Phenotypic Mutation 'wavedx' (pdf version)
Allelewavedx
Mutation Type missense
Chromosome12
Coordinate21,340,750 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Adam17
Gene Name a disintegrin and metallopeptidase domain 17
Synonym(s) CD156b, Tace
Chromosomal Location 21,323,509-21,373,632 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero or fail to survive beyond one week of age. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Most mice homozygous for targeted mutations that inactivate the gene die perinatally with stunted vibrissae and open eyelids. Survivors display various degrees of eye degeneration, perturbed hair coats, curly vibrissae, and irregular pigmentation patterns. Histological analysis of fetuses reveal defects in epithelial cell maturation and organization in multiple organs. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009615; MGI: 1096335

Mapped Yes 
Amino Acid Change Phenylalanine changed to Isoleucine
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000067953
Gene: ENSMUSG00000052593
AA Change: F343I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 1.1e-11 PFAM
Pfam:Reprolysin_5 221 451 6.7e-37 PFAM
Pfam:Reprolysin_4 221 469 3.2e-24 PFAM
Pfam:Reprolysin_2 244 464 8.8e-29 PFAM
Pfam:Reprolysin_3 248 416 1.2e-12 PFAM
Pfam:Reprolysin 383 474 3.1e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 642 4e-32 PDB
transmembrane domain 672 694 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000064536)
SMART Domains Protein: ENSMUSP00000099087
Gene: ENSMUSG00000052593
AA Change: F362I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 167 9.7e-15 PFAM
Pfam:Reprolysin_5 221 470 5e-34 PFAM
Pfam:Reprolysin_4 221 488 6.1e-20 PFAM
Pfam:Reprolysin_2 264 483 2.6e-34 PFAM
Pfam:Reprolysin_3 267 435 2.8e-14 PFAM
Pfam:Reprolysin 330 493 5.3e-9 PFAM
DISIN 503 580 6.27e-26 SMART
Pfam:ADAM17_MPD 600 661 1e-23 PFAM
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 758 774 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000101551)
SMART Domains Protein: ENSMUSP00000136677
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 25 167 9.1e-13 PFAM
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000136407
Gene: ENSMUSG00000052593
AA Change: F343I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 7.5e-12 PFAM
Pfam:Reprolysin_5 221 451 4.2e-37 PFAM
Pfam:Reprolysin_4 221 469 2e-24 PFAM
Pfam:Reprolysin_2 244 464 5.6e-29 PFAM
Pfam:Reprolysin_3 248 416 7.8e-13 PFAM
Pfam:Reprolysin 381 474 2.2e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 638 5e-29 PDB
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000145118)
Predicted Effect probably benign
Predicted Effect probably benign
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably essential (E-score: 0.947) question?
Phenotypic Category
Phenotypequestion? Literature verified References
skin/coat/nails
vision/eye
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(24) : Targeted(12) Gene trapped(10) Spontaneous(1) Chemically induced(1

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Adam17 APN 12 21328109 missense probably damaging 1.00
IGL01340:Adam17 APN 12 21330057 nonsense probably null
IGL01973:Adam17 APN 12 21349943 missense probably damaging 1.00
IGL02223:Adam17 APN 12 21361705 missense possibly damaging 0.92
IGL03153:Adam17 APN 12 21345697 missense probably damaging 1.00
Steinway UTSW 12 21353948 missense probably damaging 1.00
R0014:Adam17 UTSW 12 21336644 missense probably benign 0.36
R0080:Adam17 UTSW 12 21329048 splice site probably benign
R0082:Adam17 UTSW 12 21329048 splice site probably benign
R0324:Adam17 UTSW 12 21349938 missense probably benign 0.00
R0511:Adam17 UTSW 12 21340458 splice site probably benign
R0745:Adam17 UTSW 12 21332221 splice site probably benign
R1314:Adam17 UTSW 12 21329071 missense probably damaging 1.00
R1547:Adam17 UTSW 12 21353957 missense probably damaging 1.00
R1594:Adam17 UTSW 12 21340470 critical splice donor site probably null
R1607:Adam17 UTSW 12 21334138 splice site probably null
R1812:Adam17 UTSW 12 21361767 missense probably damaging 0.97
R2020:Adam17 UTSW 12 21349875 missense probably damaging 1.00
R3408:Adam17 UTSW 12 21329118 missense probably damaging 1.00
R3735:Adam17 UTSW 12 21325412 missense probably benign 0.05
R3886:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R3888:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R4062:Adam17 UTSW 12 21325457 missense probably damaging 1.00
R4415:Adam17 UTSW 12 21345701 missense possibly damaging 0.90
R4563:Adam17 UTSW 12 21332088 missense probably damaging 1.00
R4658:Adam17 UTSW 12 21332160 missense probably damaging 1.00
R4763:Adam17 UTSW 12 21334015 missense probably benign
R4793:Adam17 UTSW 12 21347395 missense probably benign
R5101:Adam17 UTSW 12 21373405 missense possibly damaging 0.85
R5120:Adam17 UTSW 12 21343019 intron probably benign
R5514:Adam17 UTSW 12 21340519 missense probably damaging 0.98
R5592:Adam17 UTSW 12 21334137 missense probably damaging 1.00
R5874:Adam17 UTSW 12 21329086 missense possibly damaging 0.76
R6110:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6451:Adam17 UTSW 12 21342882 missense probably benign 0.00
R6930:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6970:Adam17 UTSW 12 21345668 missense probably benign 0.06
R7213:Adam17 UTSW 12 21336678 nonsense probably null
R7302:Adam17 UTSW 12 21355693 intron probably benign
R7361:Adam17 UTSW 12 21325601 missense probably damaging 0.98
R7667:Adam17 UTSW 12 21333952 critical splice donor site probably null
R7799:Adam17 UTSW 12 21340492 missense probably damaging 1.00
R8762:Adam17 UTSW 12 21351594 missense probably benign 0.03
X0063:Adam17 UTSW 12 21332585 missense probably benign 0.17
Z1176:Adam17 UTSW 12 21361737 missense possibly damaging 0.94
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
MMRRC Submission 034295-JAX
Last Updated 2016-11-10 12:01 PM by Anne Murray
Record Created unknown
Record Posted 2010-10-29
Phenotypic Description

