility, NK cell response - decreased, pigmentation, skin/coat/nails 213 11 94947184 GRCm38 probably benign MGI:88467 Col1a1 collagen, type I, alpha 1 T A splice site behavior/neurological, skeleton phenotype 214 3 83837315 GRCm38 N I 1.000 probably damaging MGI:1346060 Tlr2 toll-like receptor 2 T A missense immune system, TLR signaling defect: TNF production by macrophages 216 10 81220573 GRCm38 probably benign MGI:2448730 Atcay ataxia, cerebellar, Cayman type A T intron behavior/neurological 217 9 35198707 GRCm38 probably benign MGI:2152213 Tirap toll-interleukin 1 receptor (TIR) domain-containing adaptor protein T A intron immune system, TLR signaling defect: TNF production by macrophages 219 14 54439999 GRCm38 S P 0.964 probably damaging MGI:101900 Mmp14 matrix metallopeptidase 14 (membrane-inserted) T C missense craniofacial, growth/size, lethality-embryonic/perinatal, life span-post-weaning/aging, reproductive system, vision/eye 220 5 17874966 GRCm38 probably benign MGI:107899 Cd36 CD36 molecule A T intron immune system, TLR signaling defect: TNF production by macrophages, vision/eye 221 18 36725551 GRCm38 Q L 0.007 probably benign MGI:88318 Cd14 CD14 antigen G A missense immune system, TLR signaling defect: TNF production by macrophages 222 X 167308286 GRCm38 T I 1.000 probably damaging MGI:2176882 Tlr7 toll-like receptor 7 G A missense immune system, TLR signaling defect: TNF production by macrophages 224 9 119338114 GRCm38 I N 0.997 probably damaging MGI:108005 Myd88 myeloid differentiation primary response gene 88 A T missense DSS: sensitive day 7, immune system, MCMV susceptibility, response to injected CpG DNA - decreased, TLR signaling defect: TNF production by macrophages 225 9 119338692 GRCm38 Y C 1.000 probably damaging MGI:108005 Myd88 myeloid differentiation primary response gene 88 T C missense immune system, TLR signaling defect: TNF production by macrophages 226 17 35200204 GRCm38 P T 1.000 probably damaging MGI:104798 Tnf tumor necrosis factor G T missense immune system, TLR signaling defect: TNF production by macrophages 227 9 106224152 GRCm38 V E 1.000 probably damaging MGI:1932389 Tlr9 toll-like receptor 9 T A missense immune system, MCMV susceptibility, response to injected CpG DNA - decreased, TLR signaling defect: TNF production by macrophages 228 11 116073423 GRCm38 probably benign MGI:1917700 Unc13d unc-13 homolog D (C. elegans) G T unclassified DSS: sensitive day 7, hematopoietic system, immune system, MCMV susceptibility, NK cell response - decreased 229 9 73082409 GRCm38 R I 0.886 possibly damaging MGI:1861441 Rab27a RAB27A, member RAS oncogene family A T missense immune system, MCMV susceptibility, pigmentation, skin/coat/nails 231 9 75211127 GRCm38 Q L 1.000 probably damaging MGI:105976 Myo5a myosin VA C T missense behavior/neurological, lethality-postnatal, life span-post-weaning/aging, pigmentation, skin/coat/nails 232 9 MGI:105976 Myo5a myosin VA missense pigmentation, skin/coat/nails 233 4 66841097 GRCm38 D V 0.998 probably damaging MGI:96824 Tlr4 toll-like receptor 4 A T missense immune system, TLR signaling defect: TNF production by macrophages 234 1 52140588 GRCm38 V E 1.000 probably damaging MGI:103063 Stat1 signal transducer and activator of transcription 1 T A missense immune system, MCMV proliferation in macrophages - increased, MCMV susceptibility, NK cell response - decreased, response to injected CpG DNA - decreased, RVFV susceptibility 235 7 56324661 GRCm38 E K 0.190 probably benign MGI:97454 Oca2 oculocutaneous albinism II G A missense pigmentation, skin/coat/nails 236 5 140891080 GRCm38 probably benign MGI:1916978 Card11 caspase recruitment domain family, member 11 A T splice site CTL killing - decreased, FACS NK cells - decreased, FACS NK1.1+ T cells - decreased, hematopoietic system, immune system, NK cell response - decreased, skin/coat/nails 244 9 MGI:105976 Myo5a myosin VA splice donor site pigmentation, skin/coat/nails 251 15 11002981 GRCm38 L P 1.000 probably damaging MGI:2153040 Slc45a2 solute carrier family 45, member 2 T C missense pigmentation, skin/coat/nails 254 7 46784145 GRCm38 probably benign MGI:2180307 Hps5 HPS5, biogenesis of lysosomal organelles complex 2 subunit 2 T A unclassified pigmentation, skin/coat/nails 256 4 MGI:1914549 Dock7 dedicator of cytokinesis 7 large deletion behavior/neurological, DSS: sensitive day 7, pigmentation, skin/coat/nails 257 11 100012611 GRCm38 Y D 1.000 probably damaging MGI:1919138 Krt33a keratin 33A A C missense skin/coat/nails 258 9 119638705 GRCm38 T A 0.995 probably damaging MGI:108029 Scn10a sodium channel, voltage-gated, type X, alpha T C missense behavior/neurological, nervous system 259 15 11012610 GRCm38 H P 0.999 probably damaging MGI:2153040 Slc45a2 solute carrier family 45, member 2 A C missense pigmentation, skin/coat/nails 260 11 99322630 GRCm38 S P 0.992 probably damaging MGI:1918060 Krt25 keratin 25 A G missense skin/coat/nails 263 X 74437222 GRCm38 L P 0.999 probably damaging MGI:1338074 Ikbkg inhibitor of kappaB kinase gamma T C missense immune system, MCMV susceptibility, T-dependent humoral response defect- decreased antibody response to rSFV, TLR signaling defect: TNF production by macrophages 265 15 79163324 GRCm38 N K 1.000 probably damaging MGI:98358 Sox10 SRY (sex determining region Y)-box 10 A C missense pigmentation, skin/coat/nails 266 3 20017173 GRCm38 probably benign MGI:2153839 Hps3 HPS3, biogenesis of lysosomal organelles complex 2 subunit 1 A T intron DSS: sensitive day 7, pigmentation, skin/coat/nails 270 19 18983351 GRCm38 S P 1.000 probably damaging MGI:1343464 Rorb RAR-related orphan receptor beta A G missense behavior/neurological 271 19 MGI:1278315 Lrp5 low density lipoprotein receptor-related protein 5 small insertion vision/eye 275 11 83069600 GRCm38 I N 0.996 probably damaging MGI:1313258 Slfn2 schlafen 2 T A missense CTL killing - decreased, FACS CD8+ T cells - decreased, FACS NK1.1+ T cells - decreased, hematopoietic system, immune system, MCMV susceptibility 282 6 115935131 GRCm38 C R 1.000 probably damaging MGI:97914 Rho rhodopsin T C missense vision/eye 285 1 52151225 GRCm38 probably benign MGI:103063 Stat1 signal transducer and activator of transcription 1 T A splice site immune system, MCMV susceptibility, NK cell response - decreased 286 1 90933301 GRCm38 probably benign MGI:2176380 Mlph melanophilin A G unclassified pigmentation, skin/coat/nails 288 19 46003836 GRCm38 W R 0.999 probably damaging MGI:2181763 Hps6 HPS6, biogenesis of lysosomal organelles complex 2 subunit 3 T A missense DSS: sensitive day 7, pigmentation, skin/coat/nails 290 13 44941438 GRCm38 probably benign MGI:2137586 Dtnbp1 dystrobrevin binding protein 1 T A intron immune system, MCMV susceptibility, NK cell response - decreased, pigmentation, skin/coat/nails 293 1 82535740 GRCm38 probably benign MGI:104687 Col4a4 collagen, type IV, alpha 4 C T critical splice donor site digestive/alimentary, hearing/vestibular/ear, renal/urinary system 300 8 120743883 GRCm38 Q * probably null MGI:96395 Irf8 interferon regulatory factor 8 C T nonsense cellular phenotype, FACS CD8+ T cells - decreased, immune system, MCMV susceptibility, response to injected CpG DNA - decreased 303 13 38606734 GRCm38 probably benign MGI:2178598 Bloc1s5 biogenesis of lysosomal organelles complex-1, subunit 5, muted A T intron hearing/vestibular/ear, pigmentation, skin/coat/nails 304 7 46777075 GRCm38 probably benign MGI:2180307 Hps5 HPS5, biogenesis of lysosomal organelles complex 2 subunit 2 A G intron DSS: sensitive day 7, immune system, MCMV susceptibility, pigmentation, skin/coat/nails, vision/eye 305 18 66859142 GRCm38 L P 1.000 probably damaging MGI:99457 Mc4r melanocortin 4 receptor A G missense adipose tissue, growth/size 306 19 27245654 GRCm38 L F 0.989 probably damaging MGI:98935 Vldlr very low density lipoprotein receptor C T missense vision/eye 307 5 75649550 GRCm38 I F 1.000 probably damaging MGI:96677 Kit KIT proto-oncogene receptor tyrosine kinase A T missense hematopoietic system, immune system, pigmentation, reproductive system, skin/coat/nails 308 5 75645875 GRCm38 D G 1.000 probably damaging MGI:96677 Kit KIT proto-oncogene receptor tyrosine kinase A G missense hematopoietic system, immune system, pigmentation, reproductive system, skin/coat/nails 309 17 31681025 GRCm38 Y D 1.000 probably damaging MGI:88515 Cryaa crystallin, alpha A T G missense vision/eye 311 10 58603163 GRCm38 P Q 1.000 probably damaging MGI:1343498 Edar ectodysplasin-A receptor G T missense craniofacial, limbs/digits/tail phenotype, skin/coat/nails 312 9 106224689 GRCm38 L P 1.000 probably damaging MGI:1932389 Tlr9 toll-like receptor 9 T C missense immune system, MCMV susceptibility, TLR signaling defect: TNF production by macrophages 313 13 12478497 GRCm38 I F 0.999 probably damaging MGI:1931001 Edaradd EDAR (ectodysplasin-A receptor)-associated death domain T A missense craniofacial, limbs/digits/tail phenotype, skin/coat/nails 314 13 MGI:1931001 Edaradd EDAR (ectodysplasin-A receptor)-associated death domain unclassified craniofacial, limbs/digits/tail phenotype, skin/coat/nails 316 8 11526034 GRCm38 S T 1.000 probably damaging MGI:1919191 Cars2 cysteinyl-tRNA synthetase 2 (mitochondrial)(putative) A T missense behavior/neurological 317 4 82983060 GRCm38 probably benign MGI:2670972 Frem1 Fras1 related extracellular matrix protein 1 A G intron limbs/digits/tail phenotype, renal/urinary system, skin/coat/nails, vision/eye 318 15 94335561 GRCm38 probably benign MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 A T intron pigmentation, skin/coat/nails 320 11 16904399 GRCm38 D G 1.000 probably damaging MGI:95294 Egfr epidermal growth factor receptor A G missense immune system, lethality-embryonic/perinatal, skin/coat/nails, touch/vibrissae, vision/eye 321 3 96920197 GRCm38 S P 0.999 probably damaging MGI:99953 Gja8 gap junction protein, alpha 8 A G missense vision/eye 322 1 65082157 GRCm38 I F 1.000 probably damaging MGI:88522 Crygb crystallin, gamma B T A missense vision/eye 323 1 65063084 GRCm38 V D 1.000 probably damaging MGI:88524 Crygd crystallin, gamma D A T missense vision/eye 325 13 13602026 GRCm38 probably benign MGI:107448 Lyst lysosomal trafficking regulator T G intron pigmentation, skin/coat/nails 326 10 MGI:1891428 Pcdh15 protocadherin 15 large deletion behavior/neurological, hearing/vestibular/ear 327 4 101768063 GRCm38 P T 0.252 probably benign MGI:104993 Lepr leptin receptor T A missense adipose tissue, behavior/neurological, Body Weight - increased, growth/size, homeostasis/metabolism, reproductive system 330 19 19110557 GRCm38 M T 0.448 probably null MGI:1343464 Rorb RAR-related orphan receptor beta A G start codon destroyed behavior/neurological 333 15 11022172 GRCm38 probably benign MGI:2153040 Slc45a2 solute carrier family 45, member 2 C A synonymous pigmentation, skin/coat/nails 339 15 78468000 GRCm38 probably benign MGI:1919003 Tmprss6 transmembrane serine protease 6 C T intron hematopoietic system, homeostasis/metabolism, iron deficiency, reproductive system, skin/coat/nails 341 18 4339608 GRCm38 probably benign MGI:1346878 Map3k8 mitogen-activated protein kinase kinase kinase 8 A T splice site immune system, TLR signaling defect: TNF production by macrophages 342 YL46 7 45881621 GRCm38 Y C 1.000 probably damaging MGI:1915387 Kdelr1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 A G missense FACS B cells - decreased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD8+ T cells - decreased, FACS NK cells - increased, FACS NK1.1+ T cells - decreased 349 11 100015850 GRCm38 C S 0.101 probably benign MGI:1919138 Krt33a keratin 33A A T missense skin/coat/nails 351 X 106157377 GRCm38 D G probably benign MGI:3045213 Tlr13 toll-like receptor 13 A G missense normal phenotype 352 9 119337394 GRCm38 F I 0.898 possibly damaging MGI:108005 Myd88 myeloid differentiation primary response gene 88 A T missense normal phenotype 353 11 53772891 GRCm38 D G 1.000 probably damaging MGI:96590 Irf1 interferon regulatory factor 1 A G missense FACS CD8+ T cells - decreased, FACS NK cells - decreased, FACS NK1.1+ T cells - decreased, hematopoietic system, immune system, MCMV susceptibility, NK cell response - decreased 354 4 11379300 GRCm38 M V 0.012 probably benign MGI:1917326 Esrp1 epithelial splicing regulatory protein 1 T C missense behavior/neurological, hearing/vestibular/ear 355 4 129555604 GRCm38 L P 1.000 probably damaging MGI:96756 Lck lymphocyte protein tyrosine kinase A G missense CTL killing - decreased, DSS: resistant day 10, DSS: sensitive day 7, FACS CD8+ T cells - decreased, hematopoietic system, immune system 356 14 70571429 GRCm38 Y D 1.000 probably damaging MGI:96223 Hr hairless T G missense Body Weight (DSS Male) - decreased, DSS: sensitive day 10, DSS: sensitive day 7, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells - increased, FACS B1b cells in B1 cells - increased, FACS B2 cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS T cells - decreased, skin/coat/nails 357 15 MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 unclassified pigmentation, skin/coat/nails 358 7 101902129 GRCm38 R L 0.999 probably damaging MGI:3769724 Tomt transmembrane O-methyltransferase C A missense behavior/neurological, hearing/vestibular/ear, nervous system 359 4 41095252 GRCm38 V A 0.051 probably benign MGI:1333777 Aqp3 aquaporin 3 A G missense immune system 362 9 106225349 GRCm38 R L 0.002 probably benign MGI:1932389 Tlr9 toll-like receptor 9 G T missense immune system, TLR signaling defect: TNF production by macrophages 365 1 77481076 GRCm38 probably benign MGI:98277 Epha4 Eph receptor A4 A G intron behavior/neurological 366 2 MGI:87853 a nonagouti unclassified pigmentation, skin/coat/nails 368 1 87669784 GRCm38 probably benign MGI:107357 Inpp5d inositol polyphosphate-5-phosphatase D T A critical splice donor site CTL killing - decreased, growth/size, hematopoietic system, homeostasis/metabolism, immune system, life span-post-weaning/aging, respiratory system 369 5 64954241 GRCm38 I T 0.984 probably damaging MGI:1341296 Tlr6 toll-like receptor 6 A G missense immune system, TLR signaling defect: TNF production by macrophages 370 11 116602260 GRCm38 I F 0.994 probably damaging MGI:2442473 Rhbdf2 rhomboid 5 homolog 2 T A missense immune system, TLR signaling defect: TNF production by macrophages 371 15 78464552 GRCm38 probably benign MGI:1919003 Tmprss6 transmembrane serine protease 6 G A intron embryogenesis, growth/size, hematopoietic system, homeostasis/metabolism, iron deficiency, reproductive system, skin/coat/nails 372 4 101772959 GRCm38 probably benign MGI:104993 Lepr leptin receptor G A synonymous adipose tissue, behavior/neurological, Body Weight - increased, growth/size, homeostasis/metabolism, reproductive system 379 X 7592654 GRCm38 I N 1.000 probably damaging MGI:1891436 Foxp3 forkhead box P3 T A missense growth/size, hematopoietic system, immune system, lethality-postnatal, limbs/digits/tail phenotype, reproductive system, skin/coat/nails 381 X 167307945 GRCm38 N Y 1.000 probably damaging MGI:2176882 Tlr7 toll-like receptor 7 T A missense immune system, TLR signaling defect: TNF production by macrophages 382 X 60269987 GRCm38 Q * probably null MGI:1859661 Atp11c ATPase, class VI, type 11C G A nonsense FACS B cells - decreased, hematopoietic system, homeostasis/metabolism, immune system, liver/biliary system, reproductive system 385 5 64954194 GRCm38 R * MGI:1341296 Tlr6 toll-like receptor 6 T A nonsense immune system, TLR signaling defect: TNF production by macrophages 386 2 MGI:87853 a nonagouti unclassified pigmentation, skin/coat/nails 387 6 142565927 GRCm38 I T 1.000 probably damaging MGI:1100508 Kcnj8 potassium inwardly-rectifying channel, subfamily J, member 8 A G missense cardiovascular system, homeostasis/metabolism, immune system, lethality-postnatal, TLR signaling defect: hypersensitivity to LPS 391 6 128784211 GRCm38 D G 0.085 probably benign MGI:107538 Klrb1c killer cell lectin-like receptor subfamily B member 1C T C missense FACS NK cells - decreased, hematopoietic system, immune system 393 2 MGI:87853 a nonagouti unclassified pigmentation, skin/coat/nails 395 7 141695682 GRCm38 C F 1.000 probably damaging MGI:1339364 Muc2 mucin 2 G T missense immune system 396 16 91499885 GRCm38 T P 0.977 probably damaging MGI:107658 Ifnar1 interferon (alpha and beta) receptor 1 A C missense adenovirus infection of macrophages - increased, immune system, influenza proliferation in macrophages - increased, MCMV proliferation in macrophages - increased, MCMV susceptibility, RVFV proliferation in macrophages - increased 399 15 52712639 GRCm38 I F 0.999 probably damaging MGI:1917040 Med30 mediator complex subunit 30 A T missense cardiovascular system, FACS NK cells - decreased, hematopoietic system, life span-post-weaning/aging 400 10 87570226 GRCm38 L P 1.000 probably damaging MGI:97473 Pah phenylalanine hydroxylase T C missense behavior/neurological, homeostasis/metabolism, pigmentation, skin/coat/nails 401 12 76385461 GRCm38 C R 0.998 probably damaging MGI:2442326 Zbtb1 zinc finger and BTB domain containing 1 T C missense FACS CD4+ T cells - decreased, FACS CD8+ T cells - decreased, hematopoietic system, immune system 403 5 64954394 GRCm38 L * MGI:1341296 Tlr6 toll-like receptor 6 A T nonsense immune system, TLR signaling defect: TNF production by macrophages 405 13 59525241 GRCm38 probably benign MGI:2159437 Agtpbp1 ATP/GTP binding protein 1 T C critical splice acceptor site behavior/neurological, growth/size 409 14 70560064 GRCm38 probably benign MGI:96223 Hr hairless G A critical splice donor site Body Weight (DSS Male) - decreased, DSS: sensitive day 10, DSS: sensitive day 7, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells - increased, FACS B1b cells in B1 cells - increased, FACS B2 cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS T cells - decreased, skin/coat/nails 410 2 101645647 GRCm38 probably benign MGI:97848 Rag1 recombination activating gene 1 G T intron FACS B cells - decreased, FACS CD4+ T cells - decreased, FACS CD8+ T cells - decreased, hematopoietic system, immune system, RVFV susceptibility 413 16 91383899 GRCm38 M V probably null MGI:1098243 Ifnar2 interferon (alpha and beta) receptor 2 A G start codon destroyed adenovirus infection of macrophages - increased, immune system, impaired response to dsDNA- type I IFN production by macrophages, influenza proliferation in macrophages - increased, MCMV proliferation in macrophages - increased, RVFV proliferation in macrophages - increased, RVFV susceptibility 415 12 24578027 GRCm38 R I 0.308 probably benign MGI:2182540 Grhl1 grainyhead like transcription factor 1 A T missense Body Weight - decreased, growth/size, skin/coat/nails 416 11 94093624 GRCm38 C * probably null MGI:1918084 Spag9 sperm associated antigen 9 C A nonsense pigmentation, skin/coat/nails 419 14 47016337 GRCm38 H P 1.000 probably damaging MGI:1921730 Samd4 sterile alpha motif domain containing 4 A C missense adipose tissue, growth/size, homeostasis/metabolism, skeleton phenotype 421 11 103249558 GRCm38 probably benign MGI:1858204 Map3k14 mitogen-activated protein kinase kinase kinase 14 G A intron FACS B cells - decreased, hematopoietic system, immune system, T-dependent humoral response defect- decreased antibody response to rSFV 424 4016 2 118400653 GRCm38 probably benign MGI:1353427 Eif2ak4 eukaryotic translation initiation factor 2 alpha kinase 4 T C splice site adenovirus infection of macrophages - increased, immune system, MCMV proliferation in macrophages - increased, TLR signaling defect: TNF production by macrophages 426 K1950 5 127608770 GRCm38 probably benign MGI:2140796 Slc15a4 solute carrier family 15, member 4 A T unclassified response to injected CpG DNA - decreased 427 9 106226593 GRCm38 G R 1.000 probably damaging MGI:1932389 Tlr9 toll-like receptor 9 G A missense immune system, response to injected CpG DNA - decreased, TLR signaling defect: TNF production by macrophages 428 4 66841142 GRCm38 G D 1.000 probably damaging MGI:96824 Tlr4 toll-like receptor 4 G A missense immune system, TLR signaling defect: TNF production by macrophages 433 X 98940782 GRCm38 probably benign MGI:1925179 Yipf6 Yip1 domain family, member 6 T A splice site DSS: sensitive day 7, immune system 437 5 137583153 GRCm38 probably benign MGI:1354956 Tfr2 transferrin receptor 2 T C splice site homeostasis/metabolism, iron excess 451 7 122582439 GRCm38 Y H 0.905 possibly damaging MGI:97596 Prkcb protein kinase C, beta T C missense immune system, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 452 7 30715800 GRCm38 S P 0.317 probably benign MGI:88113 Atp4a ATPase, H+/K+ exchanging, gastric, alpha polypeptide T C missense hematopoietic system 458 15 11023443 GRCm38 S P 0.939 possibly damaging MGI:2153040 Slc45a2 solute carrier family 45, member 2 T C missense pigmentation, skin/coat/nails 459 1 138137493 GRCm38 probably benign MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C T A intron FACS CD4+ T cells - decreased, FACS CD8+ T cells - decreased, hematopoietic system, immune system 463 17 MGI:98484 Tap2 transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) small insertion CTL killing - decreased, FACS CD8+ T cells - decreased, immune system, NK cell response - decreased 465 7 141265140 GRCm38 D G 1.000 probably damaging MGI:1859212 Irf7 interferon regulatory factor 7 T C missense response to injected CpG DNA - decreased 466 4 101728075 GRCm38 probably benign MGI:104993 Lepr leptin receptor G T splice site adipose tissue, behavior/neurological, Body Weight - increased, growth/size, homeostasis/metabolism 469 X 106088491 GRCm38 I T 1.000 probably damaging MGI:99400 Atp7a ATPase, Cu++ transporting, alpha polypeptide T C missense pigmentation, skin/coat/nails 470 9 80246451 GRCm38 C * probably null MGI:104785 Myo6 myosin VI T A nonsense behavior/neurological, hearing/vestibular/ear 471 6947 2 130024585 GRCm38 probably benign MGI:98732 Tgm3 transglutaminase 3, E polypeptide G A critical splice donor site immune system, RVFV susceptibility, skin/coat/nails 476 5439 7 141753439 GRCm38 I N unknown MGI:1339364 Muc2 mucin 2 T A missense DSS: sensitive day 7 477 1 9886104 GRCm38 C R 1.000 probably damaging MGI:2182368 Sgk3 serum/glucocorticoid regulated kinase 3 T C missense skin/coat/nails 478 A3412 13 30751751 GRCm38 R S 0.994 probably damaging MGI:1096873 Irf4 interferon regulatory factor 4 A T missense T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 479 B2485 18 5770554 GRCm38 Y * probably null MGI:1344313 Zeb1 zinc finger E-box binding homeobox 1 T A nonsense T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 480 8835 8 117581707 GRCm38 I N 0.002 probably benign MGI:97616 Plcg2 phospholipase C, gamma 2 T A missense Blood Analysis MCHC - decreased, Blood Analysis Platelet Count - decreased, FACS B1 cells - decreased, FACS B1a cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - decreased, FACS B2 cells - increased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - decreased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, IgE response to a Cysteine Protease (Papain) - increased, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, NLRP3 inflammasome: high response, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-independent B cell response defect- decreased TNP-specific IgM to 482 B2233 11 59565974 GRCm38 C W 0.450 probably benign MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 T G missense immune system, NALP3 inflammasome signaling defect 507 15 11025935 GRCm38 probably benign MGI:2153040 Slc45a2 solute carrier family 45, member 2 G T critical splice donor site pigmentation, skin/coat/nails 520 C2172 19 40952391 GRCm38 Y * probably null MGI:96878 Blnk B cell linker A T nonsense FACS B cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 526 C2191 7 87438023 GRCm38 V D 0.998 probably damaging MGI:98880 Tyr tyrosinase A T missense pigmentation 535 C2138 7 30425411 GRCm38 probably benign MGI:3041243 Nfkbid nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, delta T G critical splice donor site FACS B cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 544 A3605 11 59565879 GRCm38 W R 0.009 probably benign MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 T C missense immune system, NALP3 inflammasome signaling defect 545 X 60290036 GRCm38 I K 1.000 probably damaging MGI:1859661 Atp11c ATPase, class VI, type 11C A T missense FACS B cells - decreased, hematopoietic system, homeostasis/metabolism, liver/biliary system, reproductive system 551 C2334 7 45431318 GRCm38 probably benign MGI:1342299 Ruvbl2 RuvB-like protein 2 A T critical splice donor site FACS CD4+ T cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV 553 C2133 11 34258184 GRCm38 probably benign MGI:2149010 Dock2 dedicator of cyto-kinesis 2 A T splice site FACS B cells - decreased, FACS CD4+ T cells - decreased, FACS CD8+ T cells - decreased, immune system, T-dependent humoral response defect- decreased antibody response to rSFV 562 C2109 9 106224586 GRCm38 S P 0.999 probably damaging MGI:1932389 Tlr9 toll-like receptor 9 T C missense TLR signaling defect: TNF production by macrophages 567 D299 1 36770983 GRCm38 H R 1.000 probably damaging MGI:99613 Zap70 zeta-chain (TCR) associated protein kinase A G missense FACS CD4+ T cells - decreased, FACS CD8+ T cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV 568 D839 11 59549354 GRCm38 R G 0.999 probably damaging MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 A G missense immune system, NALP3 inflammasome signaling defect 569 D835 X 57223465 GRCm38 S P 0.995 probably damaging MGI:88337 Cd40lg CD40 ligand T C missense 574 C2772 9 106224139 GRCm38 N Y 1.000 probably damaging MGI:1932389 Tlr9 toll-like receptor 9 A T missense immune system 579 D708 7 30877787 GRCm38 Q * probably null MGI:88322 Cd22 CD22 antigen G A nonsense FACS B cells - decreased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 584 E2691 11 59555875 GRCm38 C R 0.893 possibly damaging MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 T C missense immune system, NALP3 inflammasome signaling defect 598 D702 7 MGI:2181411 Slc5a2 solute carrier family 5 (sodium/glucose cotransporter), member 2 large deletion DSS: sensitive day 7, immune system, renal/urinary system 602 C2725 11 34248572 GRCm38 probably benign MGI:2149010 Dock2 dedicator of cyto-kinesis 2 A T critical splice donor site FACS B cells - decreased, immune system, T-dependent humoral response defect- decreased antibody response to rSFV 605 6 41670961 GRCm38 V E 0.997 probably damaging MGI:2429764 Trpv5 transient receptor potential cation channel, subfamily V, member 5 A T missense DSS: sensitive day 7, immune system 609 G6542 2 101641223 GRCm38 probably benign MGI:97848 Rag1 recombination activating gene 1 A T intron FACS B cells - decreased, FACS CD4+ T cells - decreased, FACS CD8+ T cells - decreased, immune system 612 F5724 19 41356683 GRCm38 probably benign MGI:1933177 Pik3ap1 phosphoinositide-3-kinase adaptor protein 1 T A intron T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 615 G6648 7 24899175 GRCm38 C S 1.000 probably damaging MGI:101774 Cd79a CD79A antigen (immunoglobulin-associated alpha) T A missense FACS B cells - decreased, immune system, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 625 G6533 11 34248636 GRCm38 Q * probably null MGI:2149010 Dock2 dedicator of cyto-kinesis 2 G A nonsense FACS CD4+ T cells - decreased, FACS CD8+ T cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV 631 C2131 3 19989148 GRCm38 probably benign MGI:88476 Cp ceruloplasmin T C unclassified iron deficiency 640 7 87438044 GRCm38 H R 0.991 probably damaging MGI:98880 Tyr tyrosinase T C missense pigmentation, skin/coat/nails 641 G6556 8 123407958 GRCm38 Y C 1.000 probably damaging MGI:99456 Mc1r melanocortin 1 receptor A G missense pigmentation, skin/coat/nails 646 F5770 4 149657319 GRCm38 L R 1.000 probably damaging MGI:1098211 Pik3cd phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta A C missense T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 650 5 140876495 GRCm38 R * probably null MGI:1916978 Card11 caspase recruitment domain family, member 11 G A nonsense T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 656 G6596 16 15702157 GRCm38 probably benign MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide T C splice site T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 657 G6373 1 36781025 GRCm38 Y F 0.999 probably damaging MGI:99613 Zap70 zeta-chain (TCR) associated protein kinase A T missense FACS CD4+ T cells - decreased, FACS CD8+ T cells - decreased, hematopoietic competition - disadvantage, immune system 658 G7448 11 54480685 GRCm38 probably benign MGI:2444668 Fnip1 folliculin interacting protein 1 G A critical splice donor site hematopoietic competition - disadvantage, hematopoietic system, homeostasis/metabolism, muscle 659 15 11001092 GRCm38 S R 1.000 probably damaging MGI:2153040 Slc45a2 solute carrier family 45, member 2 T G missense pigmentation, skin/coat/nails 660 E2696 14 MGI:96223 Hr hairless unclassified Body Weight (DSS Male) - decreased, DSS: sensitive day 10, DSS: sensitive day 7, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells - increased, FACS B1b cells in B1 cells - increased, FACS B2 cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS T cells - decreased, skin/coat/nails 661 I1329 9 96140629 GRCm38 probably null MGI:2443336 Gk5 glycerol kinase 5 (putative) GCC GC frame shift FACS CD4:CD8 - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, skin/coat/nails, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 676 G0919 1 165855214 GRCm38 D V 1.000 probably damaging MGI:88334 Cd247 CD247 antigen A T missense hematopoietic competition - disadvantage, immune system 692 I5475 6 124732369 GRCm38 L P 1.000 probably damaging MGI:96055 Ptpn6 protein tyrosine phosphatase, non-receptor type 6 A G missense hematopoietic system, immune system 695 18 43999935 GRCm38 probably benign MGI:1919682 Spink5 serine peptidase inhibitor, Kazal type 5 T G splice site immune system, lethality-postnatal, skin/coat/nails 700 G6791 8 23097638 GRCm38 probably benign MGI:88024 Ank1 ankyrin 1, erythroid T C intron anemia 702 P0043 11 69557283 GRCm38 L P 0.999 probably damaging MGI:109196 Efnb3 ephrin B3 A G missense behavior/neurological 707 P0015 10 121578690 GRCm38 F I 0.995 probably damaging MGI:1929658 Tbk1 TANK-binding kinase 1 A T missense impaired response to dsDNA- type I IFN production by macrophages, lethality-embryonic/perinatal 715 R0009 6 29068972 GRCm38 C * probably null MGI:104663 Lep leptin T A nonsense adipose tissue, Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, FACS CD11b+ DCs (gated in CD11c+ cells) - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, growth/size 733 R0052 11 59565128 GRCm38 R * probably null MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 C T nonsense NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 736 R0122 15 MGI:2153040 Slc45a2 solute carrier family 45, member 2 unclassified pigmentation, skin/coat/nails 741 R0107 3 20030796 GRCm38 L R 1.000 probably damaging MGI:2153839 Hps3 HPS3, biogenesis of lysosomal organelles complex 2 subunit 1 A C missense pigmentation, skin/coat/nails 742 R0090 5 98261987 GRCm38 R * probably null MGI:95519 Fgf5 fibroblast growth factor 5 C T nonsense skin/coat/nails 746 R0103 10 74210425 GRCm38 D V 1.000 probably damaging MGI:1891428 Pcdh15 protocadherin 15 A T missense 754 R0091 13 52640733 GRCm38 Y C 1.000 probably damaging MGI:99515 Syk spleen tyrosine kinase A G missense FACS B cells - decreased, TLR signaling defect: hypersensitivity to LPS, TLR signaling defect: hypersensitivity to MALP2, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages 757 R0103 1 138544242 GRCm38 C * probably null MGI:1890645 Nek7 NIMA (never in mitosis gene a)-related expressed kinase 7 A T nonsense NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 759 R0130 7 88450541 GRCm38 I N 0.995 probably damaging MGI:1919683 Rab38 RAB38, member RAS oncogene family T A missense pigmentation, skin/coat/nails 767 R0010 1 87697546 GRCm38 probably null MGI:107357 Inpp5d inositol polyphosphate-5-phosphatase D G A critical splice donor site FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells - increased, FACS B2 cells - decreased, FACS CD11c+ DCs - increased 769 R0124 16 91499537 GRCm38 Q * probably null MGI:107658 Ifnar1 interferon (alpha and beta) receptor 1 C T nonsense dsDNA induced type I IFN production - decreased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - increased, impaired response to dsDNA- type I IFN production by macrophages 771 R0046 2 122600744 GRCm38 D G 1.000 probably damaging MGI:1914342 Gatm glycine amidinotransferase (L-arginine:glycine amidinotransferase) T C missense Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, DSS: sensitive day 10, DSS: sensitive day 7 773 R0079 4 3746768 GRCm38 H R 1.000 probably damaging MGI:96892 Lyn LYN proto-oncogene, Src family tyrosine kinase A G missense FACS B cells - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS neutrophils - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 799 R0096 11 80484332 GRCm38 L P 0.986 probably damaging MGI:107728 Myo1d myosin ID A G missense DSS: sensitive day 10, DSS: sensitive day 7, FACS NK1.1+ T cells - increased 810 R0049 17 57402841 GRCm38 L * probably null MGI:106912 Adgre1 adhesion G protein-coupled receptor E1 T A nonsense FACS macrophages - decreased 898 R0539 11 98635919 GRCm38 Y C 1.000 probably damaging MGI:3044668 Gsdma3 gasdermin A3 A G missense skin/coat/nails 899 R0124 10 60308056 GRCm38 Y * probably null MGI:1890219 Cdh23 cadherin 23 (otocadherin) G T nonsense 907 R0091 9 75161492 GRCm38 R C 1.000 probably damaging MGI:105976 Myo5a myosin VA C T missense behavior/neurological, pigmentation, skin/coat/nails 914 R0145 4 80840778 GRCm38 Y C 1.000 probably damaging MGI:98881 Tyrp1 tyrosinase-related protein 1 A G missense pigmentation, skin/coat/nails 915 R0148 15 11025868 GRCm38 S P 0.989 probably damaging MGI:2153040 Slc45a2 solute carrier family 45, member 2 T C missense pigmentation, skin/coat/nails 917 R0479 15 79163319 GRCm38 E G 0.999 probably damaging MGI:98358 Sox10 SRY (sex determining region Y)-box 10 T C missense pigmentation, skin/coat/nails 918 R0479 7 87493221 GRCm38 S G 0.938 possibly damaging MGI:98880 Tyr tyrosinase T C missense pigmentation, skin/coat/nails 935 R0143 12 111261576 GRCm38 V D 1.000 probably damaging MGI:108041 Traf3 TNF receptor-associated factor 3 T A missense FACS B cells - decreased, FACS B:T cells - decreased, FACS CD11c+ DCs - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 937 R0115 3 94377609 GRCm38 probably benign MGI:104856 Rorc RAR-related orphan receptor gamma T C splice site Body Weight (Male) - increased, FACS B:T cells - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD8+ T cells - decreased, FACS NK cells - increased, FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV 940 R0491 6 56780389 GRCm38 R * probably null MGI:2384811 Kbtbd2 kelch repeat and BTB (POZ) domain containing 2 G A nonsense 30 min GTT hyperglycemic, Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, FACS B1a cells - decreased, FACS CD44+ CD8 T cells - increased, growth/size, liver/biliary system 941 R0538 15 101035624 GRCm38 K * probably null MGI:103169 Scn8a sodium channel, voltage-gated, type VIII, alpha A T nonsense behavior/neurological 943 R0245 3 20012796 GRCm38 C * probably null MGI:2153839 Hps3 HPS3, biogenesis of lysosomal organelles complex 2 subunit 1 A T nonsense pigmentation, skin/coat/nails 947 R0440 7 56423352 GRCm38 Y F 0.002 probably benign MGI:97454 Oca2 oculocutaneous albinism II A T missense 952 R0012 1 161788164 GRCm38 D G probably benign MGI:99255 Fasl Fas ligand (TNF superfamily, member 6) T C missense T-dependent humoral response defect- decreased antibody response to rSFV 968 R0448 13 53468395 GRCm38 R L 1.000 probably damaging MGI:97169 Msx2 msh homeobox 2 C A missense skin/coat/nails, vision/eye 981 R0284 14 103820013 GRCm38 G D 0.999 probably damaging MGI:102720 Ednrb endothelin receptor type B C T missense lethality-postnatal, pigmentation, skin/coat/nails 984 R0152 6 124867746 GRCm38 Q * probably null MGI:88335 Cd4 CD4 antigen G A nonsense FACS CD4+ T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV 986 R0477 11 60520914 GRCm38 probably null MGI:1261811 Myo15 myosin XV T C critical splice donor site 987 R0047 3 135595053 GRCm38 L * probably null MGI:97312 Nfkb1 nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105 A T nonsense NALP3 inflammasome signaling defect, Nlrc4 inflammasome: low response, NLRP3 inflammasome: low response, T-dependent humoral response defect- decreased antibody response to rSFV 989 R0488 18 5772455 GRCm38 C S 0.998 probably damaging MGI:1344313 Zeb1 zinc finger E-box binding homeobox 1 T A missense T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1009 R0445 10 28782011 GRCm38 R G 1.000 probably damaging MGI:2443552 Themis thymocyte selection associated A G missense FACS B:T cells - increased, FACS B1a cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 1022 R0520 2 3436475 GRCm38 H R 1.000 probably damaging MGI:2441769 Dclre1c DNA cross-link repair 1C A G missense FACS B cells - decreased, FACS B:T cells - increased, FACS B1a cells - decreased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD11c+ DCs - increased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS neutrophils - increased, FACS NK cells - increased, FACS NK1.1+ T cells - decreased, FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1023 R0511 16 15831282 GRCm38 G * probably null MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide G T nonsense Body Weight - decreased, Body Weight (Z-score) - decreased, FACS B cells - decreased, FACS B1 cells - increased, FACS B1a cells - decreased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD11c+ DCs - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS neutrophils - increased, FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1030 R0244 11 80674708 GRCm38 N I 1.000 probably damaging MGI:107728 Myo1d myosin ID T A missense DSS: sensitive day 10, DSS: sensitive day 7 1051 R0464 10 74626844 GRCm38 probably null MGI:1891428 Pcdh15 protocadherin 15 T A critical splice donor site 1054 R0480 4 129555640 GRCm38 E G 1.000 probably damaging MGI:96756 Lck lymphocyte protein tyrosine kinase T C missense DSS: resistant day 10, DSS: sensitive day 7, FACS B cells - increased, FACS B:T cells - increased, FACS B1b cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS IgD+ B cell percentage - increased, FACS IgM+ B cells - increased, FACS macrophages - increased, FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV 1065 R0409 7 122424977 GRCm38 H L 1.000 probably damaging MGI:97596 Prkcb protein kinase C, beta A T missense FACS CD8+ T cells - increased, FACS T cells - increased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1073 R0522 2 121251868 GRCm38 A S 0.125 probably null MGI:1351320 Trp53bp1 transformation related protein 53 binding protein 1 C A missense FACS B:T cells - increased, FACS CD4+ T cells - decreased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS IgD MFI - decreased, FACS T cells - decreased 1075 R0304 18 4339552 GRCm38 L R 0.989 probably damaging MGI:1346878 Map3k8 mitogen-activated protein kinase kinase kinase 8 A C missense TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: hyposensitivity to PAM3CSK4, TLR signaling defect: TNF production by macrophages 1084 R0415 1 36770811 GRCm38 M V 0.025 probably null MGI:99613 Zap70 zeta-chain (TCR) associated protein kinase A G start codon destroyed FACS B:T cells - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD8+ T cells - decreased, FACS T cells - decreased 1096 R0440 15 11000817 GRCm38 M L 0.053 probably benign MGI:2153040 Slc45a2 solute carrier family 45, member 2 A T start codon destroyed pigmentation, skin/coat/nails 1112 R0553 6 125313388 GRCm38 probably null MGI:104875 Ltbr lymphotoxin B receptor A C critical splice donor site FACS B:T cells - increased, T-dependent humoral response defect- decreased antibody response to rSFV 1120 R0266 2 101630603 GRCm38 C W 0.999 probably damaging MGI:97849 Rag2 recombination activating gene 2 T G missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD8+ T cells - decreased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS neutrophils - increased, FACS T cells - decreased, NALP3 inflammasome signaling defect, NLRP3 inflammasome: high response, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1131 R0270 2 167451296 GRCm38 M K 1.000 probably damaging MGI:1924281 Slc9a8 solute carrier family 9 (sodium/hydrogen exchanger), member 8 T A missense DSS: sensitive day 7 1136 R0528 10 82739245 GRCm38 T K 1.000 probably damaging MGI:1915183 Hcfc2 host cell factor C2 C A missense TLR signaling defect: TNF production by macrophages 1172 R0197 10 80730042 GRCm38 A E 1.000 probably damaging MGI:107734 Ap3d1 adaptor-related protein complex 3, delta 1 subunit G T missense pigmentation, skin/coat/nails 1190 R0534 10 82738408 GRCm38 F I 1.000 probably damaging MGI:1915183 Hcfc2 host cell factor C2 T A missense TLR signaling defect: TNF production by macrophages 1216 R0684 7 46783469 GRCm38 probably null MGI:2180307 Hps5 HPS5, biogenesis of lysosomal organelles complex 2 subunit 2 A G critical splice donor site dsDNA induced type I IFN production - increased, FACS CD11c+ DCs - decreased, FACS IgM MFI - decreased, impaired response to dsDNA- type I IFN production by macrophages, pigmentation, skin/coat/nails 1228 R0612 8 71683377 GRCm38 Y C 1.000 probably damaging MGI:99928 Jak3 Janus kinase 3 A G missense 125-03 Response - decreased, FACS B cells - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS NK cells - decreased, FACS T cells - decreased, MCMV susceptibility, OVA-specific IgE - increased, post-MCMV FACS B cells - decreased, post-MCMV FACS CD11c+ DCs - decreased, post-MCMV FACS CD4:CD8 - increased, post-MCMV FACS CD8+ T cells in CD3+ T cells - decreased, post-MCMV FACS IgD+ B cell percentage - decreased, post-MCMV FACS IgM+ B cells - decreased, 1229 R0591 14 103823274 GRCm38 probably null MGI:102720 Ednrb endothelin receptor type B A T splice site digestive/alimentary, growth/size, life span-post-weaning/aging, pigmentation, skin/coat/nails 1243 R0610 8 10031661 GRCm38 probably null MGI:1344376 Tnfsf13b tumor necrosis factor (ligand) superfamily, member 13b G A splice site FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells - increased, FACS CD11c+ DCs - increased, FACS CD8+ T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS neutrophils - increased, FACS T cells - increased, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1244 R0595 17 34212354 GRCm38 V D 0.989 probably damaging MGI:98484 Tap2 transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) T A missense FACS B:T cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased 1255 R0588 19 34327140 GRCm38 V A 0.993 probably damaging MGI:95484 Fas Fas (TNF receptor superfamily member 6) T C missense FACS CD4+ T cells - decreased, FACS CD8+ T cells - decreased, FACS neutrophils - increased, FACS NK cells - increased, FACS T cells - decreased, post-MCMV FACS B1a cells - increased, post-MCMV FACS B2 cells - decreased, post-MCMV FACS CD44+ CD4 MFI - increased, post-MCMV FACS CD44+ CD8 MFI - increased, post-MCMV FACS CD44+ T MFI - increased, post-MCMV FACS IgD MFI - decreased, post-MCMV FACS NK cells - increased, post-MCMV FACS NK T cells - increased, total IgE level - increased 1270 R0531 8 71686976 GRCm38 probably benign MGI:99928 Jak3 Janus kinase 3 C T splice site cellular phenotype, FACS B:T cells - increased, FACS B1b cells - decreased, FACS CD8+ T cells - decreased, hematopoietic system 1273 R0480 8 3161770 GRCm38 S P 1.000 probably damaging MGI:96575 Insr insulin receptor A G missense DSS: sensitive day 10, DSS: sensitive day 7, FACS neutrophils - increased 1276 R0627 15 78564968 GRCm38 T A 1.000 probably damaging MGI:97846 Rac2 Rac family small GTPase 2 T C missense T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1280 R0658 12 91538226 GRCm38 S * probably null MGI:98849 Tshr thyroid stimulating hormone receptor C A nonsense 125-03 Response - increased, Body Weight (Z-score) - decreased, endocrine/exocrine gland, growth/size 1285 R1172 4 80844868 GRCm38 Q * probably null MGI:98881 Tyrp1 tyrosinase-related protein 1 C T nonsense MCMV resistance, pigmentation, skin/coat/nails 1298 R0783 17 35201674 GRCm38 I T 0.987 probably damaging MGI:104798 Tnf tumor necrosis factor A G missense TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: hyposensitivity to PAM3CSK4, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages 1299 R0629 7 98085466 GRCm38 L R 1.000 probably damaging MGI:104510 Myo7a myosin VIIA A C missense 1308 R0113 7 84347530 GRCm38 R C 1.000 probably damaging MGI:107188 Arnt2 aryl hydrocarbon receptor nuclear translocator 2 G A missense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, DSS: sensitive day 10, FACS NK1.1+ T cells - decreased, growth/size, NALP3 inflammasome signaling defect, NK cell response - decreased, NK killing - decreased, NLRP3 inflammasome: high response 1310 R0739 11 116600161 GRCm38 L Q 1.000 probably damaging MGI:2442473 Rhbdf2 rhomboid 5 homolog 2 A T missense TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: hyposensitivity to PAM3CSK4, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages 1313 R0666 18 46560651 GRCm38 D V 1.000 probably