Allele | stromberg | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 129,555,640 bp (GRCm38) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ C (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Lck | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | lymphocyte protein tyrosine kinase | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Hck-3, p56 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 129,548,344-129,573,641 bp (-) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016] PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_001162432, NM_010693, NM_001162433; MGI:96756 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Glutamic Acid changed to Glycine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000066209] [ENSMUSP00000099656] [ENSMUSP00000119263] [ENSMUSP00000125777] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P06240 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000066209 Gene: ENSMUSG00000000409 AA Change: E288G
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000099656 Gene: ENSMUSG00000000409 AA Change: E288G
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000119263 Gene: ENSMUSG00000000409
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000125777 Gene: ENSMUSG00000000409 AA Change: E299G
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9696 ![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) ![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(22) : Targeted(6) Gene trapped(15) Chemically induced(1) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Live Mice | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2018-01-03 4:44 AM by External Program | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2013-08-07 1:38 PM by Emre Turer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2017-02-23 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
he stromberg phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0480, some of which showed an increase in the B:T cell ratio (Figure 1) due to a decreased frequency of total T cells (Figure 2). Some mice also showed a decrease in the CD4+ to CD8+ T cell ratio (Figure 3) caused by a diminished frequency of CD4+ T cells (Figure 4) and CD4+ T cells in CD3+ T cells (Figure 5) coupled with lesser diminution of CD8+ T cells (Figure 6) and an increase in the frequency of CD8+ T cells in CD3+ T cells (Figure 7). CD44 expression was increased on both CD4+ and CD8+ T cells (Figure 8 and 9, respectively). Some mice showed diminished T-dependent IgG responses to both aluminum hydroxide (alum)-emulsified ovalbumin (OVA) (Figure 10) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 11). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 114 mutations. Three mutations (in Ago4, Lck, and Cnr2) shared equal linkage to all of the above anomalies by continuous variable mapping. The mutation in Lck is presumed to be causative as it shares immune phenotypes with other alleles of Lck (see MGI and the record for iconoclast). The Lck mutation is A to G transition at base pair 129,555,640 (v38) on chromosome 4, equivalent to base pair 18,002 in the GenBank genomic region NC_000070 encoding Lck. The strongest association was found with a recessive model of linkage to the normalized T-dependent antibody response to rSFV-β-gal, wherein 10 variant homozygotes departed phenotypically from 8 homozygous reference mice and 16 heterozygous mice with a P value of 3.568 x 10-18 (Figure 12).
The mutation corresponds to residue 953 in the NM_001162432 mRNA sequence in exon 9 of 13 total exons, or at position 995 bp of the NM_001162433 mRNA sequence in exon 9 of 13 total exons, or at position 1,050 of the NM_010693 mRNA sequence in exon 8 of 12 total exons.
Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red lettering and results in a glutamic acid to glycine substitution at position 299 (E299G) in the Lck protein isoform encoded by NM_001162432 and a glutamic acid to glycine substitution at position 288 (E288G) in the Lck protein isoforms encoded by NM_001162433 and NM_010693. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Lck encodes lymphocyte protein tyrosine kinase (Lck), a member of the Src family of nonreceptor tyrosine kinases (Figure 13). The stromberg mutation lies in the N-lobe of the Lck kinase domain (amino acids 238-496), within helix αC [Figure 14; (1-4)]. The effect of the mutation on kinase activity, expression level, or localization has not been tested.
Please see the record iconoclast for information about Lck. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Lck functions in one of the first steps in T cell receptor (TCR) signaling, in which it phosphorylates the immunoreceptor tyrosine-based activation motifs (ITAMS) present on the CD3 heterodimer (CD3εγ or CD3εδ) and CD3ζ chains of the TCR. This event is necessary for the propagation of signals from the TCR. The stromberg mutation lies in the N-lobe of the Lck kinase domain, which may alter the kinase activity. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer stromberg_pcr_F: AGGTAAAAGCGCCTTCCTTCCCTG stromberg_pcr_R: AAAGTTGAGCCGTCCTTGCCAG Sequencing Primer stromberg_seq_F: CAAAAGGTAGTGGGACCACA stromberg_seq_R: TTCCCAGGGAAACACTGAAGTTG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Stromberg genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. PCR Primers Stromberg(F): 5’- AGGTAAAAGCGCCTTCCTTCCCTG-3’ Stromberg(R): 5’- AAAGTTGAGCCGTCCTTGCCAG-3’
Sequencing Primer Stromberg_seq(F): 5’- CAAAAGGTAGTGGGACCACA-3’ Stromberg_seq(R): 5’- TTCCCAGGGAAACACTGAAGTTG -3’
PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40X 6) 72°C 10:00 7) 4°C ∞
The following sequence of 532 nucleotides is amplified (Chr. 4: 129555452- 129555983, GRCm38; NCBI RefSeq NC_000070):
aggtaaaagc gccttccttc cctgggtcca aaaggtagtg ggaccacaat agcgccctca agcggctgga catagcaggg cacccaccgt tctccatgta ttccgtgatg atgtagatgg gttcctgggt gaccactgca taaagccgga ctagccgcgg gtgctgcagc tgcttcatga ggttagcctc agccaggaag gcgtcggggg acatgctccc ttgtttcaga ctcttcaccg ccaccttcgt gtgtccgttg tagtaccctg atggggtacg ggtggagaag ttacagaggt caagatcctg acgaactagg cagccatcct gaataggcca gtgtgagagg aagctcacat tctctctcct ctttccaatc agtcccgagg gtcacactca cccatccaca cttccccgaa ctggccagct cccagccgct ccaccaactt cagtgtttcc ctgggaactt cccattcgtc ctcccaccat ggtttctggg gcttctgggt ctggcaagga cggctcaact tt
Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (T>C, Chr. + strand (shown); A>G, sense strand). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Emre Turer, Kuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler |