Phenotypic Mutation 'horton' (pdf version)
Allelehorton
Mutation Type missense
Chromosome11
Coordinate80,674,708 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Myo1d
Gene Name myosin ID
Synonym(s) 9930104H07Rik, D11Ertd9e
Chromosomal Location 80,482,126-80,780,025 bp (-)
Accession Number

NCBI RefSeq: NM_177390; MGI:107728

MappedYes 
Amino Acid Change Asparagine changed to Isoleucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000037819] [ENSMUSP00000066948]
AlphaFold Q5SYD0
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: N401I

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000041065)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: N401I

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000070997)
Meta Mutation Damage Score 0.9746 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10
DSS: sensitive day 7
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.955; ML prob: 0.932; human score: 4
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All alleles(6) : Targeted(5) Gene trapped(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
R8474:Myo1d UTSW 11 80670919 missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80684379 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80674932 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80676932 missense probably benign 0.30
R8823:Myo1d UTSW 11 80601745 missense possibly damaging 0.91
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, gDNA
Repository
Last Updated 2018-10-11 1:57 PM by Anne Murray
Record Created 2013-07-27 12:21 PM by Emre Turer
Record Posted 2018-10-11
Other Mutations in This Stock Stock #: S25812 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S26312 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S27738 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S27739 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S27740 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S27741 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S27742 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S27730 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S25811 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S26371 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S24766 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity

Stock #: S25810 Run Code: HSQ01112
Coding Region Coverage: 10x: 0.0% 20x: 0.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
Phenotypic Description

Figure 1. Horton mice exhibited weight loss after 7 days of treatment with DSS. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Non-hematopoietic defects contribute to colitis. Bone marrow chimeras were generated, and percent initial weight were determined after 1.4% DSS administration (n=5 for all groups). Figure adapted from (1).

The horton phenotype was identified among G3 mice of the pedigree R0244, some of which showed susceptibility to dextran sulfate sodium (DSS)-induced colitis. The mice exhibited weight loss on day seven after exposure to 1.3 to 1.5% DSS (Figure 1) (1).

 

Bone marrow chimeric mice were generated to assess whether intestinal homeostasis was impaired through effects on the gastrointestinal epithelium or the hematopoietic compartment. After DSS treatment, chimeric CD45.1 mice with horton hematopoietic cells did not lose weight (Figure 2). In contrast, chimeric horton recipient mice were not protected from DSS irrespective of donor bone marrow; the recipient mice lost 25% of their initial body weights by day eight of DSS administration (1) (Figure 2).

Nature of Mutation
Figure 3. Linkage mapping of the reduced body weight at day 10 of the DSS-induced colitis screen using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 91 mutations (X-axis) identified in the G1 male of pedigree R0244.  Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 91 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Myo1d: an A to T transversion at base pair 80,674,708 (v38) on chromosome 11, or base pair 105,348 in the GenBank genomic region NC_000077 encoding Myo1d.  The strongest association was found with a recessive model of linkage to the DSS-induced weight loss at day 7, wherein 3 affected variant homozygotes departed phenotypically from 4 homozygous reference mice and 11 heterozygous mice with a P value of 2.832 x 10-6 (Figure 3). The mutation corresponds to residue 1,435 in the mRNA sequence NM_177390 within exon 10 of 22 total exons.

 

1422 CAGTTCTGCATTAACTACTGCAACGAG

397  -Q--F--C--I--N--Y--C--N--E-

 

The mutated nucleotide is indicated in red.  The mutation results in an asparagine (N) to isoleucine (I) substitution at amino acid 401 in the Myo1d protein, and is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 1.00).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 4. Domain structure of myosin 1D.  The head domain contains the actin-binding (not shown) and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains two calmodulin binding IQ motifs.  The C-terminal half of myosin 1D consists of tail homology-1 (TH1) domain. The horton mutation is an asparagine (N) to isoleucine (I) substitution at amino acid 401 (red asterisk). This image is interactive. Click on the image to view another mutation found in Myo1d (red). Click on the mutations for more specific information.