damaging MGI:3040056 Ticam2 toll-like receptor adaptor molecule 2 T A missense TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages 1315 R0748 18 65475260 GRCm38 probably null MGI:2445027 Malt1 MALT1 paracaspase T A critical splice donor site post-MCMV FACS B1b cells - increased, post-MCMV FACS CD11b+ DCs (gated in CD11c+ cells) - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1320 R0827 4 66833880 GRCm38 probably null MGI:96824 Tlr4 toll-like receptor 4 T A splice site FACS B220 MFI - decreased, NLRP3 inflammasome: low response, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: TNF production by macrophages 1324 R0594 10 61303722 GRCm38 Y * probably null MGI:97551 Prf1 perforin 1 (pore forming protein) C A nonsense MCMV susceptibility 1325 R1475 13 13708212 GRCm38 probably null MGI:107448 Lyst lysosomal trafficking regulator T A critical splice donor site FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS pDCs - increased, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, MCMV susceptibility, pigmentation, skin/coat/nails 1332 R0785 7 122171661 GRCm38 probably null MGI:1349436 Ern2 endoplasmic reticulum (ER) to nucleus signalling 2 A T critical splice donor site DSS: sensitive day 10, DSS: sensitive day 7 1333 R0863 11 59565850 GRCm38 D G 0.017 probably benign MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 A G missense NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 1335 R1438 19 18955053 GRCm38 L P 1.000 probably damaging MGI:1343464 Rorb RAR-related orphan receptor beta A G missense 1339 R1378 11 70615130 GRCm38 probably null MGI:87894 Chrne cholinergic receptor, nicotinic, epsilon polypeptide T A critical splice acceptor site Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, growth/size, impaired response to dsDNA- type I IFN production by macrophages, MTT Value of PECs - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: hyposensitivity to poly I:C, TLR signaling defect: TNF production by macrophages 1353 R1674 1 34223795 GRCm38 probably null MGI:104627 Dst dystonin T A splice site behavior/neurological, FACS B1a cells in B1 cells - increased, FACS CD11c+ DCs - increased, growth/size 1356 R0967 15 101035646 GRCm38 Y C 1.000 probably damaging MGI:103169 Scn8a sodium channel, voltage-gated, type VIII, alpha A G missense behavior/neurological, Body Weight - decreased, growth/size 1357 R0972 17 43450983 GRCm38 S C 0.957 probably damaging MGI:2182928 Adgrf5 adhesion G protein-coupled receptor F5 A T missense 30 min GTT hyperglycemic 1358 R0893 17 56276693 GRCm38 probably benign MGI:2147032 Ticam1 toll-like receptor adaptor molecule 1 G A critical splice donor site TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: TNF production by macrophages 1370 R1166 17 46409692 GRCm38 Y H 0.892 possibly damaging MGI:1889348 Zfp318 zinc finger protein 318 T C missense FACS IgD MFI - decreased, post-MCMV FACS IgD MFI - decreased 1371 R0882 5 66400255 GRCm38 T S 0.996 probably damaging MGI:108405 Apbb2 amyloid beta (A4) precursor protein-binding, family B, member 2 T A missense 30 min GTT hyperglycemic, 30 min GTT hyperglycemic (male) 1372 R0564 5 66452250 GRCm38 M K 0.986 probably damaging MGI:108405 Apbb2 amyloid beta (A4) precursor protein-binding, family B, member 2 A T missense 30 min GTT hyperglycemic, 30 min GTT hyperglycemic (male), post-MCMV FACS effector memory CD8 T cells in CD8 T cells - increased 1379 R0800 1 164066201 GRCm38 probably null MGI:98279 Sell selectin, lymphocyte T A splice site FACS central memory CD4 T cells in CD4 T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV 1384 R1301 12 31525568 GRCm38 C * probably null MGI:1346029 Slc26a4 solute carrier family 26, member 4 A T nonsense behavior/neurological, DSS: sensitive day 10, hearing/vestibular/ear 1385 R0942 1 138068401 GRCm38 Q * probably null MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C G A nonsense 30 min GTT hypoglycemic, 30 min GTT hypoglycemic (male), Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS CD11c+ DCs - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percent 1387 R1907 5 104486806 GRCm38 W R 1.000 probably damaging MGI:1099818 Pkd2 polycystic kidney disease 2 T A missense renal/urinary system 1389 R1349 7 56535968 GRCm38 M K 0.002 probably benign MGI:97454 Oca2 oculocutaneous albinism II T A missense pigmentation, skin/coat/nails 1394 R1245 7 30869883 GRCm38 S P 1.000 probably damaging MGI:88322 Cd22 CD22 antigen A G missense FACS B cells - decreased, FACS B1a cells - increased, FACS B1a cells in B1 cells - increased, FACS B1b cells in B1 cells - decreased, FACS B2 cells - decreased, FACS IgD MFI - decreased, post-MCMV FACS B cells - decreased, post-MCMV FACS B:T cells - decreased, post-MCMV FACS B1a cells - increased, post-MCMV FACS B1a cells in B1 cells - increased, post-MCMV FACS B1b cells in B1 cells - decreased, post-MCMV FACS IgD+ B cell percentage - decreased, post-MCMV FACS IgM MFI - increased, post-MCMV FACS IgM+ B cells - decreased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1408 R1029 2 126923594 GRCm38 S P 0.002 probably benign MGI:1913802 Sppl2a signal peptide peptidase like 2A A G missense Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1410 R0964 8 76908668 GRCm38 probably null MGI:99459 Nr3c2 nuclear receptor subfamily 3, group C, member 2 A G splice site Body Weight - decreased, growth/size 1411 R1158 6 71373728 GRCm38 V D 0.989 probably damaging MGI:88346 Cd8a CD8 antigen, alpha chain T A missense FACS CD4:CD8 - increased, FACS CD4+ T cells - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, MCMV susceptibility, post-MCMV FACS CD4+ T cells in CD3+ T cells - increased, post-MCMV FACS CD44+ CD8 MFI - increased, post-MCMV FACS CD8+ T cells - decreased, post-MCMV FACS CD8+ T cells in CD3+ T cells - decreased, post-MCMV FACS naive CD8 T cells in CD8 T cells - decreased 1420 R1395 1 34165155 GRCm38 probably null MGI:104627 Dst dystonin T C critical splice donor site behavior/neurological, Body Weight - decreased, Body Weight (Z-score) - decreased, DSS: sensitive day 7, FACS B1a cells in B1 cells - increased, FACS B1b cells in B1 cells - increased, FACS CD11c+ DCs - increased, growth/size, TLR signaling defect: hypersensitivity to CpG + IFNg 1421 R1414 11 59549531 GRCm38 M V 0.190 probably benign MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 A G missense NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 1441 R1544 7 87492706 GRCm38 L F 1.000 probably damaging MGI:98880 Tyr tyrosinase C A missense pigmentation, skin/coat/nails 1442 R1615 10 10741508 GRCm38 Y * probably null MGI:1351338 Grm1 glutamate receptor, metabotropic 1 G T nonsense behavior/neurological, growth/size, life span-post-weaning/aging, skeleton phenotype 1444 R1846 15 94345990 GRCm38 C S 1.000 probably damaging MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 A T missense pigmentation, skin/coat/nails 1446 R1793 13 13647083 GRCm38 C * probably null MGI:107448 Lyst lysosomal trafficking regulator T A nonsense pigmentation, skin/coat/nails 1454 R1536 12 84382295 GRCm38 R * probably null MGI:1321385 Entpd5 ectonucleoside triphosphate diphosphohydrolase 5 G A nonsense 125-03 Response - increased, Body Weight - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, Body Weight (Female) - decreased, Body Weight (Z-score) - decreased, DSS: sensitive day 10, DSS: sensitive day 7, FACS B1 cells - increased, FACS CD44+ CD8 MFI - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, growth/size, phagocytosis in PECs - decreased, TLR signaling defect: hypersensitivity to PAM3CSK4 1462 R1665 1 134747620 GRCm38 A D 0.998 probably damaging MGI:99666 Syt2 synaptotagmin II C A missense behavior/neurological, Body Weight - decreased, growth/size, lethality-postnatal, nervous system 1463 R1468 16 10513288 GRCm38 probably null MGI:108445 Ciita class II transactivator G A critical splice donor site FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, post-MCMV FACS CD4:CD8 - decreased, post-MCMV FACS CD8+ T cells in CD3+ T cells - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: TNF production by macrophages 1474 R1077 1 34164167 GRCm38 E G 1.000 probably damaging MGI:104627 Dst dystonin A G missense behavior/neurological, DSS: resistant day 7, FACS B1a cells in B1 cells - increased, FACS CD11c+ DCs - increased, TLR signaling defect: hypersensitivity to PAM3CSK4, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages 1475 R1460 4 3789908 GRCm38 Y * probably null MGI:96892 Lyn LYN proto-oncogene, Src family tyrosine kinase T A nonsense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells - increased, FACS B1a cells in B1 cells - increased, FACS B220 MFI - decreased, FACS CD4+ T cells - increased, FACS CD8+ T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS neutrophils - decreased, FACS T cells - increased, MCMV susceptibility, post-MCMV FACS B cells - decreased, post-MCMV FACS B:T cells - decreased, post-MCMV FACS B2 cells - decreased, post-MCMV FACS B220 MFI - decreased, post-MCMV FACS IgD+ B cell percentage - decreased, post-MCMV FACS IgM+ B cells - decreased, post-MCMV FACS naive CD4 T cells in CD4 T cells - decreased, post-MCMV FACS naive CD8 T cells in CD8 T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 1477 R1609 9 80288217 GRCm38 probably null MGI:104785 Myo6 myosin VI G A critical splice donor site behavior/neurological, dsDNA induced type I IFN production - increased, hearing/vestibular/ear, impaired response to dsDNA- type I IFN production by macrophages 1479 R1470 3 94397302 GRCm38 Y * probably null MGI:104856 Rorc RAR-related orphan receptor gamma T A nonsense IgE response to a Cysteine Protease (Papain) - increased, T-dependent humoral response defect- decreased antibody response to rSFV 1485 R1617 10 95413081 GRCm38 E * probably null MGI:1201787 Socs2 suppressor of cytokine signaling 2 C A nonsense Body Weight - increased, Body Weight (DSS Male) - increased, Body Weight (DSS) - increased, Body Weight (Male) - increased, growth/size 1498 R1462 7 122582449 GRCm38 M K 1.000 probably damaging MGI:97596 Prkcb protein kinase C, beta T A missense FACS B1 cells - decreased, FACS B1a cells in B1 cells - decreased, FACS IgM MFI - increased, post-MCMV FACS B1a cells in B1 cells - decreased, post-MCMV FACS B1b cells in B1 cells - increased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, TLR signaling defect: hyposensitivity to poly I:C, TLR signaling defect: TNF production by macrophages 1508 R1804 6 85621275 GRCm38 Q * probably null MGI:1934606 Alms1 ALMS1, centrosome and basal body associated C T nonsense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, growth/size 1509 R1602 4 101745645 GRCm38 M K 0.938 possibly damaging MGI:104993 Lepr leptin receptor T A missense adipose tissue, Body Weight - increased, Body Weight (DSS Female) - increased, Body Weight (DSS Male) - increased, Body Weight (DSS) - increased, Body Weight (DSS, z-score) - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, FACS macrophages - increased, growth/size 1510 R1395 7 109020954 GRCm38 R * probably null MGI:2651573 Tub tubby bipartite transcription factor C T nonsense adipose tissue, Body Weight - increased, Body Weight (DSS Male) - increased, Body Weight (DSS) - increased, Body Weight (DSS, z-score) - increased, Body Weight (Z-score) - increased, growth/size 1512 R0270 19 46311626 GRCm38 M L 0.956 possibly damaging MGI:1099800 Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100 A T missense FACS B1a cells - increased 1514 R1549 7 126763512 GRCm38 K * probably null MGI:1346859 Mapk3 mitogen-activated protein kinase 3 A T nonsense NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 1515 R1622 11 59548476 GRCm38 I N 0.991 probably damaging MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 T A missense NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 1519 R2473 1 78122590 GRCm38 probably null MGI:97487 Pax3 paired box 3 C T critical splice donor site pigmentation, skin/coat/nails 1525 R1868 11 5902165 GRCm38 N K 1.000 probably damaging MGI:1270854 Gck glucokinase A T missense 30 min GTT hyperglycemic, 30 min GTT hyperoglycemic (female) 1528 R1651 12 111262036 GRCm38 D E 0.999 probably damaging MGI:108041 Traf3 TNF receptor-associated factor 3 T G missense T-dependent humoral response defect- decreased antibody response to rSFV 1529 R1648 8 10031534 GRCm38 M T 1.000 probably damaging MGI:1344376 Tnfsf13b tumor necrosis factor (ligand) superfamily, member 13b T C missense FACS B:T cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV 1530 R1911 8 111312100 GRCm38 probably benign MGI:1921818 Mlkl mixed lineage kinase domain-like T C intron LPS-induced Necroptosis - decreased, Macrophage necroptosis: low 1534 R1442 7 141264022 GRCm38 T A 0.992 probably damaging MGI:1859212 Irf7 interferon regulatory factor 7 T C missense Nlrc4 inflammasome: high response 1535 R1747 13 13757422 GRCm38 F S 0.004 probably benign MGI:107448 Lyst lysosomal trafficking regulator T C missense 125-03 Response - decreased, phagocytosis in PECs - increased 1537 R1013 4 129558127 GRCm38 C Y 1.000 probably damaging MGI:96756 Lck lymphocyte protein tyrosine kinase C T missense DSS: resistant day 10, DSS: sensitive day 7, FACS B:T cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, post-MCMV FACS CD4:CD8 - decreased, post-MCMV FACS CD4+ T cells - decreased, post-MCMV FACS CD4+ T cells in CD3+ T cells - decreased, post-MCMV FACS CD8+ T cells in CD3+ T cells - increased, post-MCMV FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV 1547 R1535 18 37896093 GRCm38 probably null MGI:1194490 Diaph1 diaphanous related formin 1 A G critical splice donor site FACS B:T cells - increased, FACS B1a cells in B1 cells - decreased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, MCMV susceptibility, OVA-specific IgE - decreased, post-MCMV FACS CD4:CD8 - increased, post-MCMV FACS CD4+ T cells in CD3+ T cells - increased, post-MCMV FACS CD44+ CD4 MFI - decreased, post-MCMV FACS CD44+ CD4 MFI - increased, post-MCMV FACS CD44+ CD8 MFI - increased, post-MCMV FACS CD44+ T MFI - inc 1553 R1418 11 60778032 GRCm38 I T 1.000 probably damaging MGI:2444720 Smcr8 Smith-Magenis syndrome chromosome region, candidate 8 homolog (human) T C missense DSS: sensitive day 10, DSS: sensitive day 7, FACS B1a cells - increased, FACS B1a cells in B1 cells - increased, FACS B1b cells - increased, FACS B220 MFI - increased, FACS CD11c+ DCs - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS macrophages - increased, FACS naive CD8 T cells in CD8 T cells - decreased, TLR signaling defect: hypersensitivity to CpG + IFNg, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: TNF production by macrophages 1567 R1770 17 87980223 GRCm38 W * probably null MGI:1343961 Msh6 mutS homolog 6 G A nonsense ratio of OVA-specific IgE over the total IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, total IgE level - decreased 1569 R0111 5 24372704 GRCm38 T I 1.000 probably damaging MGI:97362 Nos3 nitric oxide synthase 3, endothelial cell C T missense DSS: sensitive day 7, T-independent B cell response defect- increased TNP-specific IgM to TNP-Ficoll immunization 1571 R1596 3 86350304 GRCm38 Q * probably null MGI:1933162 Lrba LPS-responsive beige-like anchor C T nonsense DSS: sensitive day 10, DSS: sensitive day 7, FACS B1b cells in B1 cells - increased, FACS B220 MFI - increased, FACS CD11c+ DCs - increased, FACS effector memory CD4 T cells in CD4 T cells - increased 1583 R1585 1 45327866 GRCm38 probably null MGI:88453 Col3a1 collagen, type III, alpha 1 A T splice site DSS: sensitive day 10, DSS: sensitive day 7 1586 R1816 6 111495791 GRCm38 K * probably null MGI:1351344 Grm7 glutamate receptor, metabotropic 7 A T nonsense behavior/neurological, limbs/digits/tail phenotype, nervous system 1601 R1809 15 94341087 GRCm38 S N 0.999 probably damaging MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 C T missense pigmentation, skin/coat/nails 1603 R0926 7 30869509 GRCm38 probably null MGI:88322 Cd22 CD22 antigen C A critical splice donor site FACS B cells - decreased, FACS B1a cells - increased, FACS B1a cells in B1 cells - increased, FACS B1b cells in B1 cells - decreased, FACS B2 cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, post-MCMV FACS B cells - decreased, post-MCMV FACS B:T cells - decreased, post-MCMV FACS B1a cells - increased, post-MCMV FACS B1a cells in B1 cells - decreased, post-MCMV FACS B2 cells - decreased, post-MCMV FACS IgD+ B cell percentage - decreased, post-MCMV FACS IgM+ B cells - decreased 1607 R1572 6 64429694 GRCm38 Y * probably null MGI:95813 Grid2 glutamate receptor, ionotropic, delta 2 T A nonsense behavior/neurological, growth/size, MCMV susceptibility, nervous system 1608 R1781 18 66859847 GRCm38 V E 0.999 probably damaging MGI:99457 Mc4r melanocortin 4 receptor A T missense adipose tissue, Body Weight - increased, Body Weight (DSS) - increased, Body Weight (DSS, z-score) - increased, Body Weight (Z-score) - increased, growth/size 1609 R2030 14 70571448 GRCm38 R H 1.000 probably damaging MGI:96223 Hr hairless G A missense Body Weight (DSS Male) - decreased, DSS: sensitive day 10, DSS: sensitive day 7, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells - increased, FACS B1b cells in B1 cells - increased, FACS B2 cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS T cells - decreased, skin/coat/nails 1610 R1772 9 96150797 GRCm38 probably null MGI:2443336 Gk5 glycerol kinase 5 (putative) G A critical splice donor site FACS CD4:CD8 - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, skin/coat/nails 1612 R1398 13 13740536 GRCm38 S P 0.908 possibly damaging MGI:107448 Lyst lysosomal trafficking regulator T C missense MCMV susceptibility 1613 R1717 5 117671449 GRCm38 C S 0.994 probably damaging MGI:3610315 Ksr2 kinase suppressor of ras 2 T A missense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Z-score) - increased, growth/size, impaired response to dsDNA- type I IFN production by macrophages 1615 R1905 11 59549036 GRCm38 F V 0.999 probably damaging MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 T G missense NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 1621 R1839 11 116600191 GRCm38 V E 0.936 possibly damaging MGI:2442473 Rhbdf2 rhomboid 5 homolog 2 A T missense 125-03 Response - decreased, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: hyposensitivity to PAM3CSK4, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages 1622 R1940 9 106224647 GRCm38 L P 1.000 probably damaging MGI:1932389 Tlr9 toll-like receptor 9 T C missense TLR signaling defect: hyposensitivity to CpG + IFNg, TLR signaling defect: TNF production by macrophages 1634 R2162 15 94331458 GRCm38 C G 1.000 probably damaging MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 A C missense pigmentation, skin/coat/nails 1638 R2127 6 113760650 GRCm38 L P 1.000 probably damaging MGI:105368 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 A G missense behavior/neurological, Body Weight - decreased, hearing/vestibular/ear 1644 R1115 11 99145277 GRCm38 I K 0.899 possibly damaging MGI:103011 Ccr7 chemokine (C-C motif) receptor 7 A T missense FACS CD4:CD8 - increased, FACS CD4+ T cells - increased, FACS macrophages - decreased, FACS T cells - increased 1647 R2036 2 165062301 GRCm38 C R 0.226 probably benign MGI:88336 Cd40 CD40 antigen T C missense OVA-specific IgE - increased, ratio of OVA-specific IgE over the total IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV 1669 R2058 8 71685383 GRCm38 probably null MGI:99928 Jak3 Janus kinase 3 A T critical splice acceptor site Body Weight (DSS Female) - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - decreased, FACS CD11c+ DCs - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - decreased, FACS NK1.1+ T cells - decreased, FACS T cells - decreased, IgE response to a Cysteine Protease (Papain) - decreased, IgG1 response to a Cysteine Protease (Papain) - decreased, impaired response to dsDNA- type I IFN product 1674 R2104 2 163864865 GRCm38 probably null MGI:2674366 Rims4 regulating synaptic membrane exocytosis 4 C T critical splice donor site Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, growth/size, impaired response to dsDNA- type I IFN production by macrophages 1675 R1996 8 45397697 GRCm38 V A 0.084 probably benign MGI:2156367 Tlr3 toll-like receptor 3 A G missense TLR signaling defect: hyposensitivity to poly I:C, TLR signaling defect: TNF production by macrophages 1676 R2107 13 41338979 GRCm38 C * probably null MGI:97302 Nedd9 neural precursor cell expressed, developmentally down-regulated gene 9 A T nonsense FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, MCMV susceptibility, post-MCMV FACS B1a cells in B1 cells - decreased, post-MCMV FACS B1b cells in B1 cells - increased 1682 R2027 5 140906767 GRCm38 Y C 0.959 probably damaging MGI:1916978 Card11 caspase recruitment domain family, member 11 T C missense FACS B1a cells - increased 1689 R0801 11 34708793 GRCm38 R G 1.000 probably damaging MGI:2149010 Dock2 dedicator of cyto-kinesis 2 T C missense FACS B1b cells in B1 cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased 1691 R2256 17 74445630 GRCm38 I T 0.999 probably damaging MGI:3036243 Nlrc4 NLR family, CARD domain containing 4 A G missense Nlrc4 inflammasome: low response 1692 R2497 9 73084981 GRCm38 L P 1.000 probably damaging MGI:1861441 Rab27a RAB27A, member RAS oncogene family T C missense MCMV susceptibility, pigmentation, skin/coat/nails 1693 R1893 17 34194941 GRCm38 D E 1.000 probably damaging MGI:98483 Tap1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) T G missense FACS CD4:CD8 - increased, MCMV susceptibility, post-MCMV FACS CD4:CD8 - increased, post-MCMV FACS CD4+ T cells - decreased, post-MCMV FACS CD44+ CD8 T cells - decreased, post-MCMV FACS CD44+ T cells - decreased, post-MCMV FACS CD8+ T cells - decreased, post-MCMV FACS IgM+ B cells - decreased, post-MCMV FACS T cells - decreased 1695 R2124 8 22666020 GRCm38 L P 1.000 probably damaging MGI:1338071 Ikbkb inhibitor of kappaB kinase beta A G missense 125-03 Response - decreased, IgE response to a Cysteine Protease (Papain) - decreased, IgG1 response to a Cysteine Protease (Papain) - decreased, MCMV susceptibility, post-MCMV FACS B1a cells in B1 cells - decreased, post-MCMV FACS B1b cells in B1 cells - increased, post-MCMV FACS CD4:CD8 - increased, post-MCMV FACS CD44+ CD4 MFI - decreased, post-MCMV FACS CD44+ CD8 MFI - decreased, post-MCMV FACS CD44+ CD8 T cells - decreased, post-MCMV FACS CD44+ T MFI - decreased, post-MCMV FACS CD8+ T cells - decreased, post-MCMV FACS CD8+ T cells in CD3+ T cells - decreased, post-MCMV FACS CD8a+ DCs (gated in CD11c+ cells) - increased, post-MCMV FACS effector memory CD4 T cells in CD4 T cells - decreased, post-MCMV FACS effector memory CD8 T cells in CD8 T cells - decreased, TLR signaling defect: hyposensitivity to MALP2 1710 R2266 9 107513280 GRCm38 V A 0.999 probably damaging MGI:1929813 Cacna2d2 calcium channel, voltage-dependent, alpha 2/delta subunit 2 T C missense Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, growth/size 1711 R2146 6 56779090 GRCm38 Y H 0.996 probably damaging MGI:2384811 Kbtbd2 kelch repeat and BTB (POZ) domain containing 2 A G missense 30 min GTT hyperglycemic, 30 min GTT hyperglycemic (male), Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, growth/size, MCMV susceptibility 1712 R2140 5 88772723 GRCm38 C R 1.000 probably damaging MGI:102726 Dck deoxycytidine kinase T C missense Body Weight - decreased, Body Weight (Z-score) - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells - increased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD11c+ DCs - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decrease 1717 R2256 8 21998266 GRCm38 T P 1.000 probably damaging MGI:103297 Atp7b ATPase, Cu++ transporting, beta polypeptide T G missense liver/biliary system, MTT Value of PECs - decreased 1718 R2208 2 147365802 GRCm38 I N 1.000 probably damaging MGI:97485 Pax1 paired box 1 T A missense limbs/digits/tail phenotype 1720 R0115 2 163864120 GRCm38 V E 0.994 probably damaging MGI:2674366 Rims4 regulating synaptic membrane exocytosis 4 A T missense Body Weight - decreased, Body Weight (Z-score) - decreased, growth/size 1725 R2167 1 161787138 GRCm38 S R 0.001 probably benign MGI:99255 Fasl Fas ligand (TNF superfamily, member 6) T G missense T-dependent humoral response defect- decreased antibody response to rSFV 1728 R0418 1 158716990 GRCm38 C F 1.000 probably damaging MGI:3051647 Pappa2 pappalysin 2 C A missense Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, growth/size 1731 R2339 6 115451044 GRCm38 R L 1.000 probably damaging MGI:97747 Pparg peroxisome proliferator activated receptor gamma G T missense Body Weight - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, Body Weight (Z-score) - decreased, growth/size 2199 R2061 7 30870105 GRCm38 V M 1.000 probably damaging MGI:88322 Cd22 CD22 antigen C T missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells - increased, FACS B1a cells in B1 cells - increased, FACS B2 cells - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased 2203 R2324 14 55605910 GRCm38 probably null MGI:107587 Irf9 interferon regulatory factor 9 T C splice site dsDNA induced type I IFN production - increased, IgE response to a Cysteine Protease (Papain) - decreased, impaired response to dsDNA- type I IFN production by macrophages, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low 2207 R2374 10 77559681 GRCm38 V I 0.001 probably benign MGI:96611 Itgb2 integrin beta 2 G A missense dsDNA induced type I IFN production - increased, impaired response to dsDNA- type I IFN production by macrophages 2209 R2408 11 72262076 GRCm38 S P 0.998 probably damaging MGI:3037150 Slc13a5 solute carrier family 13 (sodium-dependent citrate transporter), member 5 A G missense Body Weight - decreased, Body Weight (DSS) - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, growth/size 2210 R1899 11 3531326 GRCm38 A D 0.895 possibly damaging MGI:1354727 Smtn smoothelin G T missense Body Weight - decreased, growth/size 2213 R1083 16 3990910 GRCm38 Q * probably null MGI:106299 Slx4 SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae) G A nonsense Body Weight - decreased, Body Weight (DSS Female) - decreased, Body Weight (DSS) - decreased, growth/size 2232 R2852 16 15652552 GRCm38 probably null MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide T C critical splice donor site Body Weight - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, FACS IgD MFI - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: TNF production by macrophages 2235 R1888 13 52640790 GRCm38 Y C 1.000 probably damaging MGI:99515 Syk spleen tyrosine kinase A G missense FACS B cells - increased, IgE response to a Cysteine Protease (Papain) - increased 2236 R3875 1 90928122 GRCm38 C R 1.000 probably damaging MGI:2176380 Mlph melanophilin T C missense 2238 R3625 18 4333965 GRCm38 R C 1.000 probably damaging MGI:1346878 Map3k8 mitogen-activated protein kinase kinase kinase 8 G A missense FACS B1 cells - increased, NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: hyposensitivity to PAM3CSK4, TLR signaling defect: hyposensitivity to poly I:C, TLR signaling defect: TNF production by macrophages 2239 R3404 12 41110847 GRCm38 L * probably null MGI:2135611 Immp2l IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) T A nonsense Body Weight - decreased, Body Weight (DSS Female) - decreased, Body Weight (DSS Male) - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, growth/size 2241 R3011 4 66839254 GRCm38 K * probably null MGI:96824 Tlr4 toll-like receptor 4 A T nonsense LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: TNF production by macrophages 2242 R2419 11 46338217 GRCm38 F L 1.000 probably damaging MGI:96621 Itk IL2 inducible T cell kinase A G missense FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, IgE response to a Cysteine Protease (Papain) - increased, total IgE level - increased 2243 R1888 4 66841172 GRCm38 V A 1.000 probably damaging MGI:96824 Tlr4 toll-like receptor 4 T C missense FACS B cells - decreased, FACS B220 MFI - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: TNF production by macrophages 2244 R1929 4 66839444 GRCm38 H L 0.998 probably damaging MGI:96824 Tlr4 toll-like receptor 4 A T missense TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: TNF production by macrophages 2245 R0512 18 65458200 GRCm38 N K 1.000 probably damaging MGI:2445027 Malt1 MALT1 paracaspase T A missense T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2246 R0319 18 65462915 GRCm38 probably null MGI:2445027 Malt1 MALT1 paracaspase T C critical splice donor site FACS CD8a+ DCs (gated in CD11c+ cells) - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2250 R3689 1 36781412 GRCm38 C R 1.000 probably damaging MGI:99613 Zap70 zeta-chain (TCR) associated protein kinase T C missense 30 min GTT hypoglycemic, dsDNA induced type I IFN production - increased, FACS B:T cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS NK cells - increased, FACS T cells - decreased, impaired response to dsDNA- type I IFN production by macrophages, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, TLR signaling defect: hypersensitivity to LPS, TLR signaling defect: hypersensitivity to PAM3CSK4, TLR signaling defect: hypersensitivity to R848, TLR sign 2255 R3404 7 128070703 GRCm38 probably null MGI:96607 Itgam integrin alpha M A G splice site FACS CD11b+ DCs (gated in CD11c+ cells) - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS macrophages - decreased, FACS neutrophils - decreased, FACS pDCs - increased, impaired response to dsDNA- type I IFN production by macrophages, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: TNF production by macrophages 2260 R3977 1 160959399 GRCm38 probably null MGI:2685397 Rc3h1 RING CCCH (C3H) domains 1 A G critical splice acceptor site Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, growth/size, limbs/digits/tail phenotype 2263 R3691 9 96129096 GRCm38 probably null MGI:2443336 Gk5 glycerol kinase 5 (putative) T C critical splice donor site FACS CD4:CD8 - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, NALP3 inflammasome signaling defect, NLRP3 inflammasome: high response, skin/coat/nails 2268 R3498 12 113271374 GRCm38 Q * probably null MGI:2685746 Ighe Immunoglobulin heavy constant epsilon G A nonsense ratio of OVA-specific IgE over the total IgE - increased, total IgE level - decreased 2271 R3027 7 128148572 GRCm38 Y * probably null MGI:96609 Itgax integrin alpha X C A nonsense FACS CD11b+ DCs (gated in CD11c+ cells) - decreased, FACS CD11c+ DCs - decreased, FACS pDCs - increased 2277 R3402 2 11283849 GRCm38 T A 0.822 possibly damaging MGI:97601 Prkcq protein kinase C, theta A G missense T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 2279 R3084 1 86547526 GRCm38 probably null MGI:1270843 Pde6d phosphodiesterase 6D, cGMP-specific, rod, delta T C splice site Body Weight - decreased, Body Weight (DSS Female) - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased 2282 R3715 18 66859821 GRCm38 N Y 0.999 probably damaging MGI:99457 Mc4r melanocortin 4 receptor T A missense 125-03 Response - decreased, adipose tissue, Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, growth/size, MTT Value of PECs - decreased, T-dependent humoral response defect- increased antibody response to rSFV 2284 R3726 14 20530942 GRCm38 probably null MGI:107163 Ppp3cb protein phosphatase 3, catalytic subunit, beta isoform A G critical splice donor site DSS: sensitive day 10, FACS B:T cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS NK cells - increased, FACS T cells - decreased, IgG1 response to a Cysteine Protease (Papain) - decreased, OVA-specific IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, Total IgE After 2nd OVA/Alum Challe 2286 R3690 11 16871881 GRCm38 probably benign MGI:95294 Egfr epidermal growth factor receptor T C splice site 30 min GTT hypoglycemic (male), skin/coat/nails 2287 R3418 11 34689760 GRCm38 M K 0.999 probably damaging MGI:2149010 Dock2 dedicator of cyto-kinesis 2 A T missense FACS B1 cells - increased, FACS B1a cells in B1 cells - decreased, FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased 2290 R3437 11 83069564 GRCm38 H L 0.045 probably benign MGI:1313258 Slfn2 schlafen 2 A T missense T-dependent humoral response defect- decreased antibody response to rSFV 2292 R3795 11 101186764 GRCm38 E G 0.994 probably damaging MGI:1858201 Cntnap1 contactin associated protein-like 1 A G missense Body Weight - decreased 2294 R3690 11 60778028 GRCm38 M V 0.999 probably null MGI:2444720 Smcr8 Smith-Magenis syndrome chromosome region, candidate 8 homolog (human) A G start codon destroyed DSS: sensitive day 10, DSS: sensitive day 7, FACS B1a cells - increased, FACS B1a cells in B1 cells - increased, FACS B220 MFI - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, TLR signaling defect: hypersensitivity to CpG + IFNg, TLR signaling defect: TNF production by macrophages 2298 R1035 1 14891303 GRCm38 probably null MGI:3522699 Trpa1 transient receptor potential cation channel, subfamily A, member 1 A G critical splice donor site 2302 R4094 9 73075544 GRCm38 I L 0.988 probably damaging MGI:1861441 Rab27a RAB27A, member RAS oncogene family A C missense pigmentation, skin/coat/nails 2303 R0751 15 78565945 GRCm38 D A 0.955 possibly damaging MGI:97846 Rac2 Rac family small GTPase 2 T G missense FACS B:T cells - increased, FACS B1 cells - decreased, FACS B1a cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells - increased, FACS B1b cells in B1 cells - increased, FACS CD4:CD8 - increased, FACS CD8+ T cells - decreased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, TLR signaling defect: hypersensitivity to LPS, TLR signaling defect: hypersensitivity to PAM3CSK4, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: TNF production by macrophages 2304 R3723 13 100223014 GRCm38 Y * probably null MGI:1298220 Naip5 NLR family, apoptosis inhibitory protein 5 G T nonsense Nlrc4 inflammasome: low response 2305 R3401 13 100221903 GRCm38 Q * probably null MGI:1298220 Naip5 NLR family, apoptosis inhibitory protein 5 G A nonsense Nlrc4 inflammasome: low response 2307 R3745 8 111315567 GRCm38 probably benign MGI:1921818 Mlkl mixed lineage kinase domain-like A G intron LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, TLR signaling defect: hypersensitivity to CpG + IFNg 2310 R1763 12 98234266 GRCm38 N S 1.000 probably damaging MGI:95636 Galc galactosylceramidase T C missense Body Weight - decreased, Body Weight (Z-score) - decreased 2311 R4192 15 78446657 GRCm38 probably null MGI:1919003 Tmprss6 transmembrane serine protease 6 A T splice site growth/size, skin/coat/nails 2313 R3548 1 195155888 GRCm38 C * probably null MGI:88489 Cr2 complement receptor 2 A T nonsense T-dependent humoral response defect- decreased antibody response to rSFV 2314 R0801 7 122180862 GRCm38 probably benign MGI:1349436 Ern2 endoplasmic reticulum (ER) to nucleus signalling 2 A G splice site DSS: sensitive day 10, DSS: sensitive day 7 2315 R3736 4 3745330 GRCm38 W C 1.000 probably damaging MGI:96892 Lyn LYN proto-oncogene, Src family tyrosine kinase G T missense FACS B1 cells - increased, FACS CD8+ T cells - decreased, FACS macrophages - increased, FACS NK cells - decreased, FACS T cells - decreased 2317 R2925 3 68697987 GRCm38 probably null MGI:96539 Il12a interleukin 12a TCAC TC frame shift MCMV proliferation in macrophages - increased, MCMV susceptibility 2318 R3959 19 25184941 GRCm38 probably null MGI:1921396 Dock8 dedicator of cytokinesis 8 G A critical splice donor site FACS B:T cells - increased, FACS CD4+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD8+ T cells - decreased, FACS macrophages - increased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV 2325 R2860 6 71334101 GRCm38 R G 0.996 probably damaging MGI:88347 Cd8b1 CD8 antigen, beta chain 1 A G missense FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - decreased, T-dependent humoral response defect- increased antibody response to rSFV 2330 R4479 15 94403445 GRCm38 R H 0.999 probably damaging MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 C T missense pigmentation, skin/coat/nails 2331 R4344 15 78459427 GRCm38 probably null MGI:1919003 Tmprss6 transmembrane serine protease 6 T A splice site FACS T cells - decreased, skin/coat/nails 2335 R3889 13 30761490 GRCm38 probably benign MGI:1096873 Irf4 interferon regulatory factor 4 T C splice site FACS B1 cells - increased, FACS IgM MFI - increased, T-dependent humoral response defect- decreased antibody response to rSFV 2336 R3848 1 164065661 GRCm38 K * probably null MGI:98279 Sell selectin, lymphocyte A T nonsense FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 2337 R4012 18 20451862 GRCm38 V E 0.814 possibly damaging MGI:2661061 Dsg4 desmoglein 4 T A missense skin/coat/nails 2338 R3410 5 76229554 GRCm38 Q * probably null MGI:99698 Clock circadian locomotor output cycles kaput G A nonsense Body Weight - increased 2340 R2145 11 97373124 GRCm38 F L 0.147 probably benign MGI:2651588 Socs7 suppressor of cytokine signaling 7 T C missense Body Weight - decreased 2345 R3707 1 158834918 GRCm38 Y * probably null MGI:3051647 Pappa2 pappalysin 2 A T nonsense Body Weight - decreased, Body Weight (DSS, z-score) - decreased, Body Weight (Female) - decreased, Body Weight (Z-score) - decreased, growth/size 2350 R3904 15 66766162 GRCm38 Q * probably null MGI:98733 Tg thyroglobulin C T nonsense Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, OVA-specific IgE - increased, total IgE level - increased 2351 R3847 2 66242679 GRCm38 L S 0.998 probably damaging MGI:1920918 Ttc21b tetratricopeptide repeat domain 21B A G missense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased 2352 R3917 11 80666578 GRCm38 V E 1.000 probably damaging MGI:107728 Myo1d myosin ID A T missense DSS: sensitive day 10, DSS: sensitive day 7 2356 R3803 8 111355398 GRCm38 probably null MGI:2443327 Fa2h fatty acid 2-hydroxylase A G critical splice donor site skin/coat/nails 2360 R4007 12 31540533 GRCm38 K * probably null MGI:1346029 Slc26a4 solute carrier family 26, member 4 T A nonsense behavior/neurological, hearing/vestibular/ear 2361 R1585 6 29069090 GRCm38 H N 0.952 possibly damaging MGI:104663 Lep leptin C A missense Body Weight - increased, Body Weight (DSS) - increased, growth/size 2363 R4294 17 56271339 GRCm38 I T 0.063 probably benign MGI:2147032 Ticam1 toll-like receptor adaptor molecule 1 A G missense TLR signaling defect: hyposensitivity to poly I:C + IFNg, TLR signaling defect: TNF production by macrophages 2364 R3978 9 8004284 GRCm38 G D 1.000 probably damaging MGI:103262 Yap1 yes-associated protein 1 C T missense DSS: sensitive day 10, DSS: sensitive day 7 2369 R1747 7 122173819 GRCm38 probably null MGI:1349436 Ern2 endoplasmic reticulum (ER) to nucleus signalling 2 C A critical splice acceptor site DSS: sensitive day 10, DSS: sensitive day 7 2370 R2061 1 133012651 GRCm38 F I 1.000 probably damaging MGI:107934 Mdm4 transformed mouse 3T3 cell double minute 4 A T missense FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased 2371 R4638 13 13696794 GRCm38 probably null MGI:107448 Lyst lysosomal trafficking regulator T C splice site FACS CD44+ CD8 T cells - increased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS NK1.1+ T cells - increased, pigmentation, skin/coat/nails 2372 R4231 8 71685545 GRCm38 V D 1.000 probably damaging MGI:99928 Jak3 Janus kinase 3 T A missense FACS B cells - decreased, FACS B1 cells - decreased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - decreased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, ratio of OVA-specific IgE over the total IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2375 R4351 11 75441812 GRCm38 L P 1.000 probably damaging MGI:2681828 Wdr81 WD repeat domain 81 A G missense behavior/neurological, Body Weight - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, dsDNA induced type I IFN production - decreased, impaired response to dsDNA- type I IFN production by macrophages, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low 2378 R4067 11 23753215 GRCm38 probably null MGI:97897 Rel reticuloendotheliosis oncogene A C critical splice donor site FACS B1 cells - decreased, FACS CD4+ T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - increased, ratio of OVA-specific IgE over the total IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, total IgE level - decreased 2379 R4213 4 66840326 GRCm38 I N 1.000 probably damaging MGI:96824 Tlr4 toll-like receptor 4 T A missense LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: TNF production by macrophages 2380 R4190 17 57402811 GRCm38 Y C unknown MGI:106912 Adgre1 adhesion G protein-coupled receptor E1 A G missense FACS macrophages - decreased 2381 R4089 10 19601485 GRCm38 probably null MGI:107655 Ifngr1 interferon gamma receptor 1 T C critical splice donor site FACS IgD+ B cell percentage - increased, FACS IgM+ B cells - increased, FACS macrophages - decreased, TLR signaling defect: hyposensitivity to poly I:C + IFNg, TLR signaling defect: TNF production by macrophages 2382 R2474 13 101702776 GRCm38 Y * probably null MGI:97583 Pik3r1 phosphoinositide-3-kinase regulatory subunit 1 A T nonsense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, FACS CD4+ T cells - increased, FACS CD8+ T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS T cells - increased, IgE response to a Cysteine Protease (Papain) - increased, OVA-specific IgE - increased 2386 R4417 4 66839303 GRCm38 N I 1.000 probably damaging MGI:96824 Tlr4 toll-like receptor 4 A T missense LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, Nlrc4 inflammasome: low response, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: TNF production by macrophages 2387 R4428 7 144840707 GRCm38 V A 1.000 probably damaging MGI:95517 Fgf3 fibroblast growth factor 3 T C missense limbs/digits/tail phenotype, OVA-specific IgE after 2nd OVA/Alum - increased 2388 R4082 6 124728419 GRCm38 D G 1.000 probably damaging MGI:96055 Ptpn6 protein tyrosine phosphatase, non-receptor type 6 T C missense FACS B cells - decreased, FACS B1 cells - increased, FACS B1a cells - increased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS CD11c+ DCs - increased, FACS CD44+ CD8 MFI - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS macrophages - increased 2389 R4818 1 78132232 GRCm38 V A 0.999 probably damaging MGI:97487 Pax3 paired box 3 A G missense 2394 R4181 3 94387193 GRCm38 C Y 1.000 probably damaging MGI:104856 Rorc RAR-related orphan receptor gamma G A missense FACS B:T cells - increased, FACS B1a cells - increased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - increased, FACS macrophages - increased, FACS naive CD8 T cells in CD8 T cells - decreased, NALP3 inflammasome signaling defect, NLRP3 inflammasome: high response, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV 2399 R3785 2 79454595 GRCm38 N I 1.000 probably damaging MGI:1339708 Neurod1 neurogenic differentiation 1 T A missense behavior/neurological, hearing/vestibular/ear 2401 R4156 10 80260724 GRCm38 R * probably null MGI:1098221 Gamt guanidinoacetate methyltransferase T A nonsense Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased 2406 R4190 9 62732109 GRCm38 C S 1.000 probably damaging MGI:2442114 Itga11 integrin alpha 11 T A missense 125-03 Response - decreased, Body Weight - decreased, Body Weight (Female) - decreased 2408 R4474 13 62875261 GRCm38 L P 1.000 probably damaging MGI:95492 Fbp1 fructose bisphosphatase 1 A G missense 2411 R4305 11 59548010 GRCm38 R * probably null MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 C T nonsense NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response, OVA-specific IgE - increased 2412 R4427 16 17281044 GRCm38 R H 0.997 probably damaging MGI:2448506 Pi4ka phosphatidylinositol 4-kinase alpha C T missense FACS CD44+ CD4 T cells - increased, FACS CD44+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - decreased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, MTT Value of PECs - decreased, NALP3 inflammasome signaling defect, NLRP3 inflammasome: high response, TLR signaling defect: hyposensitivity to PAM3CSK4, TLR signaling defect: TNF production by macrophages 2420 R4487 15 66671396 GRCm38 C Y 0.999 probably damaging MGI:98733 Tg thyroglobulin G A missense Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Z-score) - decreased, DSS: sensitive day 10, FACS B cells - decreased, FACS B1a cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 T cells - increased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS macrophages - increased 2421 R4255 13 55166251 GRCm38 V M 1.000 probably damaging MGI:95525 Fgfr4 fibroblast growth factor receptor 4 G A missense Body Weight - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, Body Weight (Z-score) - decreased, FACS B1a cells in B1 cells - decreased 2424 R4355 7 19811580 GRCm38 C * probably null MGI:88140 Bcl3 B cell leukemia/lymphoma 3 G T nonsense FACS B1 cells - increased, FACS B1b cells in B1 cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD8+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS macrophages - increased, ratio of OVA-specific IgE over the total IgE - increased, T-dependent humoral response defect- decreased antibody response to rSFV, Total IgE After 2nd OVA/Alum Challenge (day 7) - decreased, total IgE level - decreased 2425 R4355 10 21152617 GRCm38 S P 0.998 probably damaging MGI:97249 Myb myeloblastosis oncogene A G missense FACS B1 cells - decreased, FACS