The wavedX mutation was originally discovered as a visible variant among G3 mice homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU).  Homozygous wavedX mice are characterized by open eyelids and curly vibrissae at birth, while adult animals display wavy coats and corneal opacities (Figure 1).

The wavedX phenotype is similar to the waved-1 (1), waved-2 (2), Waved-5 (3) and Velvet (4) phenotypes, which result from mutations in the genes encoding transforming growth factor-α (TGF-α, waved-1) and epidermal growth factor receptor (EGFR, waved-2 Waved-5, Velvet).  Like Velvet animals, wavedX mice are also susceptible to dextran sodium sulfate (DSS)-induced colitis (DSS-induced Colitis Screen).  Homozygous wavedX mice display progressive weight loss beginning around five days after continuous administration of 2% DSS in the drinking water, when wild type mice have not yet lost any weight (5) (Figure 2).

 

No discernible embryonic or perinatal lethality is observed in homozygous wavedX mice. 

Nature of Mutation
The wavedX mutation was mapped to Chromosome 12, and corresponds to a T to A transversion at position 1186 of the Adam17 transcript (isoform 1), in exon 9 of 19 total exons (Figure 3).
 
1171 TTCACGTACCAGGATTTTGATATGGGAACTCTT
338  -F--T--Y--Q--D--F--D--M--G--T--L-
 
The mutated nucleotide is indicated in red lettering, and changes the phenylalanine at codon 343 to an isoleucine.
Illustration of Mutations in
Gene & Protein
Protein Prediction
ADAM17, also known as the tumor necrosis factor (TNF)-α converting enzyme (TACE), is a member of the ADAM (a disintegrin and metalloprotease) family of metalloproteinases. ADAMs belong to the metzincin family of metalloproteases, which also includes astacins and matrix metalloproteinases (MMPs). The term metzincin refers to the zinc-binding motif and a methionine-containing turn present in their catalytic domain. The ADAMs form the adamalysin subfamily along with snake venom metalloproteinases and ADAMTS proteins (ADAMs containing thrombospondin motifs; see the record for splotch2) (6;7). ADAMs are found in vertebrates, C. elegans and Drosophila, but are not present in bacteria, yeast or plants (8). The 827 amino acid mouse ADAM17 shares 92% identity with its human homologue (9;10). Among the ADAMs, only ADAM 10 (also known as Kuzbanian) has the most sequence homology with ADAM17 (11-13).
 
ADAMs are multi-domain type I transmembrane proteins consisting of an N-terminal signal sequence (aa 1-17 in mouse ADAM17) followed by a prodomain (aa 18-214) , a metalloprotease domain (aa 215-473), a disintegrin domain (aa 474-558), a cysteine-rich region (aa 559-671), a transmembrane domain (aa 672-694), and a cytoplasmic tail (aa 695-827) (Figure 4) (6-8). Both ADAM10 and ADAM17 lack a membrane-proximal EGF repeat that is present in all other ADAMs (14).
 
The N-terminal signal sequence of ADAMs directs these proteins into the secretory pathway, while the prodomain functions in maturation. Primarily, the prodomain keeps the metalloprotease site inactive through a cysteine switch present at amino acids 181-187 in ADAM17 (8). The cysteine switch is a conserved cysteine residue that preferentially coordinates the active site zinc and thus, sequesters the metalloprotease domain in an inactive conformation. At the end of the prodomain (aa 211-214) is a furin proprotein convertase cleavage site, which allows the processing of ADAM17 into an active enzyme. The prodomain also functions as an intermolecular chaperone and is necessary for the proper folding of the protein particularly the metalloprotease domain (15).
 
