Allele | snowcock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 101,630,603 bp (GRCm38) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ G (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Rag2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | recombination activating gene 2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Rag-2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 101,624,718-101,632,529 bp (+) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development. This protein forms a complex with the product of the adjacent recombination activating gene 1, and this complex can form double-strand breaks by cleaving DNA at conserved recombination signal sequences. The recombination activating gene 1 component is thought to contain most of the catalytic activity, while the N-terminal of the recombination activating gene 2 component is thought to form a six-bladed propeller in the active core that serves as a binding scaffold for the tight association of the complex with DNA. A C-terminal plant homeodomain finger-like motif in this protein is necessary for interactions with chromatin components, specifically with histone H3 that is trimethylated at lysine 4. Mutations in this gene cause Omenn syndrome, a form of severe combined immunodeficiency associated with autoimmune-like symptoms. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Cysteine changed to Tryptophan | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000038204] [ENSMUSP00000106858] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P21784 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PDB Structure |
A PHD finger motif in the C-terminus of RAG2 modulates recombination activity [SOLUTION NMR]
Crystal structure of RAG2-PHD finger in complex with H3K4me3 peptide [X-RAY DIFFRACTION] CRYSTAL STRUCTURE OF RAG2-PHD FINGER IN COMPLEX WITH H3R2ME1K4ME3 PEPTIDE [X-RAY DIFFRACTION] Crystal structure of RAG2-PHD finger in complex with H3R2me2aK4me3 peptide [X-RAY DIFFRACTION] Crystal structure of RAG2-PHD finger in complex with H3R2me2sK4me3 peptide [X-RAY DIFFRACTION] Crystal structure of RAG2-PHD finger in complex with H3R2me2sK4me2 peptide [X-RAY DIFFRACTION] Crystal structure of RAG2-PHD finger in complex with H3K4me3 peptide at 1.1A resolution [X-RAY DIFFRACTION] Crystal structure of the core RAG1/2 recombinase [X-RAY DIFFRACTION] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000038204 Gene: ENSMUSG00000032864 AA Change: C419W
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000106858 Gene: ENSMUSG00000032864 AA Change: C419W
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.6467 ![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) ![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | CE: excellent candidate; Verification probability: 0.858; ML prob: 0.802; human score: 4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Live Mice | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 037091-MU | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2017-05-17 8:05 AM by Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2013-09-27 10:54 AM by Kuan-Wen Wang | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2014-01-03 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The snowcock mutation was induced by N-ethyl-N-nitrosourea (ENU)-mutagenesis and discovered in G3 mice screened for T-dependent (T-D) and T-independent (T-I) humoral responses. The snowcock mice lack a T-dependent IgG response to OVA-Alum (Figure 1), a T-dependent IgG response to rSFV-encoded β-galactosidase (β-gal) (Figure 2), and a T-independent IgM response to TNP-Ficoll (Figure 3). Flow cytometric analysis determined that the snowcock mice have reduced numbers of CD4+ T cells (Figure 4, top) and B cells (Figure 4, bottom). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | Whole exome HiSeq sequencing of the G1 grandsire identified 77 mutations. Six G3 mice with the snowcock phenotype were genotyped at all 77 mutation sites and two mutations on chromosome 2 affecting Olfr1131 and Rag2 were homozygous in all six of the snowcock mice; ten unaffected mice were wild-type or heterozygous at both the Olfr1131 (LOD=8.254) and Rag2 (LOD=8.708) loci. Snowcock mice phenocopy mutant models of Rag2, supporting a causal relationship between the mutation in Rag2 and the snowcock phenotype. The Rag2 mutation is a T to G transversion at base pair 101,630,603 (v38) on chromsome 2, or base pair 5,856 in the GenBank genomic region NC_000068 encoding Rag2. The mutation corresponds to residue 1,468 in the NM_009020 mRNA sequence (equivalent to residue 1498 in the ENSMUST00000044031 cDNA sequence) in exon 3 of 3 total exons and residue 1407 in the ENSMUST00000111227 cDNA sequence in exon 2 of 2 total exons.
