Phenotypic Mutation 'horton'

• Allele: horton
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 80,565,534 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Myo1d
• Gene Name: myosin ID
• Synonym(s): D11Ertd9e, 9930104H07Rik
• Chromosomal Location: 80,372,952-80,670,851 bp (-) (GRCm39)
• Mapped: Yes
• Amino Acid Change: Asparagine changed to Isoleucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000037819] [ENSMUSP00000066948]
• AlphaFold: Q5SYD0
• SMART Domains: Protein: ENSMUSP00000037819; Gene: ENSMUSG00000035441; AA Change: N401I

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000041065)
• SMART Domains: Protein: ENSMUSP00000066948; Gene: ENSMUSG00000035441; AA Change: N401I

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	802	913	1.8e-26	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000070997)
• Meta Mutation Damage Score: 0.9746
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, gDNA
• Last Updated: 2018-10-11 1:57 PM by Anne Murray
• Record Created: 2013-07-27 12:21 PM by Emre Turer
• Record Posted: 2018-10-11
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: William McAlpine, Emre Turer, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_177390; MGI:107728

Alleles Listed at MGI

All alleles(6) : Targeted(5) Gene trapped(1)

Phenotypic Description

Figure 1. Horton mice exhibited weight loss after 7 days of treatment with DSS. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Non-hematopoietic defects contribute to colitis. Bone marrow chimeras were generated, and percent initial weight were determined after 1.4% DSS administration ( n =5 for all groups). Figure adapted from ( 1 ) .

The horton phenotype was identified among G3 mice of the pedigree R0244, some of which showed susceptibility to dextran sulfate sodium (DSS)-induced colitis. The mice exhibited weight loss on day seven after exposure to 1.3 to 1.5% DSS (Figure 1) (1).

Bone marrow chimeric mice were generated to assess whether intestinal homeostasis was impaired through effects on the gastrointestinal epithelium or the hematopoietic compartment. After DSS treatment, chimeric CD45.1 mice with horton hematopoietic cells did not lose weight (Figure 2). In contrast, chimeric horton recipient mice were not protected from DSS irrespective of donor bone marrow; the recipient mice lost 25% of their initial body weights by day eight of DSS administration (1) (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced body weight at day 10 of the DSS-induced colitis screen using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 91 mutations (X-axis) identified in the G1 male of pedigree R0244. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction , respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 91 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Myo1d: an A to T transversion at base pair 80,674,708 (v38) on chromosome 11, or base pair 105,348 in the GenBank genomic region NC_000077 encoding Myo1d.  The strongest association was found with a recessive model of linkage to the DSS-induced weight loss at day 7, wherein 3 affected variant homozygotes departed phenotypically from 4 homozygous reference mice and 11 heterozygous mice with a P value of 2.832 x 10^-6 (Figure 3). The mutation corresponds to residue 1,435 in the mRNA sequence NM_177390 within exon 10 of 22 total exons.

1422 CAGTTCTGCATTAACTACTGCAACGAG 397  -Q--F--C--I--N--Y--C--N--E-

The mutated nucleotide is indicated in red.  The mutation results in an asparagine (N) to isoleucine (I) substitution at amino acid 401 in the Myo1d protein, and is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 1.00).

Protein Prediction

Figure 4. Domain structure of myosin 1D.  The head domain contains the actin-binding (not shown) and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains two calmodulin binding IQ motifs.  The C-terminal half of myosin 1D consists of tail homology-1 (TH1) domain. The horton mutation is an asparagine (N) to isoleucine (I) substitution at amino acid 401 (red asterisk). This image is interactive. Click on the image to view another mutation found in Myo1d (red). Click on the mutations for more specific information.

Myo1d encodes myosin 1D (MYO1D; alternatively, Myr4), a member of the class I family of unconventional myosins. The single-headed class I myosins share similar protein domains and are defined by a monomeric heavy chain. MYO1D has a highly conserved head (motor) domain (amino acids 1-699) that contains ATP- and F-actin-binding sites, two IQ motifs (IQ1, amino acids 700-721; IQ2, amino acids 722-743), and a ­C-terminal tail homology-1 (TH1) domain (amino acids 763-1006) (Figure 4) (2-4). The MYO1D domains are described in more detail, below.

