Phenotypic Mutation 'Michelin' (pdf version)
List |< first << previous [record 99 of 132] next >> last >|
AlleleMichelin
Mutation Type nonsense
Chromosome11
Coordinate98,637,573 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Gsdma3
Gene Name gasdermin A3
Synonym(s) Gsdm1l, Bsk, Rim3, Dfl, Rco2, Gsdm3, Fgn
Chromosomal Location 98,626,360-98,638,226 bp (+)
MGI Phenotype PHENOTYPE: Mutations of this gene affect normal development of the hair follicle, resulting in abnormal coats. Some alleles are associated with corneal opacity and/or microphthalmia. For one allele, high rates of mutation are observed in the MHC that appear to be associated with intra-MHC recombination. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001007461; MGI: 3044668

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
K366* in Ensembl: ENSMUSP00000073022 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:Gasdermin 3 430 5.3e-127 PFAM
low complexity region 438 452 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
skin/coat/nails
Penetrance Unknown at present 
Alleles Listed at MGI

All alleles(7) : Spontaneous(3) Chemically induced(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Gsdma3 APN 11 98637572 missense probably damaging 0.97
IGL01375:Gsdma3 APN 11 98629941 critical splice donor site probably null
IGL01721:Gsdma3 APN 11 98637956 missense possibly damaging 0.95
IGL02179:Gsdma3 APN 11 98635271 missense possibly damaging 0.88
IGL02612:Gsdma3 APN 11 98635881 missense probably damaging 0.99
IGL02866:Gsdma3 APN 11 98629759 missense possibly damaging 0.88
IGL02970:Gsdma3 APN 11 98632993 missense probably benign 0.01
Mr_magoo UTSW 11 98635919 missense probably damaging 1.00
R0408:Gsdma3 UTSW 11 98635338 missense probably benign 0.41
R0539:Gsdma3 UTSW 11 98635919 missense probably damaging 1.00
R0675:Gsdma3 UTSW 11 98631191 missense probably benign 0.03
R1329:Gsdma3 UTSW 11 98632392 missense probably damaging 1.00
R1759:Gsdma3 UTSW 11 98635245 missense possibly damaging 0.93
R1812:Gsdma3 UTSW 11 98632393 missense probably damaging 0.99
R1838:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R1839:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R2287:Gsdma3 UTSW 11 98638004 missense possibly damaging 0.83
R4883:Gsdma3 UTSW 11 98629567 critical splice donor site probably null
R6767:Gsdma3 UTSW 11 98637884 missense possibly damaging 0.93
Mode of Inheritance Autosomal Semidominant
Local Stock Live Mice, Embryos, Sperm, gDNA
MMRRC Submission 031044-UCD
Last Updated 2017-04-11 4:41 PM by Katherine Timer
Record Created unknown
Record Posted 2009-03-31
Phenotypic Description

The semidominant Michelin mutation was identified in G1 mice derived from N-ethyl-N-nitrosourea (ENU)-mutagenized C57BL/6J stock.  Before three weeks of age, Michelin heterozygotes and homozygotes look very similar to wild type animals with the exception of wrinkled skin under the fur.  As they age, progressive hair loss occurs and the fur appears longer and coarser (Figure 1).  Mutant animals on a C57BL/6J background are completely bare by four months of age except for the persistence of vibrissae and snout hairs.  Hair loss is delayed on a C3H/B6 hybrid background.  The ears appear slightly larger and the eyes smaller than in a normal mouse.  Corneal opacities have been observed in some homozygous animals.

Nature of Mutation
The Michelin mutation was mapped to Chromosome 11, and corresponds to an A to T transversion at position 1178 of the Gsdma3 transcript, in exon 10 of 11 total exons.
 
1163 GTAAAATCCTTGGAGAAAAAGATCTTACCAGTG
361 -V--K--S--L--E--K--K--I--L--P--V-
 

The mutated nucleotide is indicated in red lettering, and creates a premature stop codon at position 366 of the polypeptide chain (normally a lysine), deleting 98 amino acids from the C-terminus of the protein.

Protein Prediction
The Gsdma3 encodes a 464 amino acid protein that has 75% identity with human Gasdermin1 or GSDMA.  In the mouse, Gsdma3 (previously known as Gsdm3) is a member of structurally related gene cluster on Chromosome 11 consisting of three highly homologous genes (1).  An additional cluster of related genes is found on Chromosome 15.  This gene replication has not occurred in the human or rat genomes.  Thus, all three Gsdma genes are considered to be homologous to human GSDMA, which is located on Chromosome 17q12 in a region syntenic to mouse chromosome 11 (2).
 