B1a cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS IgM MFI - increased, FACS macrophages - decreased, FACS NK cells - increased, FACS NK1.1+ T cells - decreased, NALP3 inflammasome signaling defect, NLRP3 inflammasome: high response 2429 R4242 10 76608106 GRCm38 probably null MGI:88460 Col6a2 collagen, type VI, alpha 2 C T critical splice donor site Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, growth/size 2433 R4236 1 58844770 GRCm38 V A 1.000 probably damaging MGI:1261423 Casp8 caspase 8 T C missense FACS B1 cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - decreased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased 2439 R4703 4 80840806 GRCm38 probably null MGI:98881 Tyrp1 tyrosinase-related protein 1 T A critical splice donor site pigmentation, skin/coat/nails 2444 R4379 15 98909263 GRCm38 C * probably null MGI:1289247 Lmbr1l limb region 1 like G T nonsense CD8 response - decreased, CTL killing - decreased, CTL killing dominant epitope - decreased, FACS B cells - increased, FACS B:T cells - increased, FACS B1 cells - increased, FACS B1a cells in B1 cells - decreased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - decreased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - increased, FACS IgM MFI - increased, FACS IgM+ B cells - increased, FACS macrop 2446 R4328 14 20530948 GRCm38 I K 0.997 probably damaging MGI:107163 Ppp3cb protein phosphatase 3, catalytic subunit, beta isoform A T missense FACS B:T cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS NK cells - increased, FACS T cells - decreased, IgG1 response to a Cysteine Protease (Papain) - decreased, OVA-specific IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, Total IgE After 2nd OVA/Alum Challenge (day 7) - increased 2456 R4585 10 74624284 GRCm38 R W 1.000 probably damaging MGI:1891428 Pcdh15 protocadherin 15 C T missense behavior/neurological, hearing/vestibular/ear 2473 R4541 6 71373872 GRCm38 D V 0.022 probably benign MGI:88346 Cd8a CD8 antigen, alpha chain A T missense FACS CD4:CD8 - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS effector memory CD8 T cells in CD8 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased 2483 R2089 4 149652699 GRCm38 L P 1.000 probably damaging MGI:1098211 Pik3cd phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta A G missense FACS B1 cells - decreased, impaired response to dsDNA- type I IFN production by macrophages, MCMV proliferation in macrophages - increased, MCMV susceptibility, OVA-specific IgE - increased, post-MCMV FACS B1a cells - decreased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2486 R4653 2 126920313 GRCm38 probably null MGI:1913802 Sppl2a signal peptide peptidase like 2A C T splice site FACS central memory CD8 T cells in CD8 T cells - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, Total IgE After 2nd OVA/Alum Challenge (day 7) - decreased, total IgE level - decreased 2487 R4436 15 78570743 GRCm38 Y * probably null MGI:97846 Rac2 Rac family small GTPase 2 G T nonsense FACS B cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2489 R4639 14 50950923 GRCm38 R * probably null MGI:97365 Pnp purine-nucleoside phosphorylase C T nonsense T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 2493 R4645 1 16691716 GRCm38 E * probably null MGI:1341909 Ly96 lymphocyte antigen 96 G T nonsense LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, NALP3 inflammasome signaling defect, Nlrc4 inflammasome: low response, NLRP3 inflammasome: low response, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: TNF production by macrophages 2498 R4507 10 79724786 GRCm38 I N 0.998 probably damaging MGI:1298210 Hcn2 hyperpolarization-activated, cyclic nucleotide-gated K+ 2 T A missense behavior/neurological, Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, FACS CD4:CD8 - increased, FACS CD8+ T cells in CD3+ T cells - decreased 2505 R4475 11 54939596 GRCm38 probably null MGI:1926194 Tnip1 TNFAIP3 interacting protein 1 A G critical splice donor site DSS: sensitive day 10, FACS B cells - decreased, FACS B1 cells - increased, FACS B1a cells - increased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, FACS CD11c+ DCs - increased, FACS CD44+ CD8 MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - decreased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS NK cells - decreased, IgA response to 2nd OVA/Alum Challenge (day 7) - increased, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, NALP3 inflammasome signaling defect, NLRP3 inflammasome: high response, OVA-specific IgE - increased, total IgE level - increased 2514 R4345 4 101765152 GRCm38 probably null MGI:104993 Lepr leptin receptor G A critical splice donor site 30 min GTT hyperglycemic, Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, FACS macrophages - increased, growth/size, NK cell response - decreased, NK killing - decreased, OVA-specific IgE - increased, TLR signaling defect: hyposensitivity to CpG + IFNg, total IgE level - increased 2518 R4700 15 94394622 GRCm38 C * probably null MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 A T nonsense 2532 R4760 8 111319716 GRCm38 probably null MGI:1921818 Mlkl mixed lineage kinase domain-like C G critical splice donor site LPS-induced Necroptosis - decreased, Macrophage necroptosis: low 2534 R4471 6 29204632 GRCm38 Q * probably null MGI:96567 Impdh1 inosine monophosphate dehydrogenase 1 G A nonsense TLR signaling defect: hyposensitivity to CpG + IFNg, vision/eye 2535 R4541 19 27238792 GRCm38 C R 1.000 probably damaging MGI:98935 Vldlr very low density lipoprotein receptor T C missense TLR signaling defect: hypersensitivity to CpG + IFNg, vision/eye 2536 R4239 14 103089418 GRCm38 S L 1.000 probably damaging MGI:1354702 Fbxl3 F-box and leucine-rich repeat protein 3 G A missense 2537 R1688 1 91423829 GRCm38 L P 1.000 probably damaging MGI:1195265 Per2 period circadian clock 2 A G missense 2539 R2379 8 95260130 GRCm38 L P 0.998 probably damaging MGI:2664102 Cngb1 cyclic nucleotide gated channel beta 1 A G missense FACS B1a cells - increased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, vision/eye 2540 R4622 10 60300851 GRCm38 C W 1.000 probably damaging MGI:97783 Psap prosaposin T G missense behavior/neurological 2543 R4944 1 36550311 GRCm38 C F 1.000 probably damaging MGI:109252 Sema4c sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C C A missense pigmentation, skin/coat/nails 2546 R4446 14 99302230 GRCm38 R C 1.000 probably damaging MGI:1338056 Klf5 Kruppel-like factor 5 C T missense DSS: sensitive day 10, DSS: sensitive day 7 2548 R4742 11 34294170 GRCm38 probably null MGI:2149010 Dock2 dedicator of cyto-kinesis 2 T G critical splice acceptor site FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, OVA-specific IgE - increased, resistance to B10-F16 melanoma - decreased, total IgE level - increased 2549 R4654 19 41327909 GRCm38 S P 0.999 probably damaging MGI:1933177 Pik3ap1 phosphoinositide-3-kinase adaptor protein 1 A G missense FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2553 R4537 10 77561216 GRCm38 probably null MGI:96611 Itgb2 integrin beta 2 G A critical splice donor site CD8 response - decreased, CTL killing - decreased, CTL killing dominant epitope - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1b cells - increased, FACS CD11b+ DCs (gated in CD11c+ cells) - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS macrophages - decreased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - decreased, FACS NK1.1+ T cells - increased, NK cell response - decreased, NK killing - decreased, T-dependent humoral response defe 2556 R4630 2 121207887 GRCm38 A D 1.000 probably damaging MGI:1351320 Trp53bp1 transformation related protein 53 binding protein 1 G T missense Body Weight - decreased, Body Weight (Z-score) - decreased, FACS CD44+ CD8 MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV 2560 R4934 7 46769351 GRCm38 Q * probably null MGI:2180307 Hps5 HPS5, biogenesis of lysosomal organelles complex 2 subunit 2 G A nonsense pigmentation, skin/coat/nails 2561 R4857 1 171158810 GRCm38 R C 1.000 probably damaging MGI:103177 Mpz myelin protein zero C T missense 2563 R4763 8 9972955 GRCm38 D G 1.000 probably damaging MGI:1335098 Lig4 ligase IV, DNA, ATP-dependent T C missense FACS B cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - decreased, FACS IgM+ B cells - decreased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - increased, FACS T cells - decreased, resistance to B10-F16 melanoma - decreased, resistance to B10-F16 melanom 2565 R4806 18 66859488 GRCm38 I F 1.000 probably damaging MGI:99457 Mc4r melanocortin 4 receptor T A missense Body Weight - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, growth/size 2566 R4682 17 34214032 GRCm38 Y * probably null MGI:98484 Tap2 transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) C A nonsense CD8 response - decreased, CTL killing - decreased, CTL killing dominant epitope - decreased, FACS B1a cells in B1 cells - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - increased, NK cell response - decreased, NK killing - decreased 2570 R4588 6 142449455 GRCm38 M T 0.666 possibly damaging MGI:2385254 Gys2 glycogen synthase 2 A G missense 30 min GTT hyperoglycemic (female), FACS IgM MFI - decreased 2572 R3151 6 142456333 GRCm38 E G 0.001 probably benign MGI:2385254 Gys2 glycogen synthase 2 T C missense 30 min GTT hyperglycemic, 30 min GTT hyperoglycemic (female) 2575 R4194 6 85677990 GRCm38 Q * probably null MGI:1934606 Alms1 ALMS1, centrosome and basal body associated C T nonsense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, resistance to B10-F16 melanoma - decreased 2576 R5135 10 100088222 GRCm38 probably null MGI:96974 Kitl kit ligand T C critical splice donor site pigmentation, skin/coat/nails 2578 R4425 13 20600212 GRCm38 Y * probably null MGI:2153044 Elmo1 engulfment and cell motility 1 C G nonsense FACS B cells - decreased, FACS B1 cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased 2582 R4820 2 11226986 GRCm38 probably null MGI:97601 Prkcq protein kinase C, theta G A critical splice donor site T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 2583 R4778 5 140883782 GRCm38 probably null MGI:1916978 Card11 caspase recruitment domain family, member 11 G T splice site CD8 response - decreased, CTL killing - decreased, CTL killing dominant epitope - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, FACS B220 MFI - decreased, FACS CD4+ T cells - increased, FACS CD8+ T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS macrophages - decreased, FACS NK1.1+ T cells - increased, FACS T cells - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2587 R4846 3 95545384 GRCm38 Q * probably null MGI:107341 Ctss cathepsin S C T nonsense T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, TLR signaling defect: hypersensitivity to PAM3CSK4, TLR signaling defect: TNF production by macrophages 2588 R4783 1 36779173 GRCm38 Y H 0.998 probably damaging MGI:99613 Zap70 zeta-chain (TCR) associated protein kinase T C missense FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV 2589 R4792 12 113416199 GRCm38 K E 0.015 probably benign MGI:96447 Ighd immunoglobulin heavy constant delta T C missense FACS IgD+ B cell percentage - decreased 2592 R2150 10 28668727 GRCm38 I N 1.000 probably damaging MGI:2443552 Themis thymocyte selection associated T A missense FACS B:T cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS T cells - decreased 2598 R4332 6 91723471 GRCm38 G D 1.000 probably damaging MGI:98488 Slc6a6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 G A missense FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, vision/eye 2600 R4855 11 44972908 GRCm38 K * probably null MGI:95275 Ebf1 early B cell factor 1 A T nonsense FACS B cells - decreased, FACS B:T cells - decreased, FACS CD4+ T cells - increased, FACS CD8+ T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS T cells - increased 2602 R4750 14 30610301 GRCm38 M T 0.988 probably null MGI:97598 Prkcd protein kinase C, delta A G start codon destroyed DSS: sensitive day 10, DSS: sensitive day 7, FACS NK cells - decreased 2603 R4364 17 86476851 GRCm38 T I 0.997 probably damaging MGI:97599 Prkce protein kinase C, epsilon C T missense FACS NK cells - decreased 2607 R4961 10 74379417 GRCm38 probably null MGI:1891428 Pcdh15 protocadherin 15 G T splice site FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, OVA-specific IgE after 2nd OVA/Alum - increased 2610 R4766 4 44679494 GRCm38 I F 0.996 probably damaging MGI:97489 Pax5 paired box 5 T A missense FACS B1 cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased 2612 R4920 15 75864357 GRCm38 S P 1.000 probably damaging MGI:1916396 Gsdmd gasdermin D T C missense NALP3 inflammasome signaling defect, Nlrc4 inflammasome: low response, NLRP3 inflammasome: low response 2620 R4703 12 113416041 GRCm38 probably benign MGI:96447 Ighd immunoglobulin heavy constant delta A G critical splice donor site FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, TLR signaling defect: hypersensitivity to LPS, TLR signaling defect: TNF production by macrophages 2621 R2150 11 34229472 GRCm38 probably null MGI:2149010 Dock2 dedicator of cyto-kinesis 2 A G critical splice donor site FACS B cells - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS neutrophils - increased, FACS NK cells - increased, total IgE level - increased 2624 R4904 11 44869169 GRCm38 F S 1.000 probably damaging MGI:95275 Ebf1 early B cell factor 1 T C missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B1a cells - increased, FACS B1a cells in B1 cells - increased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS CD4+ T cells - increased, FACS CD8+ T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS T cells - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: TNF production by macrophages 2625 R4606 6 142454484 GRCm38 F I 0.915 possibly damaging MGI:2385254 Gys2 glycogen synthase 2 A T missense 30 min GTT hyperoglycemic (female) 2627 R4928 18 46560922 GRCm38 K * probably null MGI:3040056 Ticam2 toll-like receptor adaptor molecule 2 T A nonsense TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages 2628 R4833 16 19957139 GRCm38 D V 1.000 probably damaging MGI:2686922 Klhl6 kelch-like 6 T A missense FACS B:T cells - decreased, FACS CD4+ T cells - increased, FACS CD8+ T cells - increased, FACS T cells - increased 2629 R4889 5 140885945 GRCm38 Q R 0.755 possibly damaging MGI:1916978 Card11 caspase recruitment domain family, member 11 T C missense FACS B1 cells - increased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2639 R4781 19 54046495 GRCm38 D G 1.000 probably damaging MGI:87934 Adra2a adrenergic receptor, alpha 2a A G missense 30 min GTT hypoglycemic, 30 min GTT hypoglycemic (female), 30 min GTT hypoglycemic (male), Body Weight (Female) - decreased 2641 R4888 11 5909150 GRCm38 M K 0.633 possibly damaging MGI:1270854 Gck glucokinase A T missense 30 min GTT hyperoglycemic (female) 2642 R4917 12 102264944 GRCm38 probably null MGI:2447362 Slc24a4 solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 T A critical splice donor site Body Weight - decreased 2645 R4911 14 20509440 GRCm38 M K 0.998 probably damaging MGI:107163 Ppp3cb protein phosphatase 3, catalytic subunit, beta isoform A T missense FACS B:T cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS NK cells - increased, FACS T cells - decreased, IgG1 response to a Cysteine Protease (Papain) - decreased, OVA-specific IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, Total IgE After 2nd OVA/Alum Challenge (day 7) - increased 2647 R0137 16 15740332 GRCm38 probably null MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide T C critical splice donor site FACS B cells - decreased, FACS B1b cells - increased, FACS neutrophils - increased, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: TNF production by macrophages 2648 R1116 16 15783079 GRCm38 D G 0.001 probably benign MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide A G missense post-MCMV FACS CD44+ CD4 T cells - increased, post-MCMV FACS CD44+ T cells - increased 2649 R1512 16 15687404 GRCm38 I L probably benign MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide A T missense post-MCMV FACS CD44+ T cells - increased 2650 R1822 16 15759605 GRCm38 D N 1.000 probably damaging MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide G A missense FACS effector memory CD4 T cells in CD4 T cells - increased, T-dependent humoral response defect- decreased antibody response to rSFV 2651 R1929 16 15654817 GRCm38 probably null MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide A G splice site FACS CD44+ CD4 T cells - increased, post-MCMV FACS CD8+ T cells - decreased, post-MCMV FACS pDCs - increased 2652 R2124 16 15719433 GRCm38 V A 0.004 probably benign MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide T C missense 2653 R3499 16 15768025 GRCm38 I F 0.981 probably damaging MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide A T missense 2654 R2174 16 15734922 GRCm38 Q L 0.012 probably benign MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide A T missense Body Weight (Female) - decreased, FACS CD8+ T cells in CD3+ T cells - decreased 2659 R4829 12 111795603 GRCm38 I T 0.997 probably damaging MGI:107978 Klc1 kinesin light chain 1 T C missense Body Weight - decreased, Body Weight (DSS Male) - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased 2664 R5215 7 56295498 GRCm38 R * probably null MGI:97454 Oca2 oculocutaneous albinism II A T nonsense 2666 R5279 13 13648802 GRCm38 L * probably null MGI:107448 Lyst lysosomal trafficking regulator T A nonsense pigmentation, skin/coat/nails 2667 R4934 1 52153923 GRCm38 Y * probably null MGI:103063 Stat1 signal transducer and activator of transcription 1 C A nonsense NK cell response - decreased, NK killing - decreased 2669 R4836 1 82287732 GRCm38 probably null MGI:99454 Irs1 insulin receptor substrate 1 TGGGGTGGACATCGAACTGAAGGAG TG frame shift Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased 2674 R2859 2 30822365 GRCm38 H R 0.995 probably damaging MGI:1913867 Ntmt1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 A G missense Body Weight - decreased, Body Weight (DSS Female) - decreased, Body Weight (DSS Male) - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, FACS IgD MFI - decreased, FACS NK cells - decreased, NALP3 inflammasome signaling defect, Nlrc4 inflammasome: high response, NLRP3 inflammasome: high response, TLR signaling defect: hyposensitivity to CpG + IFNg, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: TNF production by macrophages 2675 R5000 6 122561867 GRCm38 V I 0.999 probably damaging MGI:1342279 Aicda activation-induced cytidine deaminase G A missense OVA-specific IgE - decreased, ratio of OVA-specific IgE over the total IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, Total IgE After 2nd OVA/Alum Challenge (day 7) - decreased, total IgE level - decreased 2683 R4849 14 30599743 GRCm38 L P 1.000 probably damaging MGI:97598 Prkcd protein kinase C, delta A G missense DSS: sensitive day 10, DSS: sensitive day 7, FACS NK cells - decreased 2689 R4920 3 86664458 GRCm38 Y * probably null MGI:1933162 Lrba LPS-responsive beige-like anchor T A nonsense DSS: sensitive day 10, DSS: sensitive day 7, Total IgE After 2nd OVA/Alum Challenge (day 7) - increased 2692 R5107 17 57401977 GRCm38 Y C 0.899 possibly damaging MGI:106912 Adgre1 adhesion G protein-coupled receptor E1 A G missense FACS macrophages - decreased 2698 R4957 19 55931432 GRCm38 probably null MGI:1202879 Tcf7l2 transcription factor 7 like 2, T cell specific, HMG box A G critical splice acceptor site DSS: sensitive day 10, DSS: sensitive day 7 2699 R5091 9 119337823 GRCm38 V F 0.693 possibly damaging MGI:108005 Myd88 myeloid differentiation primary response gene 88 C A missense TLR signaling defect: hyposensitivity to CpG + IFNg, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages 2703 R4984 19 54046639 GRCm38 I T 1.000 probably damaging MGI:87934 Adra2a adrenergic receptor, alpha 2a T C missense 30 min GTT hypoglycemic, 30 min GTT hypoglycemic (female), 30 min GTT hypoglycemic (male) 2709 R5051 11 60487425 GRCm38 probably null MGI:1261811 Myo15 myosin XV G A critical splice donor site behavior/neurological, NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 2710 R5051 6 85627934 GRCm38 Q * probably null MGI:1934606 Alms1 ALMS1, centrosome and basal body associated C T nonsense 30 min GTT hyperglycemic, Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, growth/size, NK cell response - decreased, NK killing - decreased 2712 R5129 8 45402981 GRCm38 I K 1.000 probably damaging MGI:2156367 Tlr3 toll-like receptor 3 A T missense TLR signaling defect: hyposensitivity to poly I:C, TLR signaling defect: hyposensitivity to poly I:C + IFNg, TLR signaling defect: TNF production by macrophages 2714 R5022 8 10987012 GRCm38 * G probably null MGI:109334 Irs2 insulin receptor substrate 2 A C makesense 2717 R5051 11 59566199 GRCm38 R P 0.195 probably benign MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 G C missense NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 2719 R5060 13 117873905 GRCm38 K * probably null MGI:1096392 Hcn1 hyperpolarization-activated, cyclic nucleotide-gated K+ 1 A T nonsense 2728 R4998 13 11643895 GRCm38 R Q 0.999 probably damaging MGI:99685 Ryr2 ryanodine receptor 2, cardiac C T missense 2731 R5118 2 102865370 GRCm38 E D 0.988 probably damaging MGI:88338 Cd44 CD44 antigen C A missense FACS CD44+ CD4 MFI - decreased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - decreased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD44+ T MFI - decreased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS effector memory CD4 T cells in CD4 T cells - decreased 2733 R4970 1 138094299 GRCm38 S P 0.971 probably damaging MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C A G missense DSS: sensitive day 7, FACS B cells - decreased, FACS B1 cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells - increased, FACS B1b cells in B1 cells - decreased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - decreased, FACS IgM+ B cells - decreased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS NK cells - increased, FACS T cells - decreased, NALP3 inflammasome signaling defect, NLRP3 inflammasome: high response, T-dependent humoral response defect- decreased antibody response to rSFV 2737 R5031 1 82286967 GRCm38 L * probably null MGI:99454 Irs1 insulin receptor substrate 1 A T nonsense Body Weight - decreased, Body Weight (DSS Female) - decreased, Body Weight (DSS Male) - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased 2738 R4238 1 14884116 GRCm38 L P 1.000 probably damaging MGI:3522699 Trpa1 transient receptor potential cation channel, subfamily