The α-helical IQ motifs (IQXXXRGXXXR/K, where X is any amino acid) function as a rigid mechanical lever that rotates by ~90° during the working stroke (5). The IQ motifs bind the calcium-binding protein calmodulin (CaM) and EF-hand calcium-binding proteins (3;4;6). The association of CaM with the MYO1D IQ motifs are predicted to stabilize the IQ motifs (7;8). CaM contains four calcium-binding sites, one pair within the N-terminal lobe binds with lower affinity, while the other pair within the C-terminal lobe binds calcium with higher affinity (9). The N-terminal portions of the IQ1 (LQKVWR) and IQ2 (IIRYYR) motifs putatively bind the CaM C-terminal lobe in a semi-open conformation; calcium binding induces a switch to an open conformation that inhibits the actin-activated ATPase activity of MYO1D (3). The MYO1D IQ motifs bound CaM differentially in the presence of calcium in a CaM-binding assay using recombinant MYO1D IQ1 or IQ2 constructs expressed in E. coli (2). IQ1 weakly bound CaM in the presence of free calcium, but strongly in the absence of calcium (2). In contrast, IQ2 strongly bound CaM in the presence of free calcium, but weakly in the absence of free calcium (2). However, additional studies using recombinant MYO1D constructs expressed in HeLa cells showed that IQ1 had high affinity for CaM in both the absence and presence of free calcium, while IQ2 bound CaM more tightly in the presence of free calcium (3). Calcium binding to the IQ1-associated CaM inhibited actin-activated ATPase activity by ~75% (3). In addition, deletion of IQ1 inhibited the actin-activated ATPase activity upon binding of calcium to the IQ2-associated CaM (3).

Four BBXB (B, Arg or Lys (basic amino acids); X, any residue) motifs overlap the IQ motifs (2). The BBXB motif is often found in members of the CC-chemokine family (e.g., RANTES and CCL5) (10;11).  The BBXB motifs in RANTES mediates association with glycosaminoglycans (GAGs) such as heparin sulfate (10). The association of RANTES and GAGs is necessary for efficient leukocyte chemotaxis through the extracellular matrix between confluent endothelial cells (11). The function of the BBXB motifs in MYO1D is unknown.

The TH1 domain of class I myosins mediates myosin dimerization, targets each myosin to its subcellular location, binds directly to acidic phospholipids, and specifies the function(s) of a myosin (e.g., cargo binding and enzymatic activities) (4;12). The TH1 domain of MYO1D is enriched in basic and hydrophibic amino acids similar to other class I myosins (2). The lipid-binding function of the class I myosins facilitates the association of myosins with the smooth endoplasmic reticulum (SER) and axolemma, but not to membranous organelles (2;13;14). In addition, it may function in the transport of specific vesicles during cargo trafficking in epithelial (or other polarized) cells or in the generation of specific lipid domains within membranes (15;16). The TH1 domain of MYO1D associates with the C-terminus of aspartoacylase (17). Aspartoacylase catabolizes N-acetylaspartic acid (NAA) to produce acetate and aspartate in the kidney, small intestine, and brain (18). In the brain, the production and subsequent breakdown of NAA maintains the white matter, including the making of lipids that produce myelin. Aspartoacylase is a scavenger of NAA in other tissues. Mutations in aspartoacylase are linked to leukodystrophy (i.e., degeneration of the white matter of the brain) (19). The targeting of MYO1D to apical microvilli requires both the IQ and TH1 domains; however, neither is sufficient for the proper targeting of MYO1D (20).

The horton mutation (N401) is within the head domain of MYO1D.

Expression/Localization

MYO1D was detected in all human tissues tested by RT-PCR, with highest expression in the brain and lower levels in spleen, lung, and ovary (21).

In the rat, MYO1D is expressed in the cerebral cortex, brainstem, cerebellum, spinal cord, sciatic nerve, oligodendrocytes, and lower levels in lung, kidney, spleen, liver, testis, and heart muscle (2;13). Northern blot analysis determined that rat Myo1d is also expressed abundantly in the intestine (2). In the rat cortex and thalamus, MYO1D localized in the cell bodies and apical dendrites (2).