Myo1d encodes myosin 1D (MYO1D; alternatively, Myr4), a member of the class I family of unconventional myosins. The single-headed class I myosins share similar protein domains and are defined by a monomeric heavy chain. MYO1D has a highly conserved head (motor) domain (amino acids 1-699) that contains ATP- and F-actin-binding sites, two IQ motifs (IQ1, amino acids 700-721; IQ2, amino acids 722-743), and a ­C-terminal tail homology-1 (TH1) domain (amino acids 763-1006) (Figure 4) (2-4). The MYO1D domains are described in more detail, below.

 

The α-helical IQ motifs (IQXXXRGXXXR/K, where X is any amino acid) function as a rigid mechanical lever that rotates by ~90° during the working stroke (5). The IQ motifs bind the calcium-binding protein calmodulin (CaM) and EF-hand calcium-binding proteins (3;4;6). The association of CaM with the MYO1D IQ motifs are predicted to stabilize the IQ motifs (7;8). CaM contains four calcium-binding sites, one pair within the N-terminal lobe binds with lower affinity, while the other pair within the C-terminal lobe binds calcium with higher affinity (9). The N-terminal portions of the IQ1 (LQKVWR) and IQ2 (IIRYYR) motifs putatively bind the CaM C-terminal lobe in a semi-open conformation; calcium binding induces a switch to an open conformation that inhibits the actin-activated ATPase activity of MYO1D (3). The MYO1D IQ motifs bound CaM differentially in the presence of calcium in a CaM-binding assay using recombinant MYO1D IQ1 or IQ2 constructs expressed in E. coli (2). IQ1 weakly bound CaM in the presence of free calcium, but strongly in the absence of calcium (2). In contrast, IQ2 strongly bound CaM in the presence of free calcium, but weakly in the absence of free calcium (2). However, additional studies using recombinant MYO1D constructs expressed in HeLa cells showed that IQ1 had high affinity for CaM in both the absence and presence of free calcium, while IQ2 bound CaM more tightly in the presence of free calcium (3). Calcium binding to the IQ1-associated CaM inhibited actin-activated ATPase activity by ~75% (3). In addition, deletion of IQ1 inhibited the actin-activated ATPase activity upon binding of calcium to the IQ2-associated CaM (3).

 

Four BBXB (B, Arg or Lys (basic amino acids); X, any residue) motifs overlap the IQ motifs (2). The BBXB motif is often found in members of the CC-chemokine family (e.g., RANTES and CCL5) (10;11).  The BBXB motifs in RANTES mediates association with glycosaminoglycans (GAGs) such as heparin sulfate (10). The association of RANTES and GAGs is necessary for efficient leukocyte chemotaxis through the extracellular matrix between confluent endothelial cells (11). The function of the BBXB motifs in MYO1D is unknown.

 

The TH1 domain of class I myosins mediates myosin dimerization, targets each myosin to its subcellular location, binds directly to acidic phospholipids, and specifies the function(s) of a myosin (e.g., cargo binding and enzymatic activities) (4;12). The TH1 domain of MYO1D is enriched in basic and hydrophibic amino acids similar to other class I myosins (2). The lipid-binding function of the class I myosins facilitates the association of myosins with the smooth endoplasmic reticulum (SER) and axolemma, but not to membranous organelles (2;13;14). In addition, it may function in the transport of specific vesicles during cargo trafficking in epithelial (or other polarized) cells or in the generation of specific lipid domains within membranes (15;16). The TH1 domain of MYO1D associates with the C-terminus of aspartoacylase (17). Aspartoacylase catabolizes N-acetylaspartic acid (NAA) to produce acetate and aspartate in the kidney, small intestine, and brain (18). In the brain, the production and subsequent breakdown of NAA maintains the white matter, including the making of lipids that produce myelin. Aspartoacylase is a scavenger of NAA in other tissues. Mutations in aspartoacylase are linked to leukodystrophy (i.e., degeneration of the white matter of the brain) (19). The targeting of MYO1D to apical microvilli requires both the IQ and TH1 domains; however, neither is sufficient for the proper targeting of MYO1D (20).