Two studies have shown that RHBDF2, a rhomboid-like protease encoded by Rhbdf2 (see the record for sinecure) is essential for TACE folding and/or maturation (16;17).  Examination of Rhbdf2 knockout (KO) mouse (Rhbdf2-/-) macrophages found that the induction or trafficking of TNF was not altered, but the shedding of the ectodomain did not occur (16;17).    Further examination revealed that in the Rhbdf2-/- macrophages the levels of TACE were comparable to levels observed in the Rhbdf2+/+ cells, but there was a complete loss of TACE activity (16).  Furthermore, TACE was not found at the cell surface in the KO due to an inability of the protein to traffic from the ER to the trans-Golgi network (TGN).  Adrain et al. propose that iRhom2 is essential for the release of TACE from the ER and that RHBDF2 is either involved in the folding and/or maturation of TACE in the ER, or it is a cargo receptor that assists in the trafficking of TACE (16)

 

Roughly half of the proteins recognized as belonging to the ADAM family do not contain the catalytic-site consensus sequence for metalloproteases (HEXXH) in their metalloprotease domain, and are likely not catalytically active. The metalloprotease motif (HELGHNFGAEH) in mouse ADAM17 occurs at amino acids 405-415 (9;10). Crystal structure of the ADAM17 metalloprotease domain shows an active site containing zinc and water atoms that are necessary for the hydrolytic processing of protein substrates, and which are coordinated by three conserved histidine residues and the downstream methionine found in the Met turn motif (aa 433-437). The Met turn motif loops around to face the zinc binding site (Figure 5). Central to the metalloprotease domain is a twisted, five-stranded β-pleated sheet (strands sI–sV) flanked on its convex side by α-helices hB and hB2 and on its concave side by helices hA and hC (18). The ADAM17 metalloprotease domain is structurally similar to other metzincin proteins, although the ADAM17 binding pocket has an unusual tunnel connecting the two sites that accommodate the sidechains of the first and third residues of the substrate following the cleaved peptide bond (11). Some inhibitors of ADAM metalloprotease activity do so by binding to the active-site cleft of the catalytic site. The TIMP-3 protein (tissue inhibitor of metalloproteases) is able to inhibit ADAM17 activity in this way (19) (Figure 5B).

 
In snake venom metalloproteases (SVMPs), the disintegrin domain is involved in binding of platelet integrin receptors and preventing the association of platelets with their natural ligands, thus blocking platelet aggregation at the wound site. SVMP disintegrin domains mimic the ligand site of matrix proteins by containing an RGD consensus sequence within a 13 amino acid stretch known as the disintegrin loop (8). However, most ADAM proteins associate with integrin receptors through an aspartic acid-containing sequence (RX6DEVF) in their disintegrin loops. ADAM17 does not contain either of these motifs, and is not able to bind to integrin receptors (20). For various ADAMs, the cysteine-rich regions have been shown to complement the binding capacity of the disintegrin domain, and be involved in the regulation of catalytic activity, substrate targeting, and the removal of the prodomain from the catalytic domain (7;8). The structures of the ADAM10 disintegrin and cysteine-rich domains demonstrated that these domains were needed for substrate-recognition. The disintegrin domain contains two β-strands, while the cysteine-rich region contains seven short β-strands and three short α-helices. The overall structure is stabilized by disulfide bonds between the cysteine residues. The ADAM10 cysteine-rich domain contains a novel α/β fold, and a large negatively-charged pocket located on one side, which is necessary for substrate binding (14) (Figure 6). 

 

As the ADAM17 and ADAM10 cysteine-rich regions are similar to each other, but divergent from other ADAMs, it is possible that this domain is also important for ADAM17 substrate binding. ADAM17 also contains several negatively charged residues located in the same region (albeit in different positions) as the substrate binding pocket found in ADAM10 (14). However, some experiments suggest that the ADAM17 disintegrin and cysteine-rich domains are unnecessary for enzymatic activity (21). Conversely, two cysteine motifs (CXXC) located in the disintegrin and cysteine-rich regions of ADAM17 and that are implicated in thiol-disulfide conversions, have been shown to be important for the enzymatic cleavage of certain substrates under certain conditions (22).

 

The cytoplasmic domain of ADAM17 contains a proline-rich region (PAPQTPGR) at amino acids 731-738 that contains a PXXP binding site for SH3 domain-containing proteins (8)(8), and an extracellular regulated kinase (ERK) phosphorylation site (PXTP). In response to various stimuli, ADAM17 is phosphorylated by ERK at T735. This phosphorylation appears to be important for ADAM17 activity (23;24). ERK may also phosphorylate ADAM17 on S819 (25). An extended region of ADAM17 containing the proline-rich motif also interacts with the mitotic arrest deficient 2 (MAD2) protein (26), a component of the spindle assembly checkpoint mechanism during mitosis. ADAM17 is also phosphorylated by the phosphoinositide-dependent kinase 1 (PDK1), a downstream target of phosphatidylinositol 3-kinase (PI3-K) (27). The cytosolic domain of ADAM17 can also interact with the protein tyrosine phosphatase PTPH1, which binds to the five terminal amino acids (KETEC) of ADAM17 and downregulates proteolytic activity (28). Under certain conditions, the cytoplasmic domain is not necessary for the cleavage of some ADAM17 substrates (29)

 

An alternatively spliced form of mouse Adam17 has been identified that would produce a soluble protein missing the transmembrane domain and cytosolic tail (9). It is unknown if this variant produces functional protein.