In the mouse cerebellum, MYO1D localized specifically to neurons with punctate distribution along axons and in cell bodies (17). At postnatal day (P) 3 (prior to myelination), mouse MYO1D localized in the Purkinje and granule cell layers of the cerebellum and in the region of the deep nulcei; MYO1D is not present in the molecular cell layer, indicating that MYO1D is not within all neural cell types (17). MYO1D is broadly expressed throughout the whole mouse brain at P7 (after the onset of myelination), with enrichment in the cerebellar Purkinje cell layer and the site of hippocampal formation (17). At P7, mouse MYO1D localized along tracts that co-label with markers for myelin and localization was maintained in the Purkinje cell layer and the apex of the cerebellar lobules of the granule cell layer (17). Within the cerebellar nuclei, MYO1D was cytosolic in cell bodies and localized along process and axon tracts as well as along Purkinje dendrites (17). During axon repair (regrowth) after injury in rats, Myo1d mRNA expression increased in spinal motor neurons (13). In addition, newly synthesized MYO1D was transported to the cytoplasmic surfaces of the SER and the axolemma in the axon by the slow component of axonal transport (13). In mouse enterocytes, MYO1D localized to the basolateral membrane, the brush border terminal web along the full length of villi throughout the small intestine, and the tips of microvilli mostly along the distal half of the villus (20). MYO1D puncta appeared at the distal tips of core actin bundles (20).

In Madin–Darby Canine Kidney (MDCK) cells, MYO1D localized to recycling endosomes in the supranuclear region underneath the apical plasma membrane and extends towards the basolateral sorting endosomes along the lateral plasma membrane (16).

Background

Figure 5. Myosin ATP hydrolysis cycle and movement along actin. Unbound myosin is attached to actin in a rigor state. (A) ATP binds to a cleft in the myosin head causing a slight conformational chane in the actin-binding site and consequent release of the actin filament. (B) Upon ATP hydrolysis, the myosin head with ADP and P_i still bound, moves into the "cocked" pre-stroke state and binds relatively weakly to a new site on the filament. (C) This binding causes P_i to be released, resulting in a transition from a weak to a strong actin-binding state that riggers the powerstroke (D), during which ADP is released and myosin returns to its original conformation attached to actin in a rigor state. Click on the image to view an animation of the myosin movement cycle.

Myosins are molecular motors that use the energy of ATP hydrolysis to generate mechanical force along actin filaments (Figure 5). Class I myosins function at the actin/membrane interface (12) in several tissues including the intestinal epithelia (myosin-1a) (22), auditory and vestibular epithelia (myosin-1c) (23;24), kidney (myosin-1e) (25), immune cells (myosins-1f and -1g) (26;27), and neurons (MYO1D) (2;13).  Class I myosins directly control the mechanical properties of the cell membrane (i.e., tension) by mediating membrane/cytoskeleton adhesion (28). Membrane tension regulates cellular processes including endocytosis, exocytosis, membrane repair, cell motility, and cell spreading (28). Please see the records for new gray (Myo5a), mayday circler (Myo6) and parker (Myo15) for more functional information about myosins. Additional functions of MYO1D are discussed below.

MYO1D, along with CaM and F-actin, functions in apical or basolateral vesicle transport in MDCK cells; anti-Myo1d antibodies inhibited the transfer from apical or basolateral early endosomes to recycling endosomes (16).  Whether Myo1d functions as a motor protein to move vesicles along the F-actin, or whether MYO1D anchors endosomal membrane domains on actin filaments is unknown (16).

MYO1D functions in the movement of cytosolic materials from the axon tip to the nerve cell body (i.e., retrograde slow axonal transport) (13). Myo1d is upregulated during oligodendrocyte maturation (29;30) and MYO1D is an enriched component of the myelin proteome (31;32), indicating that MYO1D functions in neurodevelopment and myelination (17). In Purkinje cells, association of MYO1D with aspartoacylase may alter aspartoacylase activity (17). Alternatively, during the extension of myelin-rich processes in Schwann cells, MYO1D may facilitate the deformation of Schwann cell membranes (17).

