Phenotypic Mutations

4 mutations affecting 4 genes are currently displayed.

Mutations Mapped and Identified Based on Phenotype
[records 1 to 4 of 4] per page Full List



Verification Probability

Phenotypic Category



1 UTSW Il12a 0.000 bakers_dozen 3 68690644-68698547 bp (+) 68697987 Autosomal Recessive (1;5) 0.148 2019-09-04
Anne Murray
MCMV proliferation in macrophages - increased
MCMV susceptibility
TCAC ⇒ TC frame shift probably null
2 UTSW Irs1 0.622 runt 1 82233101-82291416 bp (-) 82287732 Unknown (1;0)
Autosomal Recessive (4;10)
0.755 2019-09-04
Anne Murray
Body Weight - decreased
Body Weight (Male) - decreased
Body Weight (Z-score) - decreased
TGGGGTGGACATCGAACTGAAGGAG ⇒ TG frame shift probably null
3 UTSW Il2rb 0.088 Moonpie 15 78479256-78495271 bp (-) 78481834 Autosomal Dominant (3;15)
Autosomal Semidominant (7;56)
0.858 2019-09-04
Anne Murray
FACS CD4:CD8 - increased
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD44+ CD8 MFI - decreased
FACS CD44+ CD8 T cells - decreased
FACS CD8+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - decreased
FACS central memory CD8 T cells in CD8 T cells - decreased
FACS IgM MFI - increased
FACS NK cells - decreased
FACS NK1.1+ T cells - decreased
TAGTCA ⇒ TAGTCAGTCA frame shift probably null
4 UTSW Klhl6 0.074 Lazuli 16 19946496-19983037 bp (-) 19956966 Autosomal Dominant (3;13)
Autosomal Semidominant (3;12)
failed initial filter 2019-05-24
Anne Murray
FACS B cells - decreased
FACS B:T cells - decreased
FACS CD4+ T cells - increased
FACS IgD+ B cell percentage - decreased
FACS IgM+ B cells - decreased
FACS T cells - increased
GT ⇒ G frame shift probably null
[records 1 to 4 of 4]