GasderminA3 (GSDMA3) is a member of a novel family of proteins now known as the gasdermin or GSDM family.  Gsdm genes are not found in amphibians or teleosts (2).  The GSDM proteins contain a novel, roughly conserved region that they share with two proteins that have been shown to be necessary for normal human hearing, DFNA5 (Deafness autosomal dominant nonsyndromic sensorineural 5) and DFNB59 or pejvakin (3;4).  This protein domain is known as the DFNA5-Gasdermin domain (1) and includes most of the protein sequence, excluding the very N-terminus and about 25 amino acids in the C-terminus.  
 

Figure 2. Domain structure of the GSDMA3 protein. GSDMA3 has nine conserved leucine motifs as indicated by the roman numerals. Blue rectangles indicate the three coiled-coil regions with the potential leucine zipper shown in yellow. The gray box indicates a non-conserved amino acid stretch from 227-261. The location of the Michelin truncation is indicated in red. Figure is interactive; click to see another Gsdma3 â€‹mutation.

 
Additionally, all GSDM-related proteins contain conserved leucine-rich regions in the N- and C-terminus (Figure 2).  Four of these motifs are present in the N-terminus and five are present in the C-terminus with the last motif being the most highly conserved.  The GSDMA proteins contain a putative leucine zipper motif within the fifth conserved leucine domain (amino acids 292-312 for GSDMA3), suggesting that GSDM proteins may be transcription factors (5;6).  However, this motif is not conserved in all family members (2), and the functional role of GSDM proteins remains unknown.  Three coiled coil domains are predicted to occur in GSDMA3 (approximate amino acids 258-280, 290-326 and 346-366) (5-7).  Two Gsdma3 transcripts are listed in the database.  The second GSDMA3 isoform is predicted to be identical to the original 464 amino acid protein except that it is missing amino acids 252-260.
 
The Michelin mutation results in the substitution of a lysine for a stop codon at amino acid 366 of GSDMA3 resulting in protein truncation in the seventh conserved leucine-rich domain and elimination of three of the conserved C-terminal motifs.  The expression level of the truncated GSDMA3 protein is unknown.
 
Expression/Localization
In general, Gsdm family genes are mainly expressed in differentiated cells of the epidermis and gastrointestinal (GI) tract in a highly tissue-specific manner.  This expression is strictly regulated along the proximal-distal and basal-apical axes in the GI tract (2)
 
Perhaps due to close homology among paralogues, there is some discrepancy in reported expression patterns for the mouse Gsdma genes and encoded proteins.  In the GI tract, Gsdma1 is expressed in the squamous epithelium of the skin, esophagus, and forestomach, and Gsdma2 in the middle to upper region of the gastric mucosa of the glandular stomach; however, neither is in the small and large intestine (2;8).  An antibody that likely detects all three GSDMA proteins localizes to differentiated cells in the forestomach and to the bottom of the gastric mucosa in glandular stomach (6)Gsdma3 gene expression does not occur in the GI tract, but is found in the skin with weak expression in placenta and testis.  Gsdma1 is also expressed in skin, tongue, trachea, esophagus, testis and prostrate (1).  Using in situ hybridization, one group found Gsdma3 to be expressed in the skin after postnatal day 3 in hair follicles, especially in the undifferentiated cells of the hair bulb.  Expression remained throughout anagen of hair follicle morphogenesis.  During early catagen on postnatal day 17, Gsdma3 expression was still found in the cortex of the proximal hair shaft and some cells of the regressing hair bulb.  By postnatal day 20, expression was also found in the epidermis.  Gsdma3 is also expressed in sebaceous and sebaceous-like glands (1).  By contrast, two other groups have reported that gene and protein expression for all three Gsdma genes can only be found in differentiated cells of the skin epithelium, hair follicle and sebaceous glands (6;7).  Gasdermin protein expression was restricted to the companion layer, inner root sheath and hair shaft of the hair follicle and the suprabasal layers of the epidermis.  Examination of antibody expression in Defolliculated (Dfl) mice (see Background and Putative Mechanism) expressing truncated GSDMA3 (lacking the antibody epitope occurring at amino acids 388-402) suggests that GSDMA1 is expressed in all of these areas (6).  A GSDMA3-specific antibody has not been developed making it unclear exactly where GSDMA3 is expressed in the skin.    
 