A, member 1 A G missense 2739 R5009 11 71122705 GRCm38 D G 0.075 probably benign MGI:2684861 Nlrp1a NLR family, pyrin domain containing 1A T C missense Body Weight - decreased, Body Weight (Z-score) - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS CD4:CD8 - increased, FACS CD8+ T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - decreased, FACS T cells - decreased, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: TNF production by macrophages, total IgE level - increased 2740 R5110 6 122561185 GRCm38 N D 0.029 probably benign MGI:1342279 Aicda activation-induced cytidine deaminase A G missense LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, NALP3 inflammasome signaling defect, Nlrc4 inflammasome: high response, NLRP3 inflammasome: high response, OVA-specific IgE - decreased, ratio of OVA-specific IgE over the total IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, TLR signaling defect: hypersensitivity to LPS, TLR signaling defect: hypersensitivity to PAM3CSK4, TLR signaling defect: TNF production by macrophages, Total IgE After 2nd OVA/Alum Challenge (day 7) - decreased, total IgE level - decreased 2741 R5073 1 72339029 GRCm38 Y H 0.995 probably damaging MGI:104517 Xrcc5 X-ray repair complementing defective repair in Chinese hamster cells 5 T C missense 30 min GTT hypoglycemic, DSS: resistant day 10, FACS B1a cells - increased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS B220 MFI - increased, FACS CD11c+ DCs - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS T cells - decreased, Total IgE After 2nd OVA/Alum Challenge (day 7) - increased 2742 R5042 11 80557521 GRCm38 D V 1.000 probably damaging MGI:107728 Myo1d myosin ID T A missense DSS: sensitive day 10, DSS: sensitive day 7 2743 R5035 4 141395158 GRCm38 Y * probably null MGI:1329026 Clcnka chloride channel, voltage-sensitive Ka A T nonsense DSS: sensitive day 10, DSS: sensitive day 7, FACS CD44+ CD8 MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased 2744 R4829 2 164099827 GRCm38 probably null MGI:1929004 Stk4 serine/threonine kinase 4 T C critical splice donor site FACS B cells - decreased, FACS B cells - increased, FACS B:T cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS IgM+ B cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS 2746 R5430 7 56295460 GRCm38 V A 0.997 probably damaging MGI:97454 Oca2 oculocutaneous albinism II T C missense DSS: sensitive day 7, pigmentation, skin/coat/nails 2747 R5051 6 125312770 GRCm38 T S 1.000 probably damaging MGI:104875 Ltbr lymphotoxin B receptor T A missense FACS NK1.1+ T cells - increased, growth/size, NK cell response - decreased, NK killing - decreased 2751 R5055 13 95015217 GRCm38 probably null MGI:2445123 Wdr41 WD repeat domain 41 T A critical splice donor site DSS: sensitive day 10, DSS: sensitive day 7, FACS B1a cells - increased, FACS B1b cells - increased, FACS B2 cells - decreased, FACS B220 MFI - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgM MFI - decreased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK1.1+ T cells - increased, Nlrc4 inflammasome: low response, NLRP3 inflammasome: low response, TLR signaling defect: hypersensitivity to CpG + IFNg, TLR signaling defect: hypersensitivity to LPS, TLR signaling defect: hypersensitivity to PAM3CSK4, TLR signaling defect: hypersensitivity to poly I:C, TLR signaling defect: hypersensitivity to R848 2756 R5078 14 50951506 GRCm38 L * probably null MGI:97365 Pnp purine-nucleoside phosphorylase T A nonsense FACS B1a cells in B1 cells - decreased, FACS B1b cells - increased, FACS B1b cells in B1 cells - increased, FACS B2 cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV 2759 R5038 1 52123209 GRCm38 N I 1.000 probably damaging MGI:103063 Stat1 signal transducer and activator of transcription 1 A T missense CD8 response - decreased, CTL killing - decreased, CTL killing dominant epitope - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased 2770 R5130 9 111229838 GRCm38 probably null MGI:101938 Mlh1 mutL homolog 1 A G critical splice donor site FACS B:T cells - increased, FACS CD44+ CD8 MFI - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, T-dependent humoral response defect- decreased antibody response to rSFV, total IgE level - decreased 2772 R5134 4 44710407 GRCm38 M T 0.960 probably null MGI:97489 Pax5 paired box 5 A G start codon destroyed FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B220 MFI - decreased, FACS CD4+ T cells - increased, FACS CD44+ CD4 MFI - decreased, FACS CD8+ T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - decreased, FACS IgM+ B cells - decreased, FACS T cells - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2778 R5156 11 11769448 GRCm38 M K 0.999 probably damaging MGI:1342540 Ikzf1 IKAROS family zinc finger 1 T A missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B1 cells - increased, FACS B1a cells - increased, FACS B1b cells - increased, FACS B1b cells in B1 cells - decreased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - decreased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - decreased, FACS IgM+ B cells - decreased, FACS macrophages - dec 2780 R4886 13 95015174 GRCm38 Q * probably null MGI:2445123 Wdr41 WD repeat domain 41 C T nonsense DSS: sensitive day 10, DSS: sensitive day 7, FACS B1a cells - increased, FACS B220 MFI - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK1.1+ T cells - increased, Nlrc4 inflammasome: low response, NLRP3 inflammasome: low response, TLR signaling defect: hypersensitivity to CpG + IFNg, TLR signaling defect: hypersensitivity to LPS, TLR signaling defect: hypersensitivity to PAM3CSK4, TLR signaling defect: hypersensitivity to poly I:C, TLR signaling defect: hypersensitivity to R848 2788 R5038 13 101689444 GRCm38 R Q 1.000 probably damaging MGI:97583 Pik3r1 phosphoinositide-3-kinase regulatory subunit 1 C T missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, FACS CD4+ T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, IgE response to a Cysteine Protease (Papain) - increased 2789 R5207 15 78565454 GRCm38 N S 0.971 probably damaging MGI:97846 Rac2 Rac family small GTPase 2 T C missense CD8 response - decreased, CTL killing - decreased, CTL killing dominant epitope - decreased, FACS B:T cells - increased, FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, NK cell response - decreased, NK killing - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 2794 R5051 15 78564934 GRCm38 I T 0.682 possibly damaging MGI:97846 Rac2 Rac family small GTPase 2 A G missense FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased 2795 R5007 9 111271410 GRCm38 * R probably null MGI:101938 Mlh1 mutL homolog 1 A G makesense T-dependent humoral response defect- decreased antibody response to rSFV 2799 R5156 8 83955911 GRCm38 F S 0.999 probably damaging MGI:1914179 Asf1b anti-silencing function 1B histone chaperone T C missense FACS CD44+ CD8 MFI - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS T cells - increased, NK cell response - decreased, NK killing - decreased, OVA-specific IgE - increased, total IgE level - increased 2803 R5108 11 60779870 GRCm38 Q * probably null MGI:2444720 Smcr8 Smith-Magenis syndrome chromosome region, candidate 8 homolog (human) C T nonsense DSS: sensitive day 10, DSS: sensitive day 7, FACS B1a cells - increased, FACS B1a cells in B1 cells - increased, FACS B1b cells - increased, FACS B220 MFI - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, TLR signaling defect: hypersensitivity to CpG + IFNg 2805 R5233 7 30877534 GRCm38 I T 1.000 probably damaging MGI:88322 Cd22 CD22 antigen A G missense FACS B cells - decreased, FACS B:T cells - decreased, FACS CD4+ T cells - increased, FACS CD8+ T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - decreased, FACS IgM+ B cells - decreased, FACS T cells - increased 2806 R5226 8 117577874 GRCm38 I F 0.800 possibly damaging MGI:97616 Plcg2 phospholipase C, gamma 2 A T missense Blood Analysis MCHC - decreased, Blood Analysis Platelet Count - decreased, FACS B1 cells - decreased, FACS B1a cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - decreased, FACS B2 cells - increased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - decreased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, IgE response to a Cysteine Protease (Papain) - increased, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, NLRP3 inflammasome: high response, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-independent B cell response defect- decreased TNP-specific IgM to 2837 R5265 9 111271523 GRCm38 M R 0.933 probably null MGI:101938 Mlh1 mutL homolog 1 A C start codon destroyed T-dependent humoral response defect- decreased antibody response to rSFV, total IgE level - decreased 2842 R5286 11 46338099 GRCm38 probably null MGI:96621 Itk IL2 inducible T cell kinase A C splice site FACS B cells - increased, FACS B:T cells - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS IgD+ B cell percentage - increased, FACS IgM+ B cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, total IgE level - increased 2844 R5249 10 28761199 GRCm38 E * probably null MGI:2443552 Themis thymocyte selection associated G T nonsense CD8 response - decreased, CTL killing - decreased, CTL killing dominant epitope - decreased, FACS B:T cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV 2846 R5310 2 165063563 GRCm38 probably null MGI:88336 Cd40 CD40 antigen T C critical splice donor site T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, total IgE level - decreased 2847 R5264 10 128281065 GRCm38 probably null MGI:103039 Stat2 signal transducer and activator of transcription 2 T A splice site FACS CD44+ CD8 T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - decreased 2854 R5066 13 59474550 GRCm38 D V 1.000 probably damaging MGI:2159437 Agtpbp1 ATP/GTP binding protein 1 T A missense Body Weight - decreased, Body Weight (DSS Male) - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased 2855 R5304 1 36778218 GRCm38 H L 0.994 probably damaging MGI:99613 Zap70 zeta-chain (TCR) associated protein kinase A T missense CD8 response - decreased, CTL killing - decreased, CTL killing dominant epitope - decreased, FACS B cells - increased, FACS B:T cells - increased, FACS B1 cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - increased, FACS IgM+ B cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, OVA-specific IgE - decreased, T-de 2856 R5271 1 36781365 GRCm38 V D 1.000 probably damaging MGI:99613 Zap70 zeta-chain (TCR) associated protein kinase T A missense CD8 response - decreased, CTL killing - decreased, CTL killing dominant epitope - decreased, FACS B cells - increased, FACS B:T cells - increased, FACS B1 cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - increased, FACS IgM+ B cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response 2857 R5294 18 37897550 GRCm38 E * probably null MGI:1194490 Diaph1 diaphanous related formin 1 C A nonsense FACS B:T cells - increased, FACS B1a cells in B1 cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, IgA response to 2nd OVA/Alum Challenge (day 7) - increased, MCMV susceptibility 2858 R5050 4 11784654 GRCm38 Y C 1.000 probably damaging MGI:1095414 Cdh17 cadherin 17 A G missense DSS: sensitive day 10, DSS: sensitive day 7, FACS IgD MFI - increased 2863 R5301 3 145930587 GRCm38 D G 0.999 probably damaging MGI:1337994 Bcl10 B cell leukemia/lymphoma 10 A G missense DSS: sensitive day 7, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells - decreased, FACS B1b cells in B1 cells - decreased, FACS B2 cells - increased, FACS CD4+ T cells - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - increased, FACS CD8+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS macrophages - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - decreased, FACS NK cells - decreased, FACS T cells - increased, IgG1 response to a Cysteine Protease (Papain) - decreased, NK cell response - decreased, NK killing - decreased, OVA-specific IgE - increased, T-dependent hum 2864 R5262 3 135612412 GRCm38 probably null MGI:97312 Nfkb1 nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105 A T critical splice donor site DSS: sensitive day 10, FACS central memory CD8 T cells in CD8 T cells - increased, T-dependent humoral response defect- decreased antibody response to rSFV, Total IgE After 2nd OVA/Alum Challenge (day 7) - decreased, total IgE level - decreased 2872 R3156 9 95721132 GRCm38 probably null MGI:109528 Trpc1 transient receptor potential cation channel, subfamily C, member 1 C T critical splice donor site Body Weight - increased, Body Weight (DSS Male) - increased, Body Weight (DSS) - increased, Body Weight (Male) - increased, FACS B cells - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased 2881 R5364 11 97101478 GRCm38 probably null MGI:1888984 Tbx21 T-box 21 C T critical splice donor site FACS CD8+ T cells in CD3+ T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased 2904 R5398 14 118972387 GRCm38 Y * probably null MGI:107373 Dnajc3 DnaJ heat shock protein family (Hsp40) member C3 T A nonsense Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, DSS: sensitive day 10, FACS CD44+ CD8 T cells - increased, FACS T cells - increased 2906 R5503 17 57303079 GRCm38 K * probably null MGI:98923 Vav1 vav 1 oncogene A T nonsense FACS B:T cells - increased, FACS B1 cells - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS IgD MFI - decreased, FACS IgM MFI - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, ratio of OVA-specific IgE over the total IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, total IgE level - decreased 2907 R5450 7 24899262 GRCm38 G C 0.999 probably damaging MGI:101774 Cd79a CD79A antigen (immunoglobulin-associated alpha) G T missense FACS B1 cells - decreased, FACS B1b cells - decreased, FACS IgD MFI - decreased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2908 R5240 17 57297122 GRCm38 E K 1.000 probably damaging MGI:98923 Vav1 vav 1 oncogene G A missense FACS B1 cells - decreased 2911 R5219 14 20528195 GRCm38 C * probably null MGI:107163 Ppp3cb protein phosphatase 3, catalytic subunit, beta isoform G T nonsense FACS B:T cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS NK cells - increased, FACS T cells - decreased, IgG1 response to a Cysteine Protease (Papain) - decreased, OVA-specific IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, Total IgE After 2nd OVA/Alum Challenge (day 7) - increased 2912 R5177 6 48743098 GRCm38 G W 0.999 probably damaging MGI:109368 Gimap1 GTPase, IMAP family member 1 G T missense FACS B220 MFI - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS IgD MFI - decreased, FACS IgM MFI - increased 2915 R5088 2 164083688 GRCm38 K * probably null MGI:1929004 Stk4 serine/threonine kinase 4 A T nonsense FACS B cells - increased, FACS B:T cells - increased, FACS B1 cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, FACS CD11c+ DCs - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgM+ B cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive 2916 R5086 1 87705964 GRCm38 H R 1.000 probably damaging MGI:107357 Inpp5d inositol polyphosphate-5-phosphatase D A G missense 125-03 Response - increased, FACS IgM MFI - decreased, FACS NK cells - decreased, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, TLR signaling defect: hypersensitivity to PAM3CSK4, TLR signaling defect: TNF production by macrophages 2917 R5073 8 3159475 GRCm38 F L 1.000 probably damaging MGI:96575 Insr insulin receptor A G missense DSS: sensitive day 7 2918 R5058 15 82224207 GRCm38 V M 0.997 probably damaging MGI:1919299 Tnfrsf13c tumor necrosis factor receptor superfamily, member 13c C T missense FACS B cells - decreased, FACS B:T cells - decreased 2919 R5019 2 121270319 GRCm38 probably null MGI:1351320 Trp53bp1 transformation related protein 53 binding protein 1 A T splice site FACS IgD MFI - decreased 2920 R5028 2 117302004 GRCm38 K * probably null MGI:1314635 Rasgrp1 RAS guanyl releasing protein 1 T A nonsense FACS B:T cells - increased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - increased, IgA response to 2nd OVA/Alum Challenge (day 7) - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, total IgE level - increased 2921 R4934 18 4339548 GRCm38 S R 0.947 possibly damaging MGI:1346878 Map3k8 mitogen-activated protein kinase kinase kinase 8 A T missense TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: TNF production by macrophages 2922 R4927 18 46560779 GRCm38 I M 1.000 probably damaging MGI:3040056 Ticam2 toll-like receptor adaptor molecule 2 T C missense 2923 R4877 5 140885877 GRCm38 S G 1.000 probably damaging MGI:1916978 Card11 caspase recruitment domain family, member 11 T C missense FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2924 R3883 17 34193258 GRCm38 V E 1.000 probably damaging MGI:98483 Tap1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) T A missense FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased 2925 R4744 2 121211313 GRCm38 V D 1.000 probably damaging MGI:1351320 Trp53bp1 transformation related protein 53 binding protein 1 A T missense FACS B2 cells - increased, FACS IgD MFI - decreased 2926 R5596 4 150929874 GRCm38 V A 0.015 probably benign MGI:1101059 Tnfrsf9 tumor necrosis factor receptor superfamily, member 9 T C missense FACS B cells - increased, FACS B:T cells - increased, FACS CD8+ T cells - decreased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - increased, FACS IgM+ B cells - increased 2933 R4836 7 128267505 GRCm38 probably null MGI:2181411 Slc5a2 solute carrier family 5 (sodium/glucose cotransporter), member 2 A G splice site Body Weight - increased, DSS: sensitive day 10, TLR signaling defect: hypersensitivity to CpG + IFNg, TLR signaling defect: TNF production by macrophages 2936 R5364 9 22575196 GRCm38 probably null MGI:2442833 Bbs9 Bardet-Biedl syndrome 9 (human) G T critical splice donor site Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, FACS naive CD4 T cells in CD4 T cells - decreased 2940 R5434 3 135626611 GRCm38 K * probably null MGI:97312 Nfkb1 nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105 T A nonsense FACS B1 cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, total IgE after 2nd OVA/Alum - decreased, Total IgE After 2nd OVA/Alum Challenge (day 7) - decreased, total IgE level - decreased 2941 R5278 1 158782403 GRCm38 probably null MGI:3051647 Pappa2 pappalysin 2 A T splice site Body Weight - decreased, Body Weight (Z-score) - decreased 2942 R5383 7 141753719 GRCm38 C R 1.000 probably damaging MGI:1339364 Muc2 mucin 2 T C missense DSS: sensitive day 10, DSS: sensitive day 7 2948 R5605 2 164079566 GRCm38 F S 1.000 probably damaging MGI:1929004 Stk4 serine/threonine kinase 4 T C missense FACS B cells - increased, FACS B:T cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgM+ B cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS NK cells - increased, FACS T cells - decreas 2950 R5441 9 53516467 GRCm38 G * probably null MGI:107202 Atm ataxia telangiectasia mutated C A nonsense FACS B:T cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV 2952 R5434 6 125312794 GRCm38 R W 0.973 probably damaging MGI:104875 Ltbr lymphotoxin B receptor G A missense T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 2959 R5503 18 20580651 GRCm38 Y * probably null MGI:1196466 Dsg2 desmoglein 2 T A nonsense DSS: sensitive day 10, DSS: sensitive day 7, FACS CD4+ T cells - decreased, FACS T cells - decreased 2960 R5671 13 94528257 GRCm38 R S unknown MGI:1333879 Ap3b1 adaptor-related protein complex 3, beta 1 subunit A T missense 2962 R5623 18 37896093 GRCm38 probably benign MGI:1194490 Diaph1 diaphanous related formin 1 A T critical splice donor site FACS B:T cells - increased, FACS B1 cells - decreased, FACS B1a cells in B1 cells - decreased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased, MCMV susceptibility 2967 R5801 15 94347670 GRCm38 E * probably null MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 C A nonsense pigmentation, skin/coat/nails 2974 R4740 11 71113640 GRCm38 probably null MGI:2684861 Nlrp1a NLR family, pyrin domain containing 1A T C critical splice acceptor site FACS B cells - decreased, FACS B:T cells - decreased, FACS IgM+ B cells - decreased, FACS neutrophils - increased, FACS NK cells - decreased, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, Nlrc4 inflammasome: high response 2978 R6138 10 100076906 GRCm38 probably null MGI:96974 Kitl kit ligand G A critical splice donor site pigmentation, skin/coat/nails 2983 R5896 15 11000855 GRCm38 Y * probably null MGI:2153040 Slc45a2 solute carrier family 45, member 2 T A nonsense pigmentation, skin/coat/nails 2988 R5441 15 66696520 GRCm38 I K 0.465 possibly damaging MGI:98733 Tg thyroglobulin T A missense Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, DSS: sensitive day 10, DSS: sensitive day 7, FACS B cells - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, total IgE level - increased 2990 R6000 14 70567833 GRCm38 D G 0.973 probably damaging MGI:96223 Hr hairless A G missense Body Weight (DSS Male) - decreased, DSS: sensitive day 10, DSS: sensitive day 7, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1a cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells - increased, FACS B1b cells in B1 cells - increased, FACS B2 cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS macrophages - increased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS T cells - decreased, skin/coat/nails 2992 R5643 9 96140656 GRCm38 Q * probably null MGI:2443336 Gk5 glycerol kinase 5 (putative) C T nonsense FACS CD4:CD8 - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, skin/coat/nails 2993 R5858 18 77948299 GRCm38 C * probably null MGI:1918673 Epg5 ectopic P-granules autophagy protein 5 homolog (C. elegans) T A nonsense FACS CD44+ CD4 MFI - decreased 2994 R5713 15 78491848 GRCm38 M T 0.663 probably null MGI:96550 Il2rb interleukin 2 receptor, beta chain A G start codon destroyed Body Weight (DSS Female) - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS B220 MFI - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgM+ B cells - decreased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, NK cell response - decreased, NK killing - decreased, OVA-specific IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, total IgE level - increased 2995 R5700 16 19957218 GRCm38 Q * probably null MGI:2686922 Klhl6 kelch-like 6 G A nonsense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - increased, FACS B220 MFI - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - decreased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - decreased, FACS IgM+ B cells - decreased, FACS T cells - increased, total IgE level - increased 3005 R5713 7 43408802 GRCm38 I F 0.987 probably damaging MGI:2443630 Siglecg sialic acid binding