 

The horton mutation (N401) is within the head domain of MYO1D.

Expression/Localization

MYO1D was detected in all human tissues tested by RT-PCR, with highest expression in the brain and lower levels in spleen, lung, and ovary (21).

 

In the rat, MYO1D is expressed in the cerebral cortex, brainstem, cerebellum, spinal cord, sciatic nerve, oligodendrocytes, and lower levels in lung, kidney, spleen, liver, testis, and heart muscle (2;13). Northern blot analysis determined that rat Myo1d is also expressed abundantly in the intestine (2). In the rat cortex and thalamus, MYO1D localized in the cell bodies and apical dendrites (2).

 

In the mouse cerebellum, MYO1D localized specifically to neurons with punctate distribution along axons and in cell bodies (17). At postnatal day (P) 3 (prior to myelination), mouse MYO1D localized in the Purkinje and granule cell layers of the cerebellum and in the region of the deep nulcei; MYO1D is not present in the molecular cell layer, indicating that MYO1D is not within all neural cell types (17). MYO1D is broadly expressed throughout the whole mouse brain at P7 (after the onset of myelination), with enrichment in the cerebellar Purkinje cell layer and the site of hippocampal formation (17). At P7, mouse MYO1D localized along tracts that co-label with markers for myelin and localization was maintained in the Purkinje cell layer and the apex of the cerebellar lobules of the granule cell layer (17). Within the cerebellar nuclei, MYO1D was cytosolic in cell bodies and localized along process and axon tracts as well as along Purkinje dendrites (17). During axon repair (regrowth) after injury in rats, Myo1d mRNA expression increased in spinal motor neurons (13). In addition, newly synthesized MYO1D was transported to the cytoplasmic surfaces of the SER and the axolemma in the axon by the slow component of axonal transport (13). In mouse enterocytes, MYO1D localized to the basolateral membrane, the brush border terminal web along the full length of villi throughout the small intestine, and the tips of microvilli mostly along the distal half of the villus (20). MYO1D puncta appeared at the distal tips of core actin bundles (20).

 

In Madin–Darby Canine Kidney (MDCK) cells, MYO1D localized to recycling endosomes in the supranuclear region underneath the apical plasma membrane and extends towards the basolateral sorting endosomes along the lateral plasma membrane (16).

Background

Figure 5. Myosin ATP hydrolysis cycle and movement along actin. Unbound myosin is attached to actin in a rigor state. (A) ATP binds to a cleft in the myosin head causing a slight conformational chane in the actin-binding site and consequent release of the actin filament. (B) Upon ATP hydrolysis, the myosin head with ADP and Pi still bound, moves into the "cocked" pre-stroke state and binds relatively weakly to a new site on the filament. (C) This binding causes Pi to be released, resulting in a transition from a weak to a strong actin-binding state that riggers the powerstroke (D), during which ADP is released and myosin returns to its original conformation attached to actin in a rigor state. Click on the image to view an animation of the myosin movement cycle.

Myosins are molecular motors that use the energy of ATP hydrolysis to generate mechanical force along actin filaments (Figure 5). Class I myosins function at the actin/membrane interface (12) in several tissues including the intestinal epithelia (myosin-1a) (22), auditory and vestibular epithelia (myosin-1c) (23;24), kidney (myosin-1e) (25), immune cells (myosins-1f and -1g) (26;27), and neurons (MYO1D) (2;13).  Class I myosins directly control the mechanical properties of the cell membrane (i.e., tension) by mediating membrane/cytoskeleton adhesion (28). Membrane tension regulates cellular processes including endocytosis, exocytosis, membrane repair, cell motility, and cell spreading (28). Please see the records for new gray (Myo5a), mayday circler (Myo6) and parker (Myo15) for more functional information about myosins. Additional functions of MYO1D are discussed below.