The Drosophila homolog of Myo1d, Myo31DF, functions in left-right asymmetry determination and Myo31DF mutants Myo31DF^souther and Myo31DF^L152 exhibited situs inversus of the gut and testes (33;34). In a Myo31DF knockout fly model, Myo31DF^souther, MYO1D overexpression using UAS-Myo31DF driven by byn-Gal4 specifically in the hindgut and posterior midgut primordium at stage 8 rescued the left-right defects observed in the mutant flies (33). In addition, Myo31DF expression specifically in the hindgut epithelium (via NP2432-driven expression of Myo31DF) was sufficient to rescue the mutant phenotype, indicating that Myo31DF is required in the hindgut epithelium for proper left-right asymmetry (33). Overexpression of Myo31DF in the whole Dropsophila embryo resulted in development of a mirror image of the foregut compared to the wild-type fly; other parts of the gut were normal. Myo31DF putatively functions to reverse foregut handedness, but it is not involved in the left-right asymmetrical development of the foregut in the wild-type embryo (33). The role of MYO1D in vertebrate left-right asymmetrical gut patterning has not been studied.

Putative Mechanism

Figure 6. Myosin 1D functions in actin and lipid binding. Representative images of FLAG-MYO1D bound to a lipid-coated strip membrane. FLAG alone bound to lipid-coated strip membrane was used as a negative control. Abbreviations: LPA, lysophosphatidic acid; S1P, sphingosine-1-phosphate; LPC, lysophosphocholine; PI, phosphatidylinositol; PI(3)P, PI-(3)-phosphate; PI(4)P, PI-(4)-phosphate; PI(5)P, PI-(5)-phosphate; PI(3,4)P 2 , PI-(3,4-) bisphosphate; PI(3,5)P 2 , PI-(3,5)-bisphosphate; PI(4,5)P 2 , PI-(4,5)-bisphosphate; PIP(3,4,5)P 3 , PI-(3,4,5)-trisphosphate; PA, phosphatidic acid; PE, phosphatidylethanolamine; PS, phosphatidylserine; PC, phosphatidylcholine. Figure adapted from ( 1 ) .

The apical brush border of the intestinal epithelial cells lining the small intestine is comprised of tightly packed microvilli (20). A core actin bundle and associated actin-binding proteins are essential to maintain the stability of each microvillus (20). Myosin-1a (MYO1A) connects the microvillar membrane to the actin bundle underneath (35-37). Myosins from classes I, II, V, VI, and VII also target to the actin-rich domain in the brush border (38;39). MYO1A has several functions within the enterocyte, including the organization of apical membrane domains (40), controlling apical membrane tension (28), and the shedding of vesicles from the tips of the microvilli (41). Myo1a (Myo1a^-/-) knockout mice exhibited apical membrane herniations in some enterocyte brush borders and defects in the brush border membrane composition (42); the Myo1a^-/- mice exhibited no noticeable physiological symptoms indicating that other myosins compensated for loss of MYO1A. In the wild-type microvillus, MYO1A is excluded from the distal tip compartment where MYO1D localized, indicating that MYO1A and MYO1D have different functions within the microvillus (20). In Myo1a^-/- mice, the levels of MYO1D in the brush border were upregulated and redistributed along the length of the microvillus (20). The redistribution of MYO1D upon the loss of MYO1A indicates that MYO1D can compensate for the function of MYO1A in the brush border (20). MYO1D putatively functions in the early stages of vesicle formation at the tips of the microvilli and that MYO1D redistribution upon loss of Myo1a expression indicates that MYO1D and MYO1A may compete for a shared binding site within the microvillus (20). MYO1D localization to the terminal web, a filamentous structure at the apical surface of epithelial cells that possess microvilli, indicates that MYO1D may function in the short-range transport, docking, and/or fusion of apically directed Golgi-derived vesicles (43). MYO1D at the tips of the microvilli may function to control actin dynamics or to transport components along the microvillar axis (20). MYO1D may also function in the formation and/or release of vesicles from the microvillar tips (44). MYO1D putatively mediates trafficking of adhesion molecules to the basolateral membrane. The adhesion molecules are necessary for the integrity of adherens and tight junctions. MYO1D binds to phosphatidylinositol 4,5-bisphosphate (PIP₂) or phosphatidylinositol (3,4,5)-trisphosphate (PIP₃) and to filamentous actin in intestinal epithelial cells (Figure 6) (1).