Ig-like lectin G A T missense FACS B1 cells - increased, FACS IgM MFI - decreased 3006 R5802 14 103821714 GRCm38 F S 0.974 probably damaging MGI:102720 Ednrb endothelin receptor type B A G missense 3018 R5847 10 58603179 GRCm38 S C 1.000 probably damaging MGI:1343498 Edar ectodysplasin-A receptor T A missense pigmentation, skin/coat/nails 3026 R5895 16 15752829 GRCm38 Y * probably null MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide C A nonsense Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, FACS B cells - decreased, FACS B:T cells - increased, FACS B1 cells - decreased, FACS B220 MFI - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - decreased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - increased, FACS NK1.1+ T cells - decreased, FACS T cells - decreased 3030 R5947 13 20290383 GRCm38 E * probably null MGI:2153044 Elmo1 engulfment and cell motility 1 G T nonsense FACS B cells - decreased, FACS B1 cells - increased, FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 3035 R5866 1 52139264 GRCm38 K E 1.000 probably damaging MGI:103063 Stat1 signal transducer and activator of transcription 1 A G missense CTL killing - increased, CTL killing dominant epitope - increased, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - decreased, FACS NK1.1+ T cells - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-independent B cell response defect- decreased TNP-specific IgM to 3039 R5921 11 78173059 GRCm38 M T 1.000 probably damaging MGI:1890646 Nek8 NIMA (never in mitosis gene a)-related expressed kinase 8 A G missense Body Weight (DSS Male) - decreased, DSS: sensitive day 10, DSS: sensitive day 7, FACS B220 MFI - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS effector memory CD4 T cells in CD4 T cells - decreased, FACS effector memory CD8 T cells in CD8 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - increased 3042 R5849 11 44990504 GRCm38 probably null MGI:95275 Ebf1 early B cell factor 1 T A splice site FACS B1 cells - decreased, FACS CD4+ T cells - increased, FACS T cells - increased 3043 R5587 7 19809634 GRCm38 Y * probably null MGI:88140 Bcl3 B cell leukemia/lymphoma 3 A T nonsense FACS B1 cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS IgD MFI - decreased, FACS IgM MFI - increased 3047 R6062 9 53488587 GRCm38 L P 1.000 probably damaging MGI:107202 Atm ataxia telangiectasia mutated A G missense FACS B:T cells - increased, FACS CD4+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased 3061 R6056 6 124732435 GRCm38 Y C 1.000 probably damaging MGI:96055 Ptpn6 protein tyrosine phosphatase, non-receptor type 6 T C missense FACS B cells - decreased, FACS B1 cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased 3072 R6138 9 96176237 GRCm38 Q * probably null MGI:2443336 Gk5 glycerol kinase 5 (putative) C T nonsense FACS CD4:CD8 - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, skin/coat/nails 3076 R6047 1 138101041 GRCm38 probably null MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C C T critical splice donor site FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - increased, FACS B220 MFI - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased 3077 R5859 6 125312808 GRCm38 H R 0.983 probably damaging MGI:104875 Ltbr lymphotoxin B receptor T C missense CTL killing - increased, CTL killing dominant epitope - increased, FACS B cells - increased, FACS B:T cells - increased, FACS B1 cells - increased, FACS B220 MFI - decreased, FACS CD44+ CD4 MFI - decreased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD44+ T MFI - decreased, FACS CD8+ T cells - decreased, FACS NK cells - decreased, NK cell response - decreased, NK killing - decreased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 3088 R6153 7 43412017 GRCm38 N K 0.819 possibly damaging MGI:2443630 Siglecg sialic acid binding Ig-like lectin G C A missense FACS B1 cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - decreased 3095 R5319 6 124732950 GRCm38 V M 0.103 probably benign MGI:96055 Ptpn6 protein tyrosine phosphatase, non-receptor type 6 C T missense FACS B cells - decreased, FACS B1 cells - increased, FACS CD44+ CD8 MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - decreased, FACS IgM+ B cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased 3097 R6092 4 101792023 GRCm38 P T 1.000 probably damaging MGI:104993 Lepr leptin receptor C A missense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, growth/size 3099 R5017 7 43411386 GRCm38 probably benign MGI:2443630 Siglecg sialic acid binding Ig-like lectin G T A intron FACS B1 cells - increased, FACS B1a cells - increased, FACS B1a cells in B1 cells - increased, FACS B2 cells - decreased, FACS IgM MFI - decreased 3103 R5912 11 11748464 GRCm38 S * probably null MGI:1342540 Ikzf1 IKAROS family zinc finger 1 C A nonsense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B1a cells - increased, FACS B1b cells - increased, FACS B1b cells in B1 cells - decreased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - decreased, FACS IgM+ B cells - decr 3106 R6130 1 60912491 GRCm38 Y H 1.000 probably damaging MGI:88556 Ctla4 cytotoxic T-lymphocyte-associated protein 4 T C missense FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased 3113 R5996 7 125567221 GRCm38 W R 1.000 probably damaging MGI:105367 Il4ra interleukin 4 receptor, alpha T C missense OVA-specific IgE - decreased, total IgE level - decreased 3114 R5828 11 53775936 GRCm38 W R 0.267 probably benign MGI:96590 Irf1 interferon regulatory factor 1 T A missense FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - decreased 3117 R5717 12 104705128 GRCm38 Y F 1.000 probably damaging MGI:2177178 Dicer1 dicer 1, ribonuclease type III T A missense FACS B:T cells - increased, FACS B1 cells - increased, FACS CD4+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased 3131 R6092 15 82223154 GRCm38 T A 0.979 probably damaging MGI:1919299 Tnfrsf13c tumor necrosis factor receptor superfamily, member 13c T C missense FACS B cells - decreased, FACS B:T cells - decreased 3171 R6195 8 84588753 GRCm38 Y C 0.989 probably damaging MGI:109482 Cacna1a calcium channel, voltage-dependent, P/Q type, alpha 1A subunit A G missense 3173 R5908 13 13696761 GRCm38 Y * probably null MGI:107448 Lyst lysosomal trafficking regulator T A nonsense pigmentation, skin/coat/nails 3176 R5341 4 44697630 GRCm38 D G 1.000 probably damaging MGI:97489 Pax5 paired box 5 T C missense FACS B220 MFI - decreased, FACS IgD MFI - decreased 3178 R6009 11 54502271 GRCm38 G V 1.000 probably damaging MGI:2444668 Fnip1 folliculin interacting protein 1 G T missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - increased, FACS B220 MFI - decreased, FACS CD4+ T cells - increased, FACS CD8+ T cells - increased, FACS T cells - increased 3185 R5458 4 44679526 GRCm38 D G 0.995 probably damaging MGI:97489 Pax5 paired box 5 T C missense FACS IgD MFI - decreased 3221 R6196 12 98259162 GRCm38 D E 0.995 probably damaging MGI:95636 Galc galactosylceramidase A T missense behavior/neurological, growth/size 3232 R5983 4 32563324 GRCm38 E V 1.000 probably damaging MGI:894679 Bach2 BTB and CNC homology, basic leucine zipper transcription factor 2 A T missense FACS B1 cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased 3241 R6148 2 3437705 GRCm38 D G 1.000 probably damaging MGI:2441769 Dclre1c DNA cross-link repair 1C A G missense Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK1.1+ T cells - decreased, FACS T cells - decreased, growth/size, skin 3244 R6026 1 138071249 GRCm38 M K 0.984 probably damaging MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C A T missense FACS CD44+ CD4 MFI - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased 3267 R5878 11 72253391 GRCm38 T I 0.655 possibly damaging MGI:3037150 Slc13a5 solute carrier family 13 (sodium-dependent citrate transporter), member 5 G A missense Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Z-score) - decreased 3274 R6113 2 3452863 GRCm38 L P 1.000 probably damaging MGI:2441769 Dclre1c DNA cross-link repair 1C T C missense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Z-score) - increased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ T MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased 3275 R6210 8 9971585 GRCm38 T A probably benign MGI:1335098 Lig4 ligase IV, DNA, ATP-dependent T C missense FACS B cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - decreased, FACS IgM+ B cells - decreased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - increased, FACS T cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ 3287 R6215 11 106312441 GRCm38 probably null MGI:96431 Cd79b CD79B antigen C A critical splice acceptor site FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B220 MFI - decreased, FACS CD4+ T cells - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD8+ T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - decreased, FACS NK cells - decreased, FACS T cells - increased 3305 R6260 6 85628735 GRCm38 K * probably null MGI:1934606 Alms1 ALMS1, centrosome and basal body associated A T nonsense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, FACS CD8+ T cells in CD3+ T cells - increased 3307 R6294 13 11879496 GRCm38 S R 0.998 probably damaging MGI:99685 Ryr2 ryanodine receptor 2, cardiac G T missense 3317 R6161 18 66859180 GRCm38 Y * probably null MGI:99457 Mc4r melanocortin 4 receptor A T nonsense Body Weight - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased 3318 R6240 9 71944016 GRCm38 K * probably null MGI:101877 Tcf12 transcription factor 12 T A nonsense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B220 MFI - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - increased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 3322 R6220 2 117284929 GRCm38 W * probably null MGI:1314635 Rasgrp1 RAS guanyl releasing protein 1 C T nonsense FACS B:T cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - increased, FACS T cells - decreased 3323 R6170 11 44883885 GRCm38 N K 1.000 probably damaging MGI:95275 Ebf1 early B cell factor 1 T A missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B220 MFI - increased, FACS CD4+ T cells - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD8+ T cells - increased, FACS NK cells - decreased, FACS T cells - increased 3324 R6234 3 135626710 GRCm38 V I 0.720 possibly damaging MGI:97312 Nfkb1 nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105 C T missense FACS B1 cells - decreased 3335 R6294 2 117291792 GRCm38 Y * probably null MGI:1314635 Rasgrp1 RAS guanyl releasing protein 1 A T nonsense FACS B cells - increased, FACS B:T cells - increased, FACS B1b cells - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS NK cells - increased, FACS T cells - decreased 3341 R6335 12 98242714 GRCm38 D G 1.000 probably damaging MGI:95636 Galc galactosylceramidase T C missense behavior/neurological 3343 R6173 1 138067890 GRCm38 C G 1.000 probably damaging MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C A C missense FACS B1 cells - increased, FACS B1a cells in B1 cells - decreased, FACS B220 MFI - decreased, FACS naive CD8 T cells in CD8 T cells - decreased 3376 R6328 1 138113678 GRCm38 E * probably null MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C C A nonsense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - increased, FACS B220 MFI - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased 3380 R6274 11 11768961 GRCm38 Q * probably null MGI:1342540 Ikzf1 IKAROS family zinc finger 1 C T nonsense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B1 cells - increased, FACS B1a cells - increased, FACS B1b cells - increased, FACS B1b cells in B1 cells - decreased, FACS B2 cells - decreased, FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - decreased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - decreased, FACS IgM+ B cells - decreased, FACS macrophages - decreased, FACS naive CD4 T cell 3388 R6371 1 87699675 GRCm38 L Q 0.999 probably damaging MGI:107357 Inpp5d inositol polyphosphate-5-phosphatase D T A missense Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - increased, FACS B220 MFI - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - decreased, FACS NK1.1+ T cells - decreased, FACS T cells - decreased 3397 R6019 2 117291895 GRCm38 D G 0.989 probably damaging MGI:1314635 Rasgrp1 RAS guanyl releasing protein 1 T C missense FACS CD44+ CD4 MFI - increased, FACS CD44+ T MFI - increased 3413 R6299 9 71858929 GRCm38 V D 0.997 probably damaging MGI:101877 Tcf12 transcription factor 12 A T missense FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B220 MFI - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - increased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 3436 R6354 15 94347810 GRCm38 C F 1.000 probably damaging MGI:2660628 Adamts20 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 C A missense pigmentation, skin/coat/nails 3438 R6441 10 60308036 GRCm38 V E 0.995 probably damaging MGI:1890219 Cdh23 cadherin 23 (otocadherin) A T missense behavior/neurological, Body Weight - decreased, Body Weight (Z-score) - decreased, FACS CD44+ T cells - increased 3446 R5571 13 11555448 GRCm38 T S 0.907 possibly damaging MGI:99685 Ryr2 ryanodine receptor 2, cardiac T A missense 3453 R6383 1 138078451 GRCm38 Y N 0.917 possibly damaging MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C A T missense FACS B1 cells - increased, FACS CD44+ CD8 MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased 3502 R6440 15 103471232 GRCm38 Y * probably null MGI:1926063 Nckap1l NCK associated protein 1 like C A nonsense Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - decreased, FACS T cells - decreased 3504 R5947 6 85619712 GRCm38 S P 0.004 probably benign MGI:1934606 Alms1 ALMS1, centrosome and basal body associated T C missense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased 3512 R6465 11 34503413 GRCm38 V E 0.999 probably damaging MGI:2149010 Dock2 dedicator of cyto-kinesis 2 A T missense FACS B cells - decreased, FACS B1 cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - increased, FACS T cells - decreased 3513 R6404 9 45001128 GRCm38 E V 1.000 probably damaging MGI:88332 Cd3e CD3 antigen, epsilon polypeptide T A missense FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased 3514 R6343 8 120753707 GRCm38 V A 0.968 probably damaging MGI:96395 Irf8 interferon regulatory factor 8 T C missense FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased 3522 R5704 3 54372106 GRCm38 C F 1.000 probably damaging MGI:1926321 Postn periostin, osteoblast specific factor G T missense 3525 R6457 10 79733773 GRCm38 E * probably null MGI:1298210 Hcn2 hyperpolarization-activated, cyclic nucleotide-gated K+ 2 G T nonsense Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, FACS B cells - decreased, FACS B:T cells - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS T cells - increased 3545 R1871 16 19957043 GRCm38 V D 0.555 possibly damaging MGI:2686922 Klhl6 kelch-like 6 A T missense FACS B1a cells - increased, FACS CD4+ T cells - increased, FACS CD8+ T cells - increased, FACS T cells - increased 3556 R6514 11 53771322 GRCm38 L V 1.000 probably damaging MGI:96590 Irf1 interferon regulatory factor 1 C G missense FACS B1 cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS NK cells - decreased 3577 R6462 4 65124891 GRCm38 T K 0.978 probably damaging MGI:97479 Pappa pregnancy-associated plasma protein A C A missense Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, Bone: Spine Deformity (male) 3586 R6499 9 95726437 GRCm38 E G 1.000 probably damaging MGI:109528 Trpc1 transient receptor potential cation channel, subfamily C, member 1 T C missense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased 3593 R6512 13 20373161 GRCm38 L P 1.000 probably damaging MGI:2153044 Elmo1 engulfment and cell motility 1 T C missense FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS NK cells - decreased 3602 R6516 15 81237868 GRCm38 Y C 0.999 probably damaging MGI:2180756 Mchr1 melanin-concentrating hormone receptor 1 A G missense Body Weight (Z-score) - decreased 3616 R6489 9 72015636 GRCm38 probably null MGI:101877 Tcf12 transcription factor 12 A G critical splice donor site FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B220 MFI - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - increased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 3628 R6515 19 41376146 GRCm38 Y H 0.003 probably benign MGI:1933177 Pik3ap1 phosphoinositide-3-kinase adaptor protein 1 A G missense FACS B1 cells - decreased 3629 R6486 16 15752764 GRCm38 S P 0.966 probably damaging MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide T C missense FACS B1 cells - decreased 3640 R6374 1 158956645 GRCm38 Y F 0.998 probably damaging MGI:3051647 Pappa2 pappalysin 2 T A missense Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased 3643 R6491 12 108513071 GRCm38 probably null MGI:1915769 Eml1 echinoderm microtubule associated protein like 1 G A critical splice donor site craniofacial, nervous system 3670 R0791 6 113773388 GRCm38 R H 1.000 probably damaging MGI:105368 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 C T missense Body Weight - decreased 3671 R1630 9 53479673 GRCm38 L Q 0.994 probably damaging MGI:107202 Atm ataxia telangiectasia mutated A T missense FACS B:T cells - increased, FACS B1 cells - increased, phagocytosis in PECs - decreased 3672 R5400 9 53503018 GRCm38 D G 0.997 probably damaging MGI:107202 Atm ataxia telangiectasia mutated T C missense FACS CD44+ CD8 MFI - increased 3680 R6562 7 43409057 GRCm38 R G 0.636 possibly damaging MGI:2443630 Siglecg sialic acid binding Ig-like lectin G A G missense FACS B1 cells - increased 3681 R6562 11 23757026 GRCm38 G * probably null MGI:97897 Rel reticuloendotheliosis oncogene C A nonsense FACS B1 cells - decreased, FACS CD4+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - decreased, FACS T cells - increased, IgE response to a Cysteine Protease (Papain) - decreased, IgG1 response to a Cysteine Protease (Papain) - decreased, ratio of OVA-specific IgE over the total IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, total IgE level - decreased 3694 R6484 12 76385891 GRCm38 T I 0.965 probably damaging MGI:2442326 Zbtb1 zinc finger and BTB domain containing 1 C T missense FACS CD44+ CD8 MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS NK1.1+ T cells - increased 3703 R6232 7 19812484 GRCm38 N I 1.000 probably damaging MGI:88140 Bcl3 B cell leukemia/lymphoma 3 T A missense FACS central memory CD8 T cells in CD8 T cells - increased 3708 R5257 5 140876425 GRCm38 P L 0.934 possibly damaging MGI:1916978 Card11 caspase recruitment domain family, member 11 G A missense FACS CD4+ T cells - increased, FACS T cells - increased 3723 R4235 1 58833698 GRCm38 H Q 0.894 possibly damaging MGI:1261423 Casp8 caspase 8 T A missense FACS B1 cells - decreased, FACS CD44+ CD4 MFI - decreased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased 3731 R2885 11 34689766 GRCm38 I N 1.000 probably damaging MGI:2149010 Dock2 dedicator of cyto-kinesis 2 A T missense FACS B1b cells in B1 cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased 3732 R3846 11 34732371 GRCm38 H P 0.813 possibly damaging MGI:2149010 Dock2 dedicator of cyto-kinesis 2 T G missense FACS NK cells - increased 3733 R4135 11 34714501 GRCm38 K E 0.827 possibly damaging MGI:2149010 Dock2 dedicator of cyto-kinesis 2 T C missense FACS CD4:CD8 - decreased, FACS CD8+ T cells in CD3+ T cells - increased 3734 R1633 19 25051563 GRCm38 T A 0.002 probably benign MGI:1921396 Dock8 dedicator of cytokinesis 8 A G missense FACS CD8+ T cells - decreased 3735 R3157 19 25149831 GRCm38 Y H probably benign MGI:1921396 Dock8 dedicator of cytokinesis 8 T C missense T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 3736 R0380 18 20582939 GRCm38 Y * probably null MGI:1196466 Dsg2 desmoglein 2 T A nonsense DSS: sensitive day 7 3737 R4299 18 20595951 GRCm38 probably null MGI:1196466 Dsg2 desmoglein 2 T A splice site DSS: sensitive day 10 3739 R1055 11 44632775 GRCm38 K E 0.982 probably damaging MGI:95275 Ebf1 early B cell factor 1 A G missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased 3746 R0840 11 54493181 GRCm38 probably benign MGI:2444668 Fnip1 folliculin interacting protein 1 T A splice site FACS B220 MFI - decreased 3750 R4328 10 79724611 GRCm38 Y H 1.000 probably damaging MGI:1298210 Hcn2 hyperpolarization-activated, cyclic nucleotide-gated K+ 2 T C missense Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Z-score) - decreased, FACS macrophages - increased 3753 R0581 15 78481936 GRCm38 Y F 0.721 possibly damaging MGI:96550 Il2rb interleukin 2 receptor, beta chain T A missense DSS: sensitive day 10, TLR signaling defect: hyposensitivity to LPS, TLR signaling defect: hyposensitivity to PAM3CSK4, TLR signaling defect: hyposensitivity to R848, TLR signaling defect: TNF production by macrophages, total IgE level - increased 3754 R1102 7 125574717 GRCm38 probably null MGI:105367 Il4ra interleukin 4 receptor, alpha G A critical splice donor site total IgE level - decreased 3756 R4676 1 87715142 GRCm38 P Q 0.998 probably damaging MGI:107357 Inpp5d inositol polyphosphate-5-phosphatase D C A missense TLR signaling defect: hypersensitivity to PAM3CSK4, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: TNF production by macrophages 3757 R0443 7 128081634 GRCm38 A V 1.000 probably damaging MGI:96607 Itgam integrin alpha M C T missense FACS CD11b+ DCs (gated in CD11c+ cells) - decreased 3758 R3822 7 128112286 GRCm38 probably null MGI:96607 Itgam integrin alpha M A G splice site FACS CD11b+ DCs (gated in CD11c+ cells) - decreased 3759 R0217 10 77548536 GRCm38 probably benign MGI:96611 Itgb2 integrin beta 2 G T splice site 3760 R3769 10 77549968 GRCm38 V A 0.803 possibly damaging MGI:96611 Itgb2 integrin beta 2 T C missense FACS CD44+ CD4 MFI - increased, FACS CD44+ T MFI - increased, FACS effector memory CD4 T cells in CD4 T cells - increased 3764 R0833 8 71683978 GRCm38 N T 1.000 probably damaging MGI:99928 Jak3 Janus kinase 3 A C missense FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 3765 R4897 8 71685404 GRCm38 E G 0.997 probably damaging MGI:99928 Jak3 Janus kinase 3 A G missense FACS NK1.1+ T cells - decreased 3766 R5038 8 71686058 GRCm38 A T 0.985 probably damaging MGI:99928 Jak3 Janus kinase 3 G A missense FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased 3770 R0541 16 19949447 GRCm38 probably null MGI:2686922 Klhl6 kelch-like 6 T A splice site FACS B220 MFI - decreased, FACS IgD MFI - increased 3771 R1510 16 19947098 GRCm38 T A 0.998 probably damaging MGI:2686922 Klhl6 kelch-like 6 T C missense FACS B1 cells - increased, FACS CD44+ CD8 T cells - increased 3772 R4824 16 19957028 GRCm38 R H 0.978 probably damaging MGI:2686922 Klhl6 kelch-like 6 C T missense