 

MYO1D, along with CaM and F-actin, functions in apical or basolateral vesicle transport in MDCK cells; anti-Myo1d antibodies inhibited the transfer from apical or basolateral early endosomes to recycling endosomes (16).  Whether Myo1d functions as a motor protein to move vesicles along the F-actin, or whether MYO1D anchors endosomal membrane domains on actin filaments is unknown (16).

 

MYO1D functions in the movement of cytosolic materials from the axon tip to the nerve cell body (i.e., retrograde slow axonal transport) (13). Myo1d is upregulated during oligodendrocyte maturation (29;30) and MYO1D is an enriched component of the myelin proteome (31;32), indicating that MYO1D functions in neurodevelopment and myelination (17). In Purkinje cells, association of MYO1D with aspartoacylase may alter aspartoacylase activity (17). Alternatively, during the extension of myelin-rich processes in Schwann cells, MYO1D may facilitate the deformation of Schwann cell membranes (17).

 

The Drosophila homolog of Myo1d, Myo31DF, functions in left-right asymmetry determination and Myo31DF mutants Myo31DFsouther and Myo31DFL152 exhibited situs inversus of the gut and testes (33;34). In a Myo31DF knockout fly model, Myo31DFsouther, MYO1D overexpression using UAS-Myo31DF driven by byn-Gal4 specifically in the hindgut and posterior midgut primordium at stage 8 rescued the left-right defects observed in the mutant flies (33). In addition, Myo31DF expression specifically in the hindgut epithelium (via NP2432-driven expression of Myo31DF) was sufficient to rescue the mutant phenotype, indicating that Myo31DF is required in the hindgut epithelium for proper left-right asymmetry (33). Overexpression of Myo31DF in the whole Dropsophila embryo resulted in development of a mirror image of the foregut compared to the wild-type fly; other parts of the gut were normal. Myo31DF putatively functions to reverse foregut handedness, but it is not involved in the left-right asymmetrical development of the foregut in the wild-type embryo (33). The role of MYO1D in vertebrate left-right asymmetrical gut patterning has not been studied.

Putative Mechanism
Figure 6. Myosin 1D functions in actin and lipid binding. Representative images of FLAG-MYO1D bound to a lipid-coated strip membrane. FLAG alone bound to lipid-coated strip membrane was used as a negative control. Abbreviations: LPA, lysophosphatidic acid; S1P, sphingosine-1-phosphate; LPC, lysophosphocholine; PI, phosphatidylinositol; PI(3)P, PI-(3)-phosphate; PI(4)P, PI-(4)-phosphate; PI(5)P, PI-(5)-phosphate; PI(3,4)P2, PI-(3,4-) bisphosphate; PI(3,5)P2, PI-(3,5)-bisphosphate; PI(4,5)P2, PI-(4,5)-bisphosphate; PIP(3,4,5)P3, PI-(3,4,5)-trisphosphate; PA, phosphatidic acid; PE, phosphatidylethanolamine; PS, phosphatidylserine; PC, phosphatidylcholine. Figure adapted from (1).