 

The wavedX mutation replaces F343 with an isoleucine in the metalloproteinase domain of ADAM17. This residue is located in the loop between the sIII and sIV beta strands (Figure 5A).

Expression/Localization

In both mouse and humans, ADAM17 mRNA is found in most tissues and cell types, and the expression of the protein is largely constitutive (9;10;12;21;30)

 

In situ hybridization studies of mouse Adam17 expression found it to be broadly expressed during embryogenesis in most organs. After birth, Adam17 mRNA is highly expressed in the kidney, lung, spleen, thymus, dorsal root ganglion, the submaxillary gland, and the cerebellum (31). Detailed examination of expression in the adult brain found Adam17 mRNA levels highest in the cerebral cortex. Adam17 mRNA was also found in the hippocampus, inferior colliculus of the mesencephalon, and the pontine nuclei of the medulla (32). During mouse pancreatic organogenesis, ADAM17 is broadly expressed, but becomes restricted to islet cells (33)

 

In humans, examination of ADAM17 protein expression in the brain found protein is expressed in distinct neuronal populations, including pyramidal neurons of the cerebral cortex and granular cell layer neurons in the hippocampus (34). However, another study suggested that ADAM17 was mostly expressed in astrocytes and endothelial cells in the brain (35)

 

In mammalian cells, ADAM17 is predominantly localized to a perinuclear compartment similar to that described for TNF-α. The immature form of ADAM17 is predominantly intracellular, whereas the mature (and active) form is detectable both within the cell and on the cell surface. Prodomain removal resulting in mature ADAM17 occurs in the Golgi compartment where furin proprotein convertases are active (36). Inducible trafficking of ADAM17 to the cell surface may be dependent upon ERK phosphorylation at T375 (see Protein Prediction) (37).

 

ADAM17 mRNA and protein levels appear to be upregulated under inflammatory conditions. ADAM17 mRNA is found in arthritis-affected, but not normal, human cartilage (21), and both mRNA and protein levels are higher in the intestines of both rodents and humans with colitis (38;39).

Background

Proteolytic ectodomain release or shedding has emerged as a key mechanism for regulating the function of many cell surface proteins. This process occurs with type I and type II transmembrane proteins or glycosylphosphatidylinositol (GPI)-anchored molecules in which the cleavage site is located close to the membrane surface. Members of the ADAM proteinase family are the major mediators of ectodomain shedding. Constitutive and regulated proteolytic cleavage of a diverse array of cell surface proteins by ADAM family members are important in many biological processes including fertilization, cell fate determination, cell migration, wound healing, neurite and axon guidance, heart development, immunity, cell proliferation and angiogenesis. ADAMs regulate target substrates by binding to and cleaving the juxtamembrane region. Proteolytic cleavage of these substrates can occur in response to both pharmacological and natural stimuli such as phorbol esters, calcium ionophores, epidermal growth factor receptor (EGFR) ligands, G-protein coupled receptors (GPCR), protein kinase C (PKC), intracellular calcium levels, and membrane lipid composition. Shedding can activate cytokines, growth factors or other mediators by releasing them from their membrane-bound precursors, or conversely, downregulate receptors and other proteins by cleavage from the cell surface [reviewed by (6;7)]. Often, ADAM mediated proteolysis is a prerequisite for intracellular signaling by regulated intramembrane proteolysis (RIP). In this process, the ectodomain shedding of type I proteins prmotes further proteolysis of the remaining transmembrane fragment by the γ-secretase complex, while type II proteins are further degraded by signal peptide peptidase like proteins (SPPLs) (40).

 

Figure 6. TNF signaling. See text for details. Briefly, within the endoplasmic reticulum (ER), the rhomboid protein, RHBDF2, associates with ADAM17 to facilitate the folding and/or trafficking of ADAM17 to the Golgi. Within the Golgi, ADAM17 is further processed by furin to its mature form. At the plasma membrane, ADAM17 cleaves the membrane-bound form of TNF to generate soluble TNF that will subsequently bind the TNFR. This image is interactive, click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