In humans, GSDMA mRNA has been detected in the epithelium of the stomach, esophagus, mammary gland and skin (8)GSDMA gene expression is mainly found in differentiated cells of the esophagus and pit cells in the stomach (9), but is found to be downregulated in most gastric and esophageal cancer cell lines and primary tumors (5;8;9).  Examination of GSDMA protein in human skin shows a similar distribution to mouse gasdermin with expression in the inner root sheath and hair shaft, but no expression in the bulb (6)
 
Mouse and human GSDMA proteins are mainly located in the cytoplasm with some nuclear localization observed in sebaceous glands and the granular layer of the epidermis (6;8)
Background

Figure 3. Hair follicle and growth cycle.  (A) The hair follicle consists of eight epithelial layers including the outer root sheath, companion layer, inner root sheath (consisting of Henle’s, Huxley’s and cuticle layers) and the hair shaft (consisting of the cuticle, cortex and medulla). All layers, with the exception of the outer root sheath, are derived from proliferative cells of the hair matrix, located around the dermal papilla at the base of the hair bulb.  (B) After hair follicles are established, hair is periodically shed and replaced, involving periodic destruction and regeneration of hair follicles.  The hair cycle is divided into three periods: the anagen phase (follicle growth), the catagen phase (regression), and the telogen phase (rest). Several signaling pathways are implicated in hair follicle regeneration. Mutations that affect the indicated stages of the cycle are noted in red text. Genes affected by these mutations are noted in black, italic text. Click on image to reveal related mutations. Click on mutations to view additional information.

The skin serves an important function as a barrier to the environment, and maintains its integrity by continuously renewing the epidermis, while also maintaining associated structures such as hair.  The surface epithelium of the skin is composed primarily of keratinocytes and is constantly regenerated as cells in the outer cornified layer are sloughed off and replaced by newly differentiated cells.  The epidermis is a stratified epithelium, composed of an inner layer of dividing cells and outer layers of terminally differentiating cells.  Murine fur consists of four different hair types called guard (also known as primary or tylotrich), awl, auchene, and zigzag, which have different morphological characteristics (10).  Hair is produced and maintained by the pilosebaceous unit consisting of a hair-producing follicle and a sebaceous gland composed of many different cell types (Figure 3).  The hair follicle can be divided into 3 regions: the lower segment (bulb and suprabulb), the middle segment (isthmus), and the upper segment (infundibulum). Eight epithelial layers are present in the hair follicle including the outer root sheath (ORS) that is continuous with the epidermis, the companion layer (CL), the inner root sheath (IRS) consisting of three layers (Henle’s, Huxley’s and cuticle) and the hair shaft, which also consists of three layers (cuticle, cortex and medulla) (11).  The layers of the hair follicle, except the ORS, are derived from proliferative cells of the hair matrix, which is located around the opening of the dermal papilla at the base of the hair bulb.  After hair follicles are established, hair is periodically shed and then replaced, involving periodic destruction and regeneration of hair follicles.  The hair cycle is divided into periods of follicle growth (anagen), followed by regression (catagen) and rest (telogen) (12;13).  During the regression phase, the lower half of the follicle undergoes apoptosis.  During the anagen phase, hair follicle growth is reinitiated as follicle stem cells are induced to proliferate.  A number of signaling pathways are implicated in skin and hair follicle morphogenesis and regeneration including Sonic hedgehog (Shh), Wnts, fibroblast growth factor (FGF) and transforming growth factor (TGF)-β family members [reviewed in (10;14)]. 
 
To date, six different dominant mutations of Gsdma3 have been identified.  These include Bareskin (Bsk), Defolliculated (Dfl), Rex-Denuded (Re-den), Finnegan (Fgn), Reduced coat 2 (Rco2) and Recombination-induced mutation 3 (Rim3).  All of these mutants display epithelial hyperproliferation, increased and inappropriate expression of keratins including Keratin 10 (mutated in Rough-fur), loss of hair follicle-associated sebaceous glands, deranged hair cycling and hair follicle degeneration resulting in hair loss and thickened, wrinkled skin.  Most also display corneal opacities (1;6;7;15;16).  Some phenotypic differences occur among these mutations.  For instance, Rim3, Dfl, and Re-den mice exhibit phenotypic abnormalities as early as one week of age and display hair shaft abnormalities, while Rco2 mutants display hair loss beginning at 23 days of age but have normal hair shaft morphology.  In general, the hair cycling derangement of most mutants has been described as an abnormal catagen resulting in progressive loss of hair follicles (1;6).  However, Rim3 mutants display an abnormal anagen phase (7).  In all cases, the few hair follicles found in older mutants were abnormally large in size either due to abnormal anagen or failure to regress during catagen (1;7;16).  Corneal opacities in these mutants are caused by abnormalities of the sebaceous-like Meibomian gland of the inner eyelid (16).                
 