Primers

PCR Primer
horton_pcr_F: AACTTTGAGCGATGCTACCCTCTG
horton_pcr_R: CGAGGTCAAGAACTATGACACCACG

Sequencing Primer
horton_seq_F: CGATGCTACCCTCTGATAGATAAAC
horton_seq_R: TATGACACCACGATACATGGG

Genotyping

Horton genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Horton(F): 5’- AACTTTGAGCGATGCTACCCTCTG-3’

Horton(R): 5’- CGAGGTCAAGAACTATGACACCACG-3’

Sequencing Primer

Horton_seq(F): 5’- CGATGCTACCCTCTGATAGATAAAC-3’
 

Horton_seq(F): 5’- TATGACACCACGATACATGGG -3’

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 409 nucleotides is amplified (Chr.11: 80674501-80674909, GRCm38):

aactttgagc gatgctaccc tctgatagat aaacatcaat gaggaagccg cagaggtcag         

aaggtctgct aaggtgggca gcacagggag ttgctcccca ggacggcact cacgtgtttc      

caagggatgc cctcccgctg gtactcctct tgctcctgct tcagcaccag ctgaatgaag      

agctgctgca gtttctcgtt gcagtagtta atgcagaact gctcaaagct acaggagaca      

gaaaatgtta ggataaacaa acaaacaaac aaacaaaacc caagcagtag gattttcaat      

atcctatcca gtttacctgt tgttgtcaaa gatttcaaag ccatagatat ccaagacacc      

aataaccgtg tttttcccat gtatcgtggt gtcatagttc ttgacctcg

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (T>A, Chr. (+) strand; A>T, sense strand).

References

  1. McAlpine, W., Wang, K., Choi, J. H., Miguel, M. S., McAlpine, S. G., Li, X., Tang, M., Zhan, X., Wang, T., Bu, C. H., Murray, A. R., Moresco, E. M. Y., Turer, E. E., and Beutler, B. (2018) The Class I Myosine MYO1D Binds to Lipid and Protects Against Coltis. Dis Model Mech. in press.

  2. Bahler, M., Kroschewski, R., Stoffler, H. E., and Behrmann, T. (1994) Rat Myr 4 Defines a Novel Subclass of Myosin I: Identification, Distribution, Localization, and Mapping of Calmodulin-Binding Sites with Differential Calcium Sensitivity. J Cell Biol. 126, 375-389.

  3. Kohler, D., Struchholz, S., and Bahler, M. (2005) The Two IQ-Motifs and Ca2+/calmodulin Regulate the Rat Myosin 1d ATPase Activity. FEBS J. 272, 2189-2197.

  4. Hasson, T., Skowron, J. F., Gilbert, D. J., Avraham, K. B., Perry, W. L., Bement, W. M., Anderson, B. L., Sherr, E. H., Chen, Z. Y., Greene, L. A., Ward, D. C., Corey, D. P., Mooseker, M. S., Copeland, N. G., and Jenkins, N. A. (1996) Mapping of Unconventional Myosins in Mouse and Human. Genomics. 36, 431-439.

  5. Kohler, D., Ruff, C., Meyhofer, E., and Bahler, M. (2003) Different Degrees of Lever Arm Rotation Control Myosin Step Size. J Cell Biol. 161, 237-241.

  6. Barylko, B., Wagner, M. C., Reizes, O., and Albanesi, J. P. (1992) Purification and Characterization of a Mammalian Myosin I. Proc Natl Acad Sci U S A. 89, 490-494.

  7. Bahler, M., and Rhoads, A. (2002) Calmodulin Signaling Via the IQ Motif. FEBS Lett. 513, 107-113.

  8. Terrak, M., Wu, G., Stafford, W. F., Lu, R. C., and Dominguez, R. (2003) Two Distinct Myosin Light Chain Structures are Induced by Specific Variations within the Bound IQ Motifs-Functional Implications. EMBO J. 22, 362-371.

  9. Linse, S., Helmersson, A., and Forsen, S. (1991) Calcium Binding to Calmodulin and its Globular Domains. J Biol Chem. 266, 8050-8054.

  10. Proudfoot, A. E., Fritchley, S., Borlat, F., Shaw, J. P., Vilbois, F., Zwahlen, C., Trkola, A., Marchant, D., Clapham, P. R., and Wells, T. N. (2001) The BBXB Motif of RANTES is the Principal Site for Heparin Binding and Controls Receptor Selectivity. J Biol Chem. 276, 10620-10626.

  11. Ali, S., Fritchley, S. J., Chaffey, B. T., and Kirby, J. A. (2002) Contribution of the Putative Heparan Sulfate-Binding Motif BBXB of RANTES to Transendothelial Migration. Glycobiology. 12, 535-543.