ADAM17 was the first ADAM to be implicated in ectodomain shedding, and was discovered by its identification as the TNF-α convertase (12;13) (see the record for PanR1). TNF-α is a proinflammatory cytokine that is necessary for the development of secondary lymphoid organs (SLOs), plays a critical role in the innate response to many infections, and is implicated in the development of autoimmune diseases (41-44) (Figure 6). ADAM17 cleaves the membrane-bound human TNF-α precursor between A76 and V77 to yield a bioactive 17 kDa protein. In mouse TNF-α, the cleavage site occurs between T79 and L80. Although ADAM17 has been identified as the primary sheddase for TNF-α in mouse macrophages and other cell types (45), human ADAM17 is unable to cleave mouse TNF-α in vitro, perhaps due to differences in the cleavage site (46). Other ADAM proteins can also cleave TNF-α, dependent on the cell type and conditions used. ADAM17 appears to be necessary for stimulated cleavage of TNF-α in response to phorbol myristate acetate (PMA) and lipopolysaccharide (LPS), a component of bacterial cell walls, while various other ADAMs including ADAM8, 9, 10 and 19 may be involved in constitutive shedding (6;45;47). Most of the proinflammatory activities of TNF-α are mediated by the released soluble cytokine, but the generation of knock-in mice expressing a non-cleavable form of TNF-α demonstrated that the membrane-bound form was able to support the development of SLO structures, although the soluble cytokine appears to be necessary for inflammatory responses (48).

 

ADAM17 is now known to regulate the proteolytic processing of nearly 50 substrates in response to specific stimuli (Table 1) [please see (6;7;49) and the references therein]. These substrates display considerable differences in cleavage sites suggesting that the secondary structure of the juxtamembrane stalk is important for efficient substrate recognition (7;8). ADAM17 substrates are involved in a wide variety of biological processes.

 
Table 1. ADAM17 substrates and regulation*
 
Substrate
Regulation
Function
Cytokines
 
 
CSF1
phorbol esters
macrophage and osteoclast differentiation
CX3CL1 (Fractalkine)
phorbol esters; Ca2+-influx, calmodulin; cholesterol depletion; calmodulin
chemoattractant; decreased adhesiveness
CXCL16
phorbol esters; Ca2+-influx; IFNγ; TNF-α
chemoattractant; decreased adhesiveness
FLT3L
LPS
hematopoietic precursor proliferation; NK and DC differentiation
Kit ligands
 
hematopoiesis, spermatogenesis, melanogenesis
TNF-α
phorbol esters; LPS
inflammatory responses
TRANCE
phorbol esters
osteoclastogenesis; DC survival
Growth factors
 
 
Amphiregulin
phorbol esters
EGFR ligand
Epigen
phorbol esters
EGFR ligand
Epiregulin
phorbol esters
EGFR ligand
HB-EGF
phorbol esters
EGFR/ErbB4 ligand
Neuregulins
 
ErbB ligands
Pref-1
 
Iinhibition of adipocyte differentiation
TGF-α
phorbol esters
EGFR ligand
Receptors
 
 
CD30
phorbol esters; cholesterol depletion
downregulation of CD30 signaling in activated lymphocytes
CD40
 
soluble CD40 antagonizes CD40 signaling in APCs
c-Kit
phorbol esters
 
ErbB4
phorbol esters
constitutive receptor activity
GHR
phorbol esters
generation of GHBP
IL-1RII
phorbol esters; IL-8; others
inhibitor of IL-1 signaling
IL-6R
phorbol esters; cholesterol depletion; chemokines; LPS
soluble agonist of gp130; chronic inflammation
IL-15R
phorbol esters
 soluble IL-15 antagonist; enhanced proinflammatory cytokines
LAG-3
PKC-dependent
stimulation of T cell proliferation and effector function
M-CSFR
phorbol esters; LPS
downregulation of M-CSFR
Neuronal pentraxin receptor
 
long-term depression
NGFR; p75NTR
phorbol esters; UV; osmotic stress
downregulated NGF signaling
Notch-1
ligand binding
neurogenesis; hematopoiesis
TNFR I and II
phorbol esters; chemotactic factors; GM-CSF; Ca2+-influx; LPS
soluble TNF-α antagonist; reduced TNFR signaling
Vps10p-domain receptors
phorbol esters
generation of carrier proteins
Adhesion proteins
 
 
CD44
phorbol esters; Ca2+-influx
increased tumor cell migration
CD166
phorbol esters; EGF
increased tumor cell migration
Collagen XVII
phorbol esters; cholesterol depletion
keratinocyte motility
Desmoglein 2
phorbol esters; Ca2+-influx
increased tumor cell migration
GP V; GP 1; Semaphorin 4D
phorbol esters; aspirin; platelet storage; mitochondrial damage; calmodulin inhibition
platelet hemostatic function
ICAM-1
phorbol esters; TNF-α
reduced leukocyte and endothelial cell adhesion
JAM-A
phorbol esters; TNF-α/IFNγ; PAF
soluble antagonist; reduced leukocyte migration
L1
phorbol esters;
Increased neuronal and tumor cell migration and neurite outgrowth
L-selectin
phorbol esters; chemotactic factors; antibody binding; LPS; aspirin
reduced neutrophil migration
NCAM
 
neurite outgrowth
Nectin-4
 
breast cancer marker
VCAM-1
phorbol esters; TNF-α; IL-1
decreased endothelial adhesiveness; de-adhesion of bound leukocytes
Proteinases
 
 
ACE2
phorbol esters; calmodulin inhibition
regulation of the hypertension peptide angiotensin II
Meprin-β (metalloprotease)
phorbol esters
downregulation of proteolysis
Other proteins
 