As described above (Protein Prediction), only one GSDMA gene occurs in humans.  As this gene is expressed in the skin, hair follicle and GI tract, it may fulfill the functions of all three Gsdma mouse genes.  No disease-causing mutations of GSDMA are known, but GSDMA and the related GSDMB are located in a region of Chromosome 17 that is commonly amplified in various kinds of cancers (5).  Interestingly, examination of gastric and esophageal cancer cell lines and primary tumors suggests that GSDMA is frequently silenced in these cancers (5;8;9), and that GSDMA has an apoptotic activity when expressed in gastric cancer cell lines (8).  Other members of the GSDM family have also been linked to cancers.  GSDMC, and its mouse homologue, are tightly linked to the MYC gene, which is amplified in many cancers (9)GSDMC is also known as melanoma-derived leucine zipper extranuclear factor (MLZE), and was discovered while searching for genes upregulated in metastatic mouse melanoma cells (17).
Putative Mechanism
The restrictive expression pattern of Gsdma genes and protein products to terminally differentiated cells of the skin and GI tract, the apoptotic role of human GSDMA, and the phenotype of Gsdma3 mouse mutants, suggests that these proteins are late differentiation markers that may be involved in the proper control of cell differentiation and proliferation.  Although GSDMA proteins contain a putative leucine zipper, their function is unknown.  The phenotypic similarities of Gsdma3 mouse mutants with other mutants may help identify the molecular pathways that GSDMA proteins are involved with in the skin, hair follicle and GI tract.  Notably, Gsdma3 mouse mutants resemble mice with mutations in the stearoyl-Coenzyme A desaturase 1 (Scd1) gene, also known as asebia mice (mutated in flake).  Asebia mice exhibit hyperplasia of the epidermis, abnormally long anagen hair follicles, short hair shafts and hair loss associated with hypoplastic sebaceous glands (18;19).  Furthermore, both asebia and Dfl mice display a significantly increased number of inflammatory cells in the skin associated with hair follicle and sebocyte degeneration (16;20).  The presence of inflammatory cell infiltrate, along with the hyperproliferation and hyperkeratization of the epidermis, may explain the skin thickening found in Gsdma3 mouse mutants. 
 
In asebia mice, hair follicle defects and degeneration are secondary effects caused by loss of the sebaceous glands.  This may also be the case for Gsdma3 mouse mutants.  However, GSDMA3 is probably expressed within the hair follicle itself, suggesting that it directly controls hair follicle morphogenesis.  Gsdma3 mutant animals have phenotypic similarities to other mouse mutants, including mice with mutations in hairless, which encodes a nuclear corepressor (mutated in prune and mister clean).  These mice also exhibit progressive alopecia and wrinkled skin due to loss of hair follicles and excessive epithelial proliferation and hyperkeratization.  Unlike Gsdma3 mutants, hairless mutants exhibit sebaceous hypertrophy and the formation of dermal cysts (21).  Other mouse mutants that may shed some light on the function of Gsdma3 include those deficient in FGF5 (mutated in porcupine), Ectodysplasin (EDA), its receptor (EDAR; mutated in achtung2) and the EDAR adaptor protein (EDARADD; mutated in achtung and gizmo), as well as TGF-β family members.  FGF5-deficient animals have a prolonged anagen phase resulting in longer hairs (22), while mutants deficient in the EDA pathway fail to induce guard hair follicles (10).  Mice deficient in TGF-β1 or TGF-β2 display hair follicle and cycling defects, with TGF-β1 suppressing and TGF-β2 stimulating hair follicle formation (23;24).  An increasing amount of evidence suggests that GSDMA proteins may be involved in TGF-β signaling pathways as TGF-β expression in the suprabasal layer of the follicular epidermis has been shown to inhibit keratinocyte proliferation in the basal cell layers (24;25).  In Gsdma3 mouse mutants, hyperproliferative cells are found in the basal epidermal layers, although Gsdma expression is restricted to suprabasal cells in wild type animals.  Additionally, TGF-β is able to induce GSDMA expression and induce apoptosis in human gastric epithelial cell lines (8).  These results suggest that GSDMA proteins function downstream of TGF-β signaling to inhibit cell proliferation in terminally differentiated cells of the skin and GI tract.    
 
Although the function of the GSDMA3 protein is unknown, the location of the various Gsdma3 mutations identifies important residues and conserved motifs necessary for protein function.  The differing phenotypes of these mutants also suggest that certain of these regions or residues may be more critical for function.  For instance, Dfl and Rim3 mutants appear to have more severe phenotypes than Bsk and Rco2 mutants (1;6;7;16).  The Dfl mutation results in protein truncation at amino acid 262 prior to the putative leucine zipper; Rim3 alters the highly conserved 344 residue occurring in the seventh conserved region, while the residues altered in Bsk and Rco2 are less well-conserved across the GSDM family and fall outside of coiled coil regions (1;6;7).  However, it is possible the phenotypic differences seen in these mutants may be due to genetic background.  Most Gsdma3 mutations affect the C-terminus of the protein only, suggesting that this region is particularly important for protein function.  
 
The Michelin mutation results in protein truncation in the seventh conserved leucine motif, which would remove three of these conserved regions from the protein, including the third predicted coiled coil domain.  Truncation occurs after the putative leucine zipper.  If the mutated protein is expressed, it is possible some function is retained.  Michelin mice have not been fully characterized, making it difficult to assess whether they possess a less severe phenotype than that exhibited by Dfl and Rim3.  Heterozygous animals carrying these alleles can be distinguished from littermates by one week of age due to thick, folded skin (7;16).  By 10 days of age, sparser hair is evident.  Similarly, Michelin mutants can be distinguished early on by their skin phenotype, but do not appear to lose hair before the age of 3 weeks.  It is not clear whether the longer, coarser appearance of the fur in Michelin mutants prior to complete hair loss is due to the persistence of guard hairs and lack of the shorter secondary hairs, or whether the few hairs that remain at these stages are actually longer than wild type due to an abnormal anagen phase.  Both of these phenotypes have previously been described in Gsdma3 mutant mice (6;16), and may be dependent on phenotypic severity or genetic background.
Primers Primers cannot be located by automatic search.
Genotyping
Michelin genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  
 
Primers for PCR amplification
Michelin(F): 5’- CCTGACCTTTGCATGACACATTTTCCCACAC -3’
Michelin(R): 5’- GTTGAGGACCCTAAGCCTCTAAG -3’
 
PCR program (use SIGMA JumpStart REDTaq)
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for Sequencing
Michelin_seq (R): 5’- GTTGAGGACCCTAAGCCTCTAAG -3’
 
The following sequence of 831 nucleotides (see Mus musculus targeted non-conditional, lacZ-tagged mutant allele Gsdma2:tm1e(KOMP)Wtsi; transgenic JN961978.1 for reference sequence) is amplified:
 
1676                                                             cctga
1681 cctttgcatg acacattttc ccacacaaaa agaaaaacgt ctcaggccac actgggtaca
1741 gagtgcctaa cttaaccctg ggctacagaa tgagattctg tctcaaaaac aaacagaaag
1801 gccatggctt ctctcaaaac tgctttgaaa gattagaatt tgtttggctg ttgtttttta
1861 gatgaggact cactatgtag ccctggctgg cctggaactc actgagtaga gcactctggc
1921 ctcgaactca caaaggttca tataactctg ccttccaaaa tgctgagatt aaaggtgtgt
1981 gtcactttac ccagtcaaaa aatacagctt ttttaaaagt taatgaccag caaaggtgta
2041 tgttatagag caggtgttca gctgtggaca gatggacggt gggatggatg aatggacaaa
2101 tgagcatatg aatgaataga tagatggatg gatgcgtgga tgcatggatt aattgatcag
2161 agtgtgctaa cactatttgt agtctgtagt tccctctgta ccagcaacac atcgtttttt
2221 tggttttggt tctttggttt gtttggtttt tttctttctt tctctgcttt tccctccaga
2281 gctaactgaa gaacaactga agattctagt aaaatccttg gagaaaaaga tcttaccagt
2341 gcaactgaag ctggtgagaa aaagtgacag attacagggg gagtttaggg tggggcaggg
2401 atgggcgcta gaacttgtgg gaacatgcag acctactgtg ctcacaggac ccagccttat
2461 ccctagagag gtcttctcct ctccttagag gcttagggtc ctcaac
 
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsLei Sun, Xiao-hong Li, Xin Du, Katherine Benson, Bruce Beutler
List |< first << previous [record 99 of 132] next >> last >|
Edit History
2010-12-28 3:13 PM (current)
2010-12-28 11:26 AM
2010-12-28 11:26 AM
2010-12-23 3:04 PM
2010-02-03 3:59 PM