Phenotypic Mutation 'Tigrou' (pdf version)
Gene Symbol Atp7a
Gene Name ATPase, Cu++ transporting, alpha polypeptide
Synonym(s) RP23-186F4.3, Blo, DXHXS1608e, I14, MNK, Mo, blotchy, br, brindled, mottled
Accession Number

NCBI RefSeq: NM_009726; MGI: 99400

Allele Tigrou
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome X
Chromosomal Location 106,027,276-106,124,926 bp (+)
Type of Mutation NONSENSE
DNA Base Change
(Sense Strand)
G to T at 106,088,407 bp (GRCm38)
Amino Acid Change Glutamic Acid changed to Stop codon
Ref Sequences
E469* in NCBI: NP_033856.3 (fasta)
SMART Domains

DomainStartEndE-ValueType
Pfam:HMA 11 72 1.5e-9 PFAM
Pfam:HMA 174 235 2.2e-8 PFAM
Pfam:HMA 280 344 1.9e-9 PFAM
low complexity region 348 362 N/A INTRINSIC
Pfam:HMA 380 441 6.4e-11 PFAM
Pfam:HMA 482 543 2.5e-7 PFAM
Pfam:HMA 558 619 9.3e-10 PFAM
transmembrane domain 643 665 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:E1-E2_ATPase 777 1025 6.5e-47 PFAM
Pfam:Hydrolase 1029 1304 1.3e-40 PFAM
Pfam:Hydrolase_3 1272 1336 5.4e-2 PFAM
transmembrane domain 1350 1372 N/A INTRINSIC
transmembrane domain 1376 1398 N/A INTRINSIC
Phenotypic Category growth/size, lethality-embryonic/perinatal, lethality-postnatal, pigmentation, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(104) : Targeted(2) Gene trapped(63) Spontaneous(24) Chemically induced(9) Radiation induced(8)          

Lab Alleles APN: IGL01505:Atp7a
UTSW: brown, Golden, Silver, Tigrou-like, Ups, R0240:Atp7a
Mode of Inheritance X-linked Dominant
Local Stock Embryos
Repository

none

Last Updated 12/12/2013 6:56 PM by Stephen Lyon
Record Created unknown
Record Posted 06/02/2008
Phenotypic Description
Figure 1. The tigrou phenotype. (A) Upper panel displays a heterozygous Tigrou female with distinctive mottled pigmentation. (B) Lower panel displays a Tigrou male (right) with a pup. Note the darker extremities.

The Tigrou mutation was originally discovered in a G1 female.  Heterozygous Tigrou females are black with brown stripes on the back, belly and face (Figure 1A) (1).  These stripes do not appear to cross the midline.  The strength of the phenotype increases with age, the brown coat color becoming lighter with time.  Closer examination of newborn mutant females shows that the skin itself is lighter in color at the sites destined to become covered with brown hair.  The Tigrou mutation results in some prenatal male lethality (1).  Surviving Tigrou males are entirely white except for darker pigmentation at the extremities, similar to a thermolabile mutation in the melanogenic enzyme tyrosinase (see the record for ghost) (Figure 1B).  Such males die within 20 days after birth.

 

Nature of Mutation
The Tigrou mutation corresponds to a G to T transversion at position 1485 of the Atp7a transcript, in exon 5 of 23 total exons.
 
1470  TTGCCCTCAAGTAATGAGCTAGAAAATGTGATG
464   -L--P--S--S--N--E--L--E--N--V--M-
 
The mutated nucleotide is indicated in red lettering, and changes the glutamic acid at codon 469 to a stop codon.
 
Protein Prediction
Figure 2. Domain organization and function of ATP7A. A, Topography. B, Domain structure. MBD1-MBD6 represent the N-terminal metal binding domains with the Cu-binding cysteines indicated. Critical residues thought to bind Cu in transmembrane domains 6, 7, and 8 are shown. The canonical A-domain and P-domain residues are also indicated. The LL and PBM motifs in the C-terminal tail are necessary for subcellular localization of ATP7A. Conversion of ATP to ADP by the N-domain leads to phosphorylation of the P-domain and copper transport. The A-domain dephosphorylates the P-domain. Numbers 1, 2, and 3 indicate the order of copper binding and transport (see text). The Tigrou mutation changes glutamic acid to a stop codon at amino acid 469 in the ATP7A protein. This image is interactive. Click on the image to view other mutations found in ATP7A (red). Click on the mutations for more specific information.   
The Tigrou mutation causes protein truncation prior to the fifth MBD (Figure 2).  It is unknown whether any levels of the truncated ATP7A protein exist in mice.
 