 
APP
phorbol esters
suppression of β-amyloid formation
Delta like ligand-1 (DLL-1)
 
Notch ligand
Klotho
insulin
antiaging
MICA
phorbol esters
tumor immune escape
Mucin-1
phorbol esters
embryo implantation
Prp
phorbol esters
neuroprotective
PTP-LAR
EGFR signaling
downregulation of phosphatase activity
*Abbreviations: ACE2, angiotensin I converting enzyme; APC, antigen presenting cell; APP, amyloid precursor protein; CD, cluster of differentiation; CSF1, colony stimulating factor I; CX3CL/CXCL, chemokine ligand; DC, dendritic cell; EGF, epidermal growth factor; FGF, fibroblast growth factor; FLT3L, FMS-like tyrosine kinase 3 ligand; GHBP, growth hormone binding protein; GHR, growth hormone receptor; GP, glycoprotein; GPCR, G-protein coupled receptor; HB-EGF, heparin-binding EGF-like growth factor; ICAM, intracellular adhesion molecule; IFN, interferon; JAM, junctional adhesion molecule; IL, interleukin; LAG; lymphocyte activation gene; LPA, lysophosphatidic acid; LPS, lipopolysaccharide; M-CSFR, macrophage-colony-stimulating factor receptor; MICA, MHC class I polypeptide-related sequence A; NCAM, neural cell adhesion molecule; NGFR, nerve growth factor receptor; NK, natural killer cell; p75NTR, p75 neurotensin receptor; PAF, platelet activating factor; PDGF; platelet-derived growth factor; Pref; preadipocyte factor; PrP, prion protein; PTP, protein tyrosine phosphataseTGF, transforming growth factor; TNF, tumor necrosis factor; TRANCE, TNF-related activation induced cytokine; VCAM, vascular cell-adhesion molecule; Vps, vacuolar proteins sorting; UV, ultraviolet radiation
 

Mice with a targeted disruption of the zinc-binding domain of ADAM17 (taceΔZn/ΔZn) exhibit embryonic and perinatal lethality along with open eye lids, a lack of a conjunctival sac, thinned corneas, and epidermal and hair defects (50).  Epithelial dysgenesis characterized by delayedor impaired maturation was observed in multiple organs, includingthe intestine, lung, nonglandular stomach, thyroid, parathyroid,and salivary gland taceΔZn/ΔZn knockout animals also displayed heart abnormalities, impaired vascular development, and defects in lung branching morphogenesis (51-53).  The phenotypes seen in these mice are similar to mice lacking components of the epidermal growth factor receptor (EGFR) signaling pathway.  EGFR is the receptor for a number of growth factors including EGF, TGF-α, amphiregulin (AREG), betacellulin (BTC), heparin-binding EGF (HB-EGF), and epiregulin (see the record for Velvet). The eye, hair, and skin defects are similar to those of mice lacking transforming growth factor-α (TGF-α) and the EGFR (1;2). The other epithelial defects observed in taceΔZn/ΔZn knockouts are also observed in mice lacking EGFR (54;55).  In addition, both EGFR-deficient mice and HB-EGF-deficient mice have similar defects in heart and lung development (51;53;56).  HB-EGF is also implicated in eyelid closure (57), and mice carrying uncleavable forms of HB-EGF displayed similar phenotypes as HB-EGF-deficient animals (58).  ADAM17 has also been shown to regulate the proteolysis of other EGFR ligands including amphicellulin, epigen, and epiregulin (EREG).  Mammary ductal morphogenesis was shown to require ADAM17-dependent shedding of epithelial AREG (59), while animals deficient in EREG have abnormal intestinal epithelial proliferation and are sensitive to chemically induced colitis, a phenotype also seen in certain Egfr mutants including Velvet (5;60;61)

 

On certain genetic backgrounds, a low percentage of taceΔZn/ΔZn animals survive to adulthood.  In addition to the phenotypes caused by defects in EGFR signaling, these mice display a partial block in T cell development in the thymus, loss of B cell maturation and lack of B cell follicle and germinal center formation in the spleen.  These defects were attributed to loss of ADAM17 function in nonhematopoietic cells (62), although a subsequent study using a conditional knockout of Adam17 in thymic epithelial cells (TECs) did not affect T cell development (63).  Studies using conditional taceΔZn/ΔZn knockouts and irradiated mice transplanted with ADAM17-deficient hematopoietic cells have confirmed ADAM17 as the primary sheddase for TNF-α and TNFR in vivo (64;65).      