FACS CD4+ T cells - increased, FACS IgD MFI - increased, FACS IgD+ B cell percentage - decreased, FACS T cells - increased 3773 R5475 16 19948127 GRCm38 C S 1.000 probably damaging MGI:2686922 Klhl6 kelch-like 6 A T missense FACS B1 cells - increased 3777 R2421 4 3748787 GRCm38 A V 0.930 possibly damaging MGI:96892 Lyn LYN proto-oncogene, Src family tyrosine kinase C T missense FACS B cells - decreased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 3778 R1170 1 133012692 GRCm38 L P 1.000 probably damaging MGI:107934 Mdm4 transformed mouse 3T3 cell double minute 4 A G missense FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased 3780 R1733 8 111322748 GRCm38 S P 0.999 probably damaging MGI:1921818 Mlkl mixed lineage kinase domain-like A G missense LPS-induced Necroptosis - decreased, Macrophage necroptosis: low 3793 R1985 3 135615349 GRCm38 T I 0.806 possibly damaging MGI:97312 Nfkb1 nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105 G A missense total IgE level - decreased 3794 R2409 3 135613943 GRCm38 E K 0.934 possibly damaging MGI:97312 Nfkb1 nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105 C T missense NALP3 inflammasome signaling defect, Nlrc4 inflammasome: low response, NLRP3 inflammasome: low response, total IgE level - decreased 3795 R0008 11 59558448 GRCm38 H L 0.002 probably benign MGI:2653833 Nlrp3 NLR family, pyrin domain containing 3 A T missense NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 3796 R4947 5 24377855 GRCm38 C Y 0.994 probably damaging MGI:97362 Nos3 nitric oxide synthase 3, endothelial cell G A missense DSS: sensitive day 7 3803 R4043 4 65314587 GRCm38 N S 0.055 probably benign MGI:97479 Pappa pregnancy-associated plasma protein A A G missense Body Weight (Male) - decreased 3804 R4657 4 65314796 GRCm38 probably null MGI:97479 Pappa pregnancy-associated plasma protein A G A splice site Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Z-score) - decreased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization, TLR signaling defect: hypersensitivity to LPS, TLR signaling defect: hypersensitivity to PAM3CSK4, TLR signaling defect: hypersensitivity to R848, TLR signaling defect: TNF production by macrophages 3805 R4952 1 158857136 GRCm38 T I 1.000 probably null MGI:3051647 Pappa2 pappalysin 2 G A missense Body Weight - decreased 3807 R4175 13 101701732 GRCm38 L H 1.000 probably damaging MGI:97583 Pik3r1 phosphoinositide-3-kinase regulatory subunit 1 A T missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B1b cells in B1 cells - increased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, FACS CD4+ T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, IgE response to a Cysteine Protease (Papain) - increased, resistance to B10-F16 melanoma - decreased 3809 R0050 14 20531752 GRCm38 V A 0.853 possibly damaging MGI:107163 Ppp3cb protein phosphatase 3, catalytic subunit, beta isoform A G missense FACS B:T cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS NK cells - increased, FACS T cells - decreased, IgG1 response to a Cysteine Protease (Papain) - decreased, OVA-specific IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, Total IgE After 2nd OVA/Alum Challenge (day 7) - increased 3810 R1713 16 15795094 GRCm38 V A probably benign MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide T C missense post-MCMV FACS pDCs - increased 3811 R1848 16 15808058 GRCm38 L S 0.006 probably benign MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide T C missense FACS effector memory CD4 T cells in CD4 T cells - increased 3812 R6000 16 15829697 GRCm38 I F 0.861 possibly damaging MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide A T missense FACS CD44+ CD4 MFI - increased 3813 R6406 16 15717801 GRCm38 L Q 1.000 probably damaging MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide T A missense FACS CD44+ CD8 MFI - increased 3819 R2047 6 124721789 GRCm38 T A 0.423 probably benign MGI:96055 Ptpn6 protein tyrosine phosphatase, non-receptor type 6 T C missense FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ T MFI - increased 3820 R5807 6 124724984 GRCm38 H R probably benign MGI:96055 Ptpn6 protein tyrosine phosphatase, non-receptor type 6 T C missense FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased 3821 R3834 1 138083567 GRCm38 N I 1.000 probably damaging MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C T A missense Body Weight (Male) - increased, FACS B1b cells in B1 cells - decreased, total IgE level - decreased 3825 R4163 2 117282654 GRCm38 D G 0.023 probably benign MGI:1314635 Rasgrp1 RAS guanyl releasing protein 1 T C missense FACS NK cells - increased 3834 R2358 7 43409422 GRCm38 S G 0.908 possibly damaging MGI:2443630 Siglecg sialic acid binding Ig-like lectin G A G missense FACS B1a cells in B1 cells - increased 3843 R4288 2 164099712 GRCm38 S G probably benign MGI:1929004 Stk4 serine/threonine kinase 4 A G missense FACS B cells - increased, FACS B:T cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgM+ B cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increas 3847 R4360 2 164088959 GRCm38 E G 0.939 possibly damaging MGI:1929004 Stk4 serine/threonine kinase 4 A G missense FACS B cells - increased, FACS B:T cells - increased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased, FACS B220 MFI - decreased, FACS CD11b+ DCs (gated in CD11c+ cells) - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgM+ B cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS NK cells 3850 R0841 17 34215940 GRCm38 D E 0.638 possibly damaging MGI:98484 Tap2 transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) C A missense FACS CD4+ T cells - increased, NALP3 inflammasome signaling defect, NLRP3 inflammasome: low response 3852 R4885 9 71858840 GRCm38 G S 0.539 probably null MGI:101877 Tcf12 transcription factor 12 C T missense FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B220 MFI - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - increased, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 3853 R0135 15 66694870 GRCm38 S G 0.010 probably benign MGI:98733 Tg thyroglobulin A G missense FACS CD44+ T cells - increased 3854 R4797 15 66758006 GRCm38 probably null MGI:98733 Tg thyroglobulin G A critical splice donor site Body Weight - decreased, Body Weight (Z-score) - decreased, FACS B1a cells - increased, FACS B2 cells - decreased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS IgM+ B cells - decreased, FACS macrophages - increased, total IgE level - increased 3861 R4755 2 121228606 GRCm38 R * probably null MGI:1351320 Trp53bp1 transformation related protein 53 binding protein 1 T A nonsense FACS IgD MFI - decreased 3863 R4998 15 66674050 GRCm38 D G 1.000 probably damaging MGI:98733 Tg thyroglobulin A G missense FACS central memory CD4 T cells in CD4 T cells - increased 3866 R0507 10 28781832 GRCm38 V E 0.903 possibly damaging MGI:2443552 Themis thymocyte selection associated T A missense FACS CD4+ T cells - decreased 3868 R3723 8 10031545 GRCm38 I V 0.480 possibly damaging MGI:1344376 Tnfsf13b tumor necrosis factor (ligand) superfamily, member 13b A G missense FACS B cells - decreased, FACS B:T cells - decreased, FACS IgM+ B cells - decreased 3869 R5327 9 95721471 GRCm38 probably null MGI:109528 Trpc1 transient receptor potential cation channel, subfamily C, member 1 T C critical splice acceptor site Body Weight (Female) - increased 3876 R1345 17 57301214 GRCm38 T S 0.057 probably benign MGI:98923 Vav1 vav 1 oncogene A T missense T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization 3877 R4779 17 57296552 GRCm38 V I 0.998 probably damaging MGI:98923 Vav1 vav 1 oncogene G A missense FACS B1 cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased 3878 R5945 17 57301870 GRCm38 K E 0.912 possibly damaging MGI:98923 Vav1 vav 1 oncogene A G missense FACS CD8+ T cells - decreased 3895 R5538 8 71678773 GRCm38 D G probably benign MGI:99928 Jak3 Janus kinase 3 A G missense FACS CD44+ CD4 MFI - increased 3902 R6492 1 138113562 GRCm38 probably null MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C A T critical splice donor site FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - increased, FACS B220 MFI - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS NK cells - decreased 3925 R6401 11 5829491 GRCm38 W R 1.000 probably damaging MGI:1860191 Polm polymerase (DNA directed), mu A T missense FACS B cells - decreased, FACS B:T cells - decreased 3928 R3812 11 5829512 GRCm38 F L 0.458 possibly damaging MGI:1860191 Polm polymerase (DNA directed), mu A G missense FACS B cells - decreased 3945 R5436 15 98904791 GRCm38 R C 1.000 probably damaging MGI:1289247 Lmbr1l limb region 1 like G A missense CD8 response - decreased, CTL killing - decreased, CTL killing dominant epitope - decreased, FACS B cells - increased, FACS B:T cells - increased, FACS B1 cells - increased, FACS B1a cells in B1 cells - decreased, FACS B220 MFI - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T cells - decreased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - increased, FACS IgM MFI - increased, FACS IgM+ B cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 3948 R3953 16 17285281 GRCm38 probably benign MGI:2448506 Pi4ka phosphatidylinositol 4-kinase alpha A G unclassified FACS CD44+ CD4 T cells - increased, FACS CD44+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, MTT Value of PECs - decreased 3949 R3500 8 117612978 GRCm38 M V 0.004 probably benign MGI:97616 Plcg2 phospholipase C, gamma 2 A G missense Blood Analysis MCHC - decreased, Blood Analysis Platelet Count - decreased, FACS B1 cells - decreased, FACS B1a cells - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - decreased, FACS B2 cells - increased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 MFI - decreased, FACS CD44+ CD8 T cells - decreased, FACS CD44+ T cells - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS IgD MFI - decreased, FACS IgM MFI - increased, FACS IgM+ B cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, IgE response to a Cysteine Protease (Papain) - increased, LPS-induced Necroptosis - decreased, Macrophage necroptosis: low, NLRP3 inflammasome: high response, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-independent B cell response defect- decreased TNP-specific IgM to 3950 R4085 14 20508543 GRCm38 C R 0.734 possibly damaging MGI:107163 Ppp3cb protein phosphatase 3, catalytic subunit, beta isoform A G missense FACS B:T cells - increased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS macrophages - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS neutrophils - increased, FACS NK cells - increased, FACS T cells - decreased, IgG1 response to a Cysteine Protease (Papain) - decreased, OVA-specific IgE - increased, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, Total IgE After 2nd OVA/Alum Challenge (day 7) - increased 3971 R6715 9 53531648 GRCm38 I T 1.000 probably damaging MGI:107202 Atm ataxia telangiectasia mutated A G missense 3994 R1312 11 23757010 GRCm38 T I 0.995 probably damaging MGI:97897 Rel reticuloendotheliosis oncogene G A missense T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 3995 R6725 13 64366623 GRCm38 R * probably null MGI:88564 Ctsl cathepsin L T A nonsense FACS B1 cells - decreased, FACS B1a cells - decreased, FACS B1a cells in B1 cells - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - decreased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - decreased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - increased, FACS T cells - decreased, skin/coat/nails 3996 R6687 3 107105027 GRCm38 S Y 1.000 probably damaging MGI:96659 Kcna2 potassium voltage-gated channel, shaker-related subfamily, member 2 C A missense lethality-postnatal 3999 R6617 8 119538137 GRCm38 P S 1.000 probably damaging MGI:1927235 Mbtps1 membrane-bound transcription factor peptidase, site 1 G A missense pigmentation, skin/coat/nails 4000 R6750 9 44750394 GRCm38 V A 0.917 possibly damaging MGI:2387591 Arcn1 archain 1 A G missense pigmentation, skin/coat/nails 4005 R6641 4 101765305 GRCm38 D E 0.972 probably damaging MGI:104993 Lepr leptin receptor T A missense Body Weight (DSS Male) - increased, Body Weight (DSS) - increased, Body Weight (DSS, z-score) - increased 4008 R6679 2 101644284 GRCm38 P L 1.000 probably damaging MGI:97848 Rag1 recombination activating gene 1 G A missense FACS B cells - decreased, FACS B:T cells - decreased, FACS CD44+ CD8 MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased 4029 R6605 11 106312713 GRCm38 G D 1.000 probably damaging MGI:96431 Cd79b CD79B antigen C T missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS CD4+ T cells - increased, FACS T cells - increased 4030 R6625 19 5760826 GRCm38 V F 0.999 probably damaging MGI:1931787 Scyl1 SCY1-like 1 (S. cerevisiae) C A missense behavior/neurological, Body Weight (DSS Female) - decreased, Body Weight (DSS Male) - decreased, Body Weight (DSS) - decreased, Body Weight (DSS, z-score) - decreased, FACS B1b cells - decreased, FACS B2 cells - increased 4037 R6694 1 36782517 GRCm38 Y C 1.000 probably damaging MGI:99613 Zap70 zeta-chain (TCR) associated protein kinase A G missense FACS CD44+ CD8 MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased 4040 R6561 11 34687538 GRCm38 F S 1.000 probably damaging MGI:2149010 Dock2 dedicator of cyto-kinesis 2 A G missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - increased, FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - decreased 4067 R1899 11 34294286 GRCm38 H R 0.253 probably benign MGI:2149010 Dock2 dedicator of cyto-kinesis 2 T C missense Body Weight - decreased, Body Weight (Z-score) - decreased, FACS B1a cells in B1 cells - decreased, FACS B1b cells in B1 cells - increased 4068 R5860 11 34256562 GRCm38 G R 1.000 probably damaging MGI:2149010 Dock2 dedicator of cyto-kinesis 2 C T missense FACS B:T cells - decreased, FACS CD8+ T cells - increased 4069 R6173 11 34262388 GRCm38 K R 0.795 probably null MGI:2149010 Dock2 dedicator of cyto-kinesis 2 T C missense FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD8+ T cells - increased 4104 R6531 13 20572446 GRCm38 R L 0.912 possibly damaging MGI:2153044 Elmo1 engulfment and cell motility 1 G T missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased 4105 R6666 15 78481834 GRCm38 probably null MGI:96550 Il2rb interleukin 2 receptor, beta chain TAGTCA TAGTCAGTCA frame shift FACS CD4:CD8 - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD8 MFI - decreased, FACS CD44+ CD8 T cells - decreased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - decreased, FACS IgM MFI - increased, FACS NK cells - decreased, FACS NK1.1+ T cells - decreased 4112 R6747 11 44883814 GRCm38 V F 1.000 probably damaging MGI:95275 Ebf1 early B cell factor 1 G T missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B220 MFI - increased, FACS CD4+ T cells - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - decreased, FACS IgD MFI - decreased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS naive CD4 T cells in CD4 T cells - increased, FACS T cells - increased 4137 R6633 2 101642710 GRCm38 R W 1.000 probably damaging MGI:97848 Rag1 recombination activating gene 1 T A missense FACS B cells - decreased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T cells - increased, FACS CD44+ T MFI - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased 4147 R6650 4 101815201 GRCm38 Q K 1.000 probably damaging MGI:104993 Lepr leptin receptor C A missense Body Weight (DSS Female) - increased, Body Weight (DSS Male) - increased, Body Weight (DSS) - increased, Body Weight (DSS, z-score) - increased, FACS B220 MFI - decreased 4154 R6727 10 28781907 GRCm38 I T 1.000 probably damaging MGI:2443552 Themis thymocyte selection associated T C missense FACS B:T cells - increased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - increased, FACS NK1.1+ T cells - increased, FACS T cells - decreased 4160 R6774 16 15725461 GRCm38 probably null MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide G T critical splice donor site FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - decreased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased 4169 R6807 18 66859856 GRCm38 N I 1.000 probably damaging MGI:99457 Mc4r melanocortin 4 receptor T A missense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased, FACS NK cells - decreased 4178 R6744 11 106301404 GRCm38 K * probably null MGI:95707 Gh growth hormone T A nonsense Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Z-score) - decreased 4184 R6738 8 22675036 GRCm38 I L 0.998 probably damaging MGI:1338071 Ikbkb inhibitor of kappaB kinase beta T G missense FACS central memory CD4 T cells in CD4 T cells - decreased, MCMV susceptibility, post-MCMV FACS B1a cells in B1 cells - decreased, post-MCMV FACS B1b cells in B1 cells - increased, post-MCMV FACS CD44+ CD4 MFI - decreased, post-MCMV FACS CD44+ CD8 MFI - decreased, post-MCMV FACS CD44+ CD8 T cells - decreased, post-MCMV FACS CD44+ T MFI - decreased, post-MCMV FACS CD8a+ DCs (gated in CD11c+ cells) - increased, post-MCMV FACS effector memory CD4 T cells in CD4 T cells - decreased, post-MCMV FACS effector memory CD8 T cells in CD8 T cells - decreased, TLR signaling defect: hyposensitivity to MALP2 4190 R6792 5 140913309 GRCm38 I F 1.000 probably damaging MGI:1916978 Card11 caspase recruitment domain family, member 11 T A missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS CD4+ T cells - increased, FACS CD44+ T MFI - decreased, FACS CD8+ T cells - increased, FACS central memory CD4 T cells in CD4 T cells - decreased, FACS effector memory CD4 T cells in CD4 T cells - decreased, FACS effector memory CD8 T cells in CD8 T cells - decreased, FACS NK cells - decreased, FACS T cells - increased 4194 R6665 16 15786050 GRCm38 probably null MGI:104779 Prkdc protein kinase, DNA activated, catalytic polypeptide T C critical splice donor site FACS B cells - decreased, FACS B:T cells - increased, FACS B1 cells - decreased, FACS B220 MFI - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS NK cells - increased, FACS T cells - decreased 4204 R6795 6 71326340 GRCm38 L Q 1.000 probably damaging MGI:88347 Cd8b1 CD8 antigen, beta chain 1 T A missense FACS B:T cells - increased, FACS B220 MFI - decreased, FACS CD4:CD8 - increased, FACS CD4+ T cells - increased, FACS CD4+ T cells in CD3+ T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ CD8 T cells - decreased, FACS CD8+ T cells - decreased, FACS CD8+ T cells in CD3+ T cells - decreased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased 4209 R6805 5 75652808 GRCm38 I N 1.000 probably damaging MGI:96677 Kit KIT proto-oncogene receptor tyrosine kinase T A missense pigmentation, skin/coat/nails 4248 R6818 19 25169501 GRCm38 probably null MGI:1921396 Dock8 dedicator of cytokinesis 8 T C critical splice donor site FACS B:T cells - increased, FACS B1 cells - decreased, FACS B220 MFI - decreased, FACS CD4+ T cells - decreased, FACS CD44+ CD4 MFI - increased, FACS CD44+ CD4 T cells - increased, FACS CD44+ CD8 MFI - increased, FACS CD44+ T MFI - increased, FACS CD8+ T cells - decreased, FACS central memory CD4 T cells in CD4 T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS effector memory CD4 T cells in CD4 T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - increased, FACS naive CD4 T cells in CD4 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - decreased, FACS T cells - decreased 4260 R6590 7 122289514 GRCm38 I T 0.997 probably damaging MGI:97596 Prkcb protein kinase C, beta T C missense FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - decreased, FACS CD8+ T cells - increased, FACS central memory CD8 T cells in CD8 T cells - increased, FACS T cells - increased 4264 R6618 7 122627663 GRCm38 R Q 0.070 probably benign MGI:97596 Prkcb protein kinase C, beta G A missense FACS B1 cells - decreased 4265 R1540 7 122627693 GRCm38 T I 0.997 probably damaging MGI:97596 Prkcb protein kinase C, beta C T missense T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 4266 R6805 1 138067885 GRCm38 probably null MGI:97810 Ptprc protein tyrosine phosphatase, receptor type, C C T critical splice donor site FACS B1 cells - increased, FACS B220 MFI - decreased, FACS CD44+ CD8 MFI - increased, FACS naive CD8 T cells in CD8 T cells - decreased 4268 R6851 10 79729113 GRCm38 probably null MGI:1298210 Hcn2 hyperpolarization-activated, cyclic nucleotide-gated K+ 2 T A critical splice donor site Body Weight - decreased, Body Weight (Male) - decreased, Body Weight (Z-score) - decreased, FACS B cells - decreased, FACS CD8+ T cells in CD3+ T cells - increased, LPS Cachexia: Body Weight (day 0) - decreased, LPS Cachexia: Body Weight (day 0, z-score) - decreased, LPS Cachexia: Body Weight Change (day 1, g) - increased, LPS Cachexia: Body Weight Change (day 1, ratio) - increased, LPS Cachexia: Body Weight Change (day 2, g) - increased, LPS Cachexia: Body Weight Change (day 2, ratio) - increased 4296 R6794 19 46307720 GRCm38 probably null MGI:1099800 Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100 T C critical splice donor site FACS B cells - decreased, FACS B:T cells - decreased, FACS B1 cells - increased, FACS B220 MFI - decreased, FACS CD4:CD8 - decreased, FACS CD4+ T cells - increased, FACS CD4+ T cells in CD3+ T cells - decreased, FACS CD44+ CD4 MFI - decreased, FACS CD44+ CD8 MFI - decreased, FACS CD44+ T MFI - decreased, FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased, FACS effector memory CD8 T cells in CD8 T cells - decreased, FACS naive CD8 T cells in CD8 T cells - increased, FACS NK cells - decreased, FACS T cells - increased 4331 R0110 6 85620369 GRCm38 R * probably null MGI:1934606 Alms1 ALMS1, centrosome and basal body associated A T nonsense Body Weight - increased, Body Weight (Female) - increased, Body Weight (Male) - increased, Body Weight (Z-score) - increased 4345 R4493 19 46308439 GRCm38 D G 0.991 probably damaging MGI:1099800 Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100 A G missense FACS CD4+ T cells - increased, FACS CD8+ T cells - increased, FACS T cells - increased 4346 R2127 4 65297257 GRCm38 L M 1.000 probably damaging MGI:97479 Pappa pregnancy-associated plasma protein A T A missense Body Weight - decreased, Body Weight (Female) - decreased, Body Weight (Z-score) - decreased, FACS CD8a+ DCs (gated in CD11c+ cells) - increased 4364 R5809 11 34262445 GRCm38 D A probably benign MGI:2149010 Dock2 dedicator of cyto-kinesis 2 T G missense FACS CD8+ T cells - increased, FACS CD8+ T cells in CD3+ T cells - increased 4369 R0497 16 19956966 GRCm38 probably null MGI:2686922 Klhl6 kelch-like 6 GT G frame shift FACS B cells - decreased, FACS B:T cells - decreased, FACS CD4+ T cells - increased, FACS IgD+ B cell percentage - decreased, FACS IgM+ B cells - decreased, FACS T cells - increased