The apical brush border of the intestinal epithelial cells lining the small intestine is comprised of tightly packed microvilli (20). A core actin bundle and associated actin-binding proteins are essential to maintain the stability of each microvillus (20). Myosin-1a (MYO1A) connects the microvillar membrane to the actin bundle underneath (35-37). Myosins from classes I, II, V, VI, and VII also target to the actin-rich domain in the brush border (38;39). MYO1A has several functions within the enterocyte, including the organization of apical membrane domains (40), controlling apical membrane tension (28), and the shedding of vesicles from the tips of the microvilli (41). Myo1a (Myo1a-/-) knockout mice exhibited apical membrane herniations in some enterocyte brush borders and defects in the brush border membrane composition (42); the Myo1a-/- mice exhibited no noticeable physiological symptoms indicating that other myosins compensated for loss of MYO1A. In the wild-type microvillus, MYO1A is excluded from the distal tip compartment where MYO1D localized, indicating that MYO1A and MYO1D have different functions within the microvillus (20). In Myo1a-/- mice, the levels of MYO1D in the brush border were upregulated and redistributed along the length of the microvillus (20). The redistribution of MYO1D upon the loss of MYO1A indicates that MYO1D can compensate for the function of MYO1A in the brush border (20). MYO1D putatively functions in the early stages of vesicle formation at the tips of the microvilli and that MYO1D redistribution upon loss of Myo1a expression indicates that MYO1D and MYO1A may compete for a shared binding site within the microvillus (20). MYO1D localization to the terminal web, a filamentous structure at the apical surface of epithelial cells that possess microvilli, indicates that MYO1D may function in the short-range transport, docking, and/or fusion of apically directed Golgi-derived vesicles (43). MYO1D at the tips of the microvilli may function to control actin dynamics or to transport components along the microvillar axis (20). MYO1D may also function in the formation and/or release of vesicles from the microvillar tips (44). MYO1D putatively mediates trafficking of adhesion molecules to the basolateral membrane. The adhesion molecules are necessary for the integrity of adherens and tight junctions. MYO1D binds to phosphatidylinositol 4,5-bisphosphate (PIP2) or phosphatidylinositol (3,4,5)-trisphosphate (PIP3) and to filamentous actin in intestinal epithelial cells (Figure 6) (1).

Primers PCR Primer
horton_pcr_F: AACTTTGAGCGATGCTACCCTCTG
horton_pcr_R: CGAGGTCAAGAACTATGACACCACG

Sequencing Primer
horton_seq_F: CGATGCTACCCTCTGATAGATAAAC
horton_seq_R: TATGACACCACGATACATGGG
Genotyping

Horton genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Horton(F): 5’- AACTTTGAGCGATGCTACCCTCTG-3’

Horton(R): 5’- CGAGGTCAAGAACTATGACACCACG-3’

 

Sequencing Primer

Horton_seq(F): 5’- CGATGCTACCCTCTGATAGATAAAC-3’
 

Horton_seq(F): 5’- TATGACACCACGATACATGGG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 409 nucleotides is amplified (Chr.11: 80674501-80674909, GRCm38):

 

aactttgagc gatgctaccc tctgatagat aaacatcaat gaggaagccg cagaggtcag         

aaggtctgct aaggtgggca gcacagggag ttgctcccca ggacggcact cacgtgtttc      

caagggatgc cctcccgctg gtactcctct tgctcctgct tcagcaccag ctgaatgaag      

agctgctgca gtttctcgtt gcagtagtta atgcagaact gctcaaagct acaggagaca      

gaaaatgtta ggataaacaa acaaacaaac aaacaaaacc caagcagtag gattttcaat      

atcctatcca gtttacctgt tgttgtcaaa gatttcaaag ccatagatat ccaagacacc      

aataaccgtg tttttcccat gtatcgtggt gtcatagttc ttgacctcg

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (T>A, Chr. (+) strand; A>T, sense strand).

References
  1. McAlpine, W., Wang, K., Choi, J. H., Miguel, M. S., McAlpine, S. G., Li, X., Tang, M., Zhan, X., Wang, T., Bu, C. H., Murray, A. R., Moresco, E. M. Y., Turer, E. E., and Beutler, B. (2018) The Class I Myosine MYO1D Binds to Lipid and Protects Against Coltis. Dis Model Mech. in press.
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsWilliam McAlpine, Emre Turer, and Bruce Beutler