 

Although ADAM17 appears to be an important sheddase for many of the substrates listed in Table 1, other ADAMs may be involved as was shown for TNF-α.  Therefore, the specific phenotypes displayed by taceΔZn/ΔZn knockout mice could be due to partial functional redundancy between Adam genes.  Deficiency of ADAM10 resulted in early embryonic lethality due to defective Notch signaling, which is critical for the differentiation of multiple tissues (66).  Although ADAM17 is also able to regulate Notch signaling in cell assays, it is clear that ADAM10 is the primary regulator of Notch signaling in vivo.  Similarly, the overexpression of wild-type and dominant-negative Adam10 in mice suggested that ADAM10 was the principal sheddase in the brain (67).  ADAM19-deficient mice die after birth with heart defects that differ from those seen in Adam17 knockouts (68;69), while most other Adam knockouts have resulted in viable mice [reviewed in (6;7)].  Adam9/12/15/17-deficient animals have slightly higher embryonic lethality, but an otherwise identical phenotype as taceΔZn/ΔZn knockouts (70)

 

Human mutations in the ADAM17 gene have not been described, but ADAM17 levels and activity may be higher in certain inflammatory diseases including intestinal bowel disease (IBD; OMIM #266600), arthritis, and the neural autoimmune diseases, GBS (OMIM #139393) and MS (OMIM #126200) (71;72).  In the latter two diseases, high levels of ADAM17 protein are localized to the invading T lymphocytes that are mediating the inflammatory demyelination of the peripheral (GBS) and central (MS) nervous systems.  High levels of ADAM17 activity likely lead to increased activity of proinflammatory cytokines including TNF-α, which is implicated in the development of several autoimmune diseases including rheumatoid arthritis, ankylosing spondylitis, Crohn’s disease, and psoriasis; (OMIM *191160).  Thus, the development of specific inhibitors against ADAM17 may lead to effective therapies for certain autoimmune diseases.  However, the involvement of ADAM17 in the cleavage and downregulation of TNF receptor activity suggests that ADAM17 may also be important in modulating inflammatory responses.  Human mutations in TNFR1 cause TNFR-associated periodic syndrome (TRAPS, also known as Familial Hybernian Fever; OMIM #142680), an autosomal dominant syndrome characterized by episodes of fever and severe localized inflammation. These autoinflammatory symptoms may be caused by increased TNFR1 signaling due to impaired downregulation of membrane TNFR1 (73).  This system is further complicated by the upregulation of ADAM17 expression by a number of proinflammatory cytokines, including TNF-α and IL-1β (74).  Aside from inflammatory diseases, increased ADAM17 activity is also implicated in the development of many cancers [reviewed in (49)].  The cleavage of adhesion molecules by ADAM17 leads to tumor cell migration and tissue invasion, while increased growth factor signaling through the ErbB/EGF receptors is known to contribute to cancer progression.  Furthermore, shedding of the MHC class I chain-related molecule A (MICA) by ADAM17 may lead to tumor evasion of the immune system.  High levels of MICA present on malignant cells is recognized by the immunoreceptor NKG2D on cytotoxic lymphocytes (75).

Putative Mechanism
As taceΔZn/ΔZn mice display mostly embryonic and perinatal lethality (50), it is likely that the wavedX allele is hypomorphic and that mice harboring this mutation retain some ADAM17 function.  However, the phenotypes of wavedX mutants and of surviving taceΔZn/ΔZn, which demonstrate a lack ADAM17 proteolytic activity, appear to be similar (62). The residue altered by the wavedX mutation, F343, is highly conserved across ADAM family members.  Although located in the metalloprotease domain, this residue is not part of the active site of the protein.  However, phenylalanine has a large benzyl side chain, which likely forms contacts with the side chains of other residues (see Figure 2), and may play a role with the overall structure of the domain.  Western blot analysis of ADAM17 in wavedX mice identified only the precursor form of the wavedX protein (Figure 7A), suggesting that the phenylalanine to isoleucine substitution somehow affects the ability of the protein to be cleaved into its mature, functional form.  The sheddase activity of the ADAM17 protein in wavedX animals is significantly reduced.  LPS-stimulated peritoneal macrophages from wavedX homozygotes showed increased surface expression of TNF-αand secreted diminished quantities of mature, soluble TNF-α, whereas intracellular TNF-αlevels were not affected, and the shedding of two other ADAM17 substrates, L-selectin (induced by PMA) and FLT3L (induced by LPS), were also both impaired (5) (Figure 7B,C).  

 

Other viable alleles of Adam17 have been recently reported.  The waved with open eyes (woe) locus is a spontaneous recessive mouse mutation resulting in wavy fur, eyelids open at birth and other eye phenotypes, as well as defects in the semilunar cardiac valves.  The visible phenotypes greatly resemble those seen in wavedX mice.  The Adam17 missense mutation in woe animals results in a threonine to methionine substitution at amino acid 265, and affects a putative exonic splicing enhancer.  Consequently, Adam17 is aberrantly spliced resulting in a predominant transcript that lacks exon 7 and deletes residues 252-281 from the metalloprotease domain.  Similar to wavedX mice, woe animals did not display cleaved, functional ADAM17.  However, some shedding of ADAM17 substrates still occurred likely due to a small amount of functional protein produced from the appropriately spliced full-length transcript (76).  It is possible that small amounts of appropriately cleaved but undetectable ADAM17 is also made in wavedX mice, explaining the viability of this allele.