Genomic numbering is shown corresponding to NC_000068. The mutated nucleotide is in red. The snowcock mutation results in a cysteine (C) to tryptophan (W) substitution at amino acid 419 of RAG2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
The unusual structure of the recombination activating gene (RAG) locus is present in most vertebrate genomes. Within the locus, the genes encoding RAG1 and RAG2 lie immediately adjacent to each other (separated by only a few kb), are convergently transcribed, and have an exceptionally compact organization with the entire open reading frame of each gene contained in a single exon (exon 2 in Rag2) (1;2).
Rag2 encodes the 527 amino acid RAG2 protein that can be divided into two functional regions, an N-terminal “core” domain (amino acid 1-383) and a C-terminal “non-core” domain (amino acids 384-527) [Figure 5; (3); reviewed in (4)]. The RAG2 core domain is necessary and sufficient for variable (V), diversity (D), joining (J) (V(D)J) recombination in vivo as well as V(D)J cleavage at recombination signal sequences (RSS) in vitro (3;5-7). RSS sequences flank each V, D, and J encoding gene segment and consist of moderately well-conserved heptamer (CACAGTG) and nonamer (ACAAAAACC) sequences separated by 12 or 23 (±1) base pairs of nonconserved spacer DNA (designated a 12- or 23-RSS, respectively). The RAG2 core domain is predicted to fold into a six-bladed β-propeller structure, with each blade of the propeller composed of a 50 amino acid Kelch motif [Figure 6; PDB:3WDZ; (8-10); reviewed in (11)]. Kelch motifs consist of four antiparallel β-strands and often function as docking platforms for proteins or small signaling molecules [(8); reviewed in (4)]. The sixth Kelch motif of the RAG2 β-propeller (amino acids 314-371) mediates the interaction of RAG2 with RAG1. Mutation of Trp317 (W317Y) within the sixth Kelch motif results in loss of RAG1-RAG2 complex formation and a subsequent detriment in RSS recognition and cleavage (8). The association of RAG2 with RAG1 is believed to induce a conformational change within RAG1 that switches the catalytic center of RAG1 into an active conformation [(8); reviewed in (4)].
The non-core domain of RAG2 is conserved throughout evolution and is dispensable for the catalytic activity of RAG2 [(3;12;13); reviewed in (11)]. However, mice that express only the core domain of RAG2 have impaired B cell development (i.e., reduction in the number of mature, pre-B, and immature B cells as well as an increase in the percentage of pro-B cells) and reduced T cell numbers, indicating that there is an essential physiological function for the non-core domain of RAG2 (12;14;15). Subsequent studies determined that the RAG2 non-core domain restricts RAG1/2-mediated transposition (16-18). Reports have been conflicting as to whether the non-core domain also functions in the suppression of hybrid joint formation, in which a signal end rejoins to a coding end during V(D)J recombination. Some studies indicate that full-length RAG2 supports more hybrid joint formation than the core RAG2 domain alone (16-17), while others demonstrate that full-length RAG2 suppresses hybrid joint formation significantly more than the core RAG2 domain alone (18-19). Reasons for the conflicting results were not indicated and the function of the non-core domain of RAG2 in hybrid joint formation has not been resolved. In addition, the non-core domain of RAG2 regulates the recombinatorial order during V(D)J recombination, inhibiting direct V to D rearrangements prior to D-J rearrangement. Non-core RAG2 also suppresses some forms of inter-chromosomal translocations between TCRβ and TCRδ D gene segments (13). In addition, non-core RAG2 helps to enforce the use of the proper RSSs during recombination (13).