  12. McConnell, R. E., and Tyska, M. J. (2010) Leveraging the Membrane - Cytoskeleton Interface with Myosin-1. Trends Cell Biol. 20, 418-426.

  13. Lund, L. M., Machado, V. M., and McQuarrie, I. G. (2005) Axonal Isoforms of Myosin-I. Biochem Biophys Res Commun. 330, 857-864.

  14. Adams, R. J., and Pollard, T. D. (1989) Binding of Myosin I to Membrane Lipids. Nature. 340, 565-568.

  15. LeBlanc-Straceski, J. M., Sokac, A., Bement, W., Sobrado, P., and Lemoine, L. (2009) Developmental Expression of Xenopus Myosin 1d and Identification of a myo1d Tail Homology that Overlaps TH1. Dev Growth Differ. 51, 443-451.

  16. Huber, L. A., Fialka, I., Paiha, K., Hunziker, W., Sacks, D. B., Bahler, M., Way, M., Gagescu, R., and Gruenberg, J. (2000) Both Calmodulin and the Unconventional Myosin Myr4 Regulate Membrane Trafficking Along the Recycling Pathway of MDCK Cells. Traffic. 1, 494-503.

  17. Benesh, A. E., Fleming, J. T., Chiang, C., Carter, B. D., and Tyska, M. J. (2012) Expression and Localization of Myosin-1d in the Developing Nervous System. Brain Res. 1440, 9-22.

  18. Kaul, R., Gao, G. P., Balamurugan, K., and Matalon, R. (1993) Cloning of the Human Aspartoacylase cDNA and a Common Missense Mutation in Canavan Disease. Nat Genet. 5, 118-123.

  19. Namboodiri, A. M., Peethambaran, A., Mathew, R., Sambhu, P. A., Hershfield, J., Moffett, J. R., and Madhavarao, C. N. (2006) Canavan Disease and the Role of N-Acetylaspartate in Myelin Synthesis. Mol Cell Endocrinol. 252, 216-223.

  20. Benesh, A. E., Nambiar, R., McConnell, R. E., Mao, S., Tabb, D. L., and Tyska, M. J. (2010) Differential Localization and Dynamics of Class I Myosins in the Enterocyte Microvillus. Mol Biol Cell. 21, 970-978.

  21. Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1998) Prediction of the Coding Sequences of Unidentified Human Genes. XI. the Complete Sequences of 100 New cDNA Clones from Brain which Code for Large Proteins in Vitro. DNA Res. 5, 277-286.

  22. Collins, J. H., and Borysenko, C. W. (1984) The 110,000-Dalton Actin- and Calmodulin-Binding Protein from Intestinal Brush Border is a Myosin-Like ATPase. J Biol Chem. 259, 14128-14135.

  23. Gillespie, P. G., Wagner, M. C., and Hudspeth, A. J. (1993) Identification of a 120 Kd Hair-Bundle Myosin Located Near Stereociliary Tips. Neuron. 11, 581-594.

  24. Hasson, T., Gillespie, P. G., Garcia, J. A., MacDonald, R. B., Zhao, Y., Yee, A. G., Mooseker, M. S., and Corey, D. P. (1997) Unconventional Myosins in Inner-Ear Sensory Epithelia. J Cell Biol. 137, 1287-1307.

  25. Krendel, M., Kim, S. V., Willinger, T., Wang, T., Kashgarian, M., Flavell, R. A., and Mooseker, M. S. (2009) Disruption of Myosin 1e Promotes Podocyte Injury. J Am Soc Nephrol. 20, 86-94.

  26. Kim, S. V., Mehal, W. Z., Dong, X., Heinrich, V., Pypaert, M., Mellman, I., Dembo, M., Mooseker, M. S., Wu, D., and Flavell, R. A. (2006) Modulation of Cell Adhesion and Motility in the Immune System by Myo1f. Science. 314, 136-139.

  27. Olety, B., Walte, M., Honnert, U., Schillers, H., and Bahler, M. (2010) Myosin 1G (Myo1G) is a Haematopoietic Specific Myosin that Localises to the Plasma Membrane and Regulates Cell Elasticity. FEBS Lett. 584, 493-499.

  28. Nambiar, R., McConnell, R. E., and Tyska, M. J. (2009) Control of Cell Membrane Tension by Myosin-I. Proc Natl Acad Sci U S A. 106, 11972-11977.