 
In addition, a novel gene targeting strategy, exon-induced translational stop (EXITS), was used to generate mice with dramatically reduced ADAM17 levels in all tissues (77).  These mice are viable; show compromised shedding of ADAM17 substrates from the cell surface, and develop eye, heart, and skin defects due to impaired EGFR signaling.  AREG-induced formation of milk ducts in females is reduced. Similar to wavedX mice, these animals also display increased susceptibility to DSS-induced colitis as a consequence of impaired shedding of EGFR ligands resulting in defective regeneration of epithelial cells and breakdown of the intestinal barrier. Further examination of this phenotype in wavedX mice using bone marrow chimeras confirms the necessity for functional ADAM17 in the non-hematopoietic compartment in order to confer protection from DSS-induced colitis (Figure 8A). This study also demonstrated that Toll-like receptor (TLR) signaling in non-hematopoietic cells is upstream of EGFR signaling and necessary to protect against DSS-induced colitis. TLRs trigger intestinal inflammation when the epithelial barrier is breached by physical trauma or pathogenic microbes. Bone marrow (BM) chimeras were generated, in which the donors and/or the recipients were either wild type or double deficient in the TLR adaptor proteins MyD88 and Trif. Transplant recipients lacking epithelial TLR signaling showed severe weight loss in response to DSS administration, while chimeric mice lacking TLR signaling in hematopoietic cells were equivalent to wild type animals (Figure 8B).  Microarray analysis comparing MyD88/Trif deficient colonic epithelial cells to wild type identified two EGFR ligands, AREG and EREG, as being differently regulated.  Real time PCR of various EGFR ligands confirmed this observation, and the administration of AREG to MyD88/Trif deficient mice ameliorated the effects of DSS (Figure 8C). LPS was able to induce the expression of both amphiregulin and epiregulin transcripts in the wild type colon.  A model of this TLR→MyD88→AREG/EREG→EGFR signaling pathway in non-hematopoietic cells is depicted in Figure 7D (5)
Primers Primers cannot be located by automatic search.
Genotyping
WavedX genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 
Primers
wavedX(F): 5’- CTGTGGGAGAGCAGTCCTTTCATTC -3’
wavedX(R): 5’-GCAGACAAGAGAGCAGTGCCTTAAC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
wavedX_seq(F): 5’- AGAGCAGTCCTTTCATTCTGAGTAG -3’
wavedX_seq(R): 5’- CTTCACAGTTGGGTTGTAATAAGC -3’
 
The following sequence of 964 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 12, bases 21,345,948 to 21,346,911) is amplified:
 
                       ctgtgggag agcagtcctt tcattctgag tagatgaatg
gtgcctgagt gctgcccacc accgcatgag cactgtgctt ctacctgccc ggtcaggtgt
gagccccagg gaaagcattg gtgtagccag ctattgcagg tgctagtgct gagctgcagc
tgttctgtaa tgttgaggtg cccttgaatg tggcatgatg acaagctaac taagacctcc
ctctttttaa agcaatttag ctttgatata gctgaagaag catctaaagt ctgcctggct
catcttttca cgtaccagga ttttgatatg ggaactcttg gattagctta cgttggttct
cccagagcaa acagtcatgg aggggtttgt ccaaaaggta agtatatcat tgcactgtca
tgacactgag agacggaaga gaaagctgac tgggttatgt ttcagttctg agtttaaaag
tcagtttttg tctgtttcct ttttctttta gcttattaca acccaactgt gaagaaaaac
atctatttaa atagtggtct gactagtact aaaaattatg gcaaaactat tctcacaaag
gtatgttttt ttgattttct ttaaaaactt tattaaaaaa tagtgtgtgt acacaccaca
tgcacataag catgggtccc gacagatacc agaagaggat gttggaattg ctggagctgg
agttagagta gatggttgtg aaccatctga taccagtcct gggattgacc atgcagcctc
tgcaagagta gcaagggctt ttaactgctg agccaactct tcagcctctg ttcttgtttt
gaaacaggac agatttggaa tctattgcat tagtatgttg gttacatagt tacagtggtg
tctttgtaaa tagtaacgtg tacttggtgg gcaatgtgac tgtgtgctct gcccttagca
gttaaggcac tgctctcttg tctgc
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
Science Writers Nora G. Smart, Anne Murray
Illustrators Diantha La Vine
AuthorsLei Sun, Katharina Brandl, Owen M. Siggs, Xiao-hong Li, Xin Du, Buce Beutler
Edit History
2011-04-03 2:17 PM (current)
2011-02-24 1:35 PM
2011-02-24 1:34 PM
2011-02-24 1:28 PM
2011-01-07 8:09 AM
2010-12-13 11:02 AM
2010-12-13 11:01 AM
2010-12-08 3:43 PM
2010-12-01 9:13 AM
2010-12-01 9:12 AM
2010-11-06 11:10 AM
2010-11-05 3:22 PM
2010-11-05 3:19 PM
2010-11-05 1:21 PM
2010-11-05 12:35 PM
2010-11-05 12:34 PM
2010-11-05 12:33 PM
2010-10-29 11:07 AM