Please see the record for Tigrou-like for information about Atp7a.
Putative Mechanism

The Tigrou mutation results in protein truncation prior to the fifth N-terminal copper-binding domain.  This would result in a severely truncated protein missing all of the transmembrane domains, the catalytic domains, as well as known targeting domains. The only intact domains remaining are four of the N-terminal binding domains.  The Tigrou mutation should produce a completely non-functional protein that is unable to localize appropriately and should be readily degraded.  However, it is unknown whether any levels of the truncated protein exist or where the mutant protein localizes.  It has been shown in mice that complete ATP7A deficiency invariably results in prenatal lethality (2-4).  Since Tigrou males can survive up to 20 days after birth, this suggests some level of ATP7A function remains in these animals although genetic background cannot be discounted from contributing to the different phenotypes seen in Atp7a mutant mice.   

 

Several human ATP7A nonsense mutations have been identified that occur approximately in the same region as the Tigrou mouse mutation (5;6).  Human males carrying these mutations exhibit severe MD suggesting that truncation of the protein in this region results in non-functional ATP7A.  However, at least one patient carrying a nonsense mutation in ATP7A was found expressing two transcripts; a normal size transcript carrying the mutation, and a smaller transcript with the mutated exon spliced out (7).  If a similar process occurs in Tigrou animals, the removal of exon 5 leads to an otherwise normally translated protein.  Although exon 5 encodes the potentially critical MBD5 (8;9), it is possible that MBD6 and/or the other MBDs may be able to compensate for lack of MBD5 leading to a functional or partially functional protein.  

 

The striped pattern in heterozygous females caused by the Tigrou mutation is a result of random X-inactivation early during embryonic development and use of wild-type or mutant ATP7A in various cells and their clonal populations (10).  As functional ATP7A is critical for tyrosinase activity, loss of tyrosinase activity in melanocytes will result in pigmentation defects (please see the record for ghost).
Genotyping
Tigrou genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Tig(F): 5’- TGATGCCAGGGTACAAATTGTCAGC -3’
Tig(R): 5’- GGTTAGGGCAGCCTAAGTACCAAAC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Tig_seq(F): 5’- GCACAAGAACTGTCTAGTAACTG -3’
Tig_seq(R): 5’- CTAGGCAACTTGGATCTTACAAGG -3’
 
The following sequence of 1173 nucleotides (from Genbank genomic region NC_000086 for linear DNA sequence of Atp7a) is amplified:
 
60664    tgatgcc agggtacaaa ttgtcagcat gataaggcta gttaaataca agcacaagaa
60721 ctgtctagta actggttatt ttctactcgg ggttgggttt ggagataata gctagaagaa
60781 tctgacataa ctaaattttt tgtactcact tgagtcagat tttcttggga cccccctgag
60841 gtggacagta aagaaattca aagtcagtgt tgggaatggg taataacaat atatttgttg
60901 agagctttta ggaccttgct gattttatag aaatgcattg gcaggcctag aggtgtggct
60961 gtgacttttg acaaggtgta agctagagaa taaatgaaaa gaacctttct ctctccagca
61021 gacatgaaag agccactggt agtgatagct cagccctcac tggaaacacc tcttttgccc
61081 tcaagtaatg agctagaaaa tgtgatgacg tcagttcaga acaagtgtta catacaggtc
61141 tctgggatga cctgtgcttc ttgtgtagca aacattgaac gcaatttaag acgagaagaa
61201 ggtaagtgtt gttattttta tgtcccttat ttccagattc tgtccaatct gtgttttatg
61261 gccatgcttt gaagtctttc caaggcttcc ttcccaaaga tcatccttga tgaacaatac
61321 atccctgaat ttctggaagt ttttaattag tgttatttct tttacaatcc cattttagtg
61381 ccagtgaaat ctactaaaaa gtttatagca gaaggaaata catagcatta ctattatgag
61441 ccatggctat aatagccttt aagaaactaa attttttgtt aaagctgttt taaaaagtga
61501 taatgaataa gttaggtatt gtcttatcta gattaaacag cagagccaaa ccatatttgt
61561 gtagaattat attgtctcct ctagcagttt gacctctgat ctttccttgt aagatccaag
61621 ttgcctagta ctgtgtattt taacttcagg ttacaaaatc tttgaaaatc aacaccactg
61681 tttttctgta gttgctcaaa tgttttagtc tataaattta tatacatttt ataggtatat
61741 caataatata gcatagtacc ttagttaacc gtataaatat atgattatgt ttaatgagac
61801 caaagtctta agtttggtac ttaggctgcc ctaacc                                                    
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsSophie Rutschmann, Xiao-hong Li, Bruce Beutler.
Edit History
08/03/2011 3:36 PM (current)
08/03/2011 3:32 PM
01/07/2011 9:53 AM
09/09/2010 2:59 PM
09/09/2010 2:58 PM
02/25/2010 2:42 PM