  29. Cahoy, J. D., Emery, B., Kaushal, A., Foo, L. C., Zamanian, J. L., Christopherson, K. S., Xing, Y., Lubischer, J. L., Krieg, P. A., Krupenko, S. A., Thompson, W. J., and Barres, B. A. (2008) A Transcriptome Database for Astrocytes, Neurons, and Oligodendrocytes: A New Resource for Understanding Brain Development and Function. J Neurosci. 28, 264-278.

  30. Nielsen, J. A., Maric, D., Lau, P., Barker, J. L., and Hudson, L. D. (2006) Identification of a Novel Oligodendrocyte Cell Adhesion Protein using Gene Expression Profiling. J Neurosci. 26, 9881-9891.

  31. Ishii, A., Dutta, R., Wark, G. M., Hwang, S. I., Han, D. K., Trapp, B. D., Pfeiffer, S. E., and Bansal, R. (2009) Human Myelin Proteome and Comparative Analysis with Mouse Myelin. Proc Natl Acad Sci U S A. 106, 14605-14610.

  32. Jahn, O., Tenzer, S., and Werner, H. B. (2009) Myelin Proteomics: Molecular Anatomy of an Insulating Sheath. Mol Neurobiol. 40, 55-72.

  33. Hozumi, S., Maeda, R., Taniguchi, K., Kanai, M., Shirakabe, S., Sasamura, T., Speder, P., Noselli, S., Aigaki, T., Murakami, R., and Matsuno, K. (2006) An Unconventional Myosin in Drosophila Reverses the Default Handedness in Visceral Organs. Nature. 440, 798-802.

  34. Speder, P., Adam, G., and Noselli, S. (2006) Type ID Unconventional Myosin Controls Left-Right Asymmetry in Drosophila. Nature. 440, 803-807.

  35. Mooseker, M. S., and Tilney, L. G. (1975) Organization of an Actin Filament-Membrane Complex. Filament Polarity and Membrane Attachment in the Microvilli of Intestinal Epithelial Cells. J Cell Biol. 67, 725-743.

  36. Matsudaira, P. T., and Burgess, D. R. (1979) Identification and Organization of the Components in the Isolated Microvillus Cytoskeleton. J Cell Biol. 83, 667-673.

  37. Howe, C. L., and Mooseker, M. S. (1983) Characterization of the 110-Kdalton Actin-Calmodulin-, and Membrane-Binding Protein from Microvilli of Intestinal Epithelial Cells. J Cell Biol. 97, 974-985.

  38. Chen, Z. Y., Hasson, T., Zhang, D. S., Schwender, B. J., Derfler, B. H., Mooseker, M. S., and Corey, D. P. (2001) Myosin-VIIb, a Novel Unconventional Myosin, is a Constituent of Microvilli in Transporting Epithelia. Genomics. 72, 285-296.

  39. Heintzelman, M. B., Hasson, T., and Mooseker, M. S. (1994) Multiple Unconventional Myosin Domains of the Intestinal Brush Border Cytoskeleton. J Cell Sci. 107 ( Pt 12), 3535-3543.

  40. Tyska, M. J., and Mooseker, M. S. (2002) MYO1A (Brush Border Myosin I) Dynamics in the Brush Border of LLC-PK1-CL4 Cells. Biophys J. 82, 1869-1883.

  41. McConnell, R. E., Higginbotham, J. N., Shifrin, D. A.,Jr, Tabb, D. L., Coffey, R. J., and Tyska, M. J. (2009) The Enterocyte Microvillus is a Vesicle-Generating Organelle. J Cell Biol. 185, 1285-1298.

  42. Tyska, M. J., Mackey, A. T., Huang, J. D., Copeland, N. G., Jenkins, N. A., and Mooseker, M. S. (2005) Myosin-1a is Critical for Normal Brush Border Structure and Composition. Mol Biol Cell. 16, 2443-2457.

  43. Fath, K. R., and Burgess, D. R. (1993) Golgi-Derived Vesicles from Developing Epithelial Cells Bind Actin Filaments and Possess Myosin-I as a Cytoplasmically Oriented Peripheral Membrane Protein. J Cell Biol. 120, 117-127.

  44. McConnell, R. E., and Tyska, M. J. (2007) Myosin-1a Powers the Sliding of Apical Membrane Along Microvillar Actin Bundles. J Cell Biol. 177, 671-681.