Within the non-core domain, amino acids 417-484 fold into a plant homeodomain (PHD)-type zinc finger that is important for VH-to-DJH rearrangement (3;12;14;20)]. PHD zinc fingers are a member of the treble class of zinc-binding domains that function in PtdInsP-binding, nucleosome interaction, chromatin modification, and E3 ubiquitin ligase activities in different proteins (10;21-25). Treble clef motifs include RING finger domains (often found in E3 ubiquitin ligase enzymes) and FYVE finger domains (found in proteins that bind PtdInsP) domains]. PHD zinc fingers fold into a two-strand anti-parallel β-sheet and a C-terminal α-helix (not present in all PHDs) that is stabilized by two zinc atoms. Using nuclear magnetic resonance (NMR) spectroscopy, Elkin et al. determined that Cys419, Cys423, Cys446, His452, His455, Cys458, Cys478, and His481 within the PHD zinc finger of RAG2 bind the two zinc ions in a characteristic interleaved topology shared by members of the treble class of zinc-binding domains [Figure 7; PDB: 2JWO; (3)]. RAG2 does not display E3 ubiquitin ligase activity, but does bind to PtdInsPs (preferentially to bis-phosphorylated PtdInsPs) (3). The PHD zinc finger of RAG2 plus amino acids 488-527 (i.e., the “basic patch”) were necessary and sufficient for PtdInsP binding; each domain alone did not bind PtdInsPs (3). Arg464 and His468 are proposed to be involved in PtdInsP recognition and Trp453 and Asn474 are predicted to influence the molecular surface area of the α-helix formed by the L2 segment (Figure 7) of the RAG2 zinc finger; mutations in Trp453 and Asn474 (e.g., W453R and N474S, respectively) alter the surface area of the α-helix and, subsequently, the interaction of the PHD domain with PtdInsPs (3). In addition to the association of the PHD zinc finger to PtdInsP, the PHD zinc finger of RAG2 recognizes trimethylated histone H3K4, a modification that occurs mostly within accessible chromatin; mutations that disrupt the RAG2-histone association impair V(D)J recombination in vivo [(26-28); reviewed in (4)].
RAG2 contains an “acidic region” (amino acids 374-414) that acts as a linker between the core domain and the PHD zinc finger (2;5;15;29). The acidic region is required for the interaction of RAG2 with histones as well as for complete recombination of the IgH locus in B cells (2;5;15). Full-length RAG2 binds directly to core histones H2A, H2B, H3, and H4 via amino acids 397-408; mutation of Tyr402, Asn403, Asp406, or Glu407 to alanine in full-length RAG2 diminished the histone interaction (15). West et al. propose that the binding of RAG2 to histones could stabilize RAG1/2 binding to the RSS; or that the RAG2 C-terminus could recognize specific histones that bear unique posttranslational modification patterns bringing the recombinase to, or stabilizing it, at very specific RSSs; and/or the interaction of RAG2 with histones could function in the stabilization or protection of DNA ends during the processing and joining phases of the recombination reaction (15).
Cyclin A/CDK2-mediated phosphorylation of RAG2 at amino acid Thr490 facilitates RAG2 degradation at the G1/S transition; degradation of RAG2 at G1/S prevents the formation of RAG1/2-initiated DNA breaks during replication and restricts V(D)J recombination to the G1 stage of the cell cycle (6;30-32). Upon Thr490 phosphorylation, RAG2 is translocated from the nucleus to the cytoplasm, where it is degraded by the proteasome (31,32). Treatment of RAG2-expressing human embryonic kidney cells (HEK-293) with the cyclin-dependent kinase inhibitor, p27Kip1, inhibited the activity of cyclin A/CDK2 and subsequently increased RAG2 stability (31). In addition, p27Kip1 induced the localization of RAG2 to the nucleus and its subsequent stabilization (32). Mizuta et al. propose that after the completion of V(D)J recombination and the cell cycle progresses to S phase, p27Kip1 is degraded, allowing cyclin A/CDK2 to become active (32). Cyclin A/CDK2 subsequently phosphorylates RAG2 at Thr490, removing the C-terminal regulatory domain function that inhibits the cytoplasmic localization of RAG2; RAG2 is subsequently translocated from the nucleus to the cytoplasm where it is ubiquitinated and degraded by the 26S proteasome (32). The mechanism by which Thr490 phosphorylation promotes the cytoplasmic localization of RAG2 as well as the identity of the ubiquitin ligase are unknown (32).
The snowcock mutation (C419W) is within the PHD domain of RAG2. Cys419 is directly involved in binding one of two zinc atoms associated with RAG2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | RAG2 is expressed specifically in developing B and T cells during V(D)J recombination (2). V(D)J recombination is restricted to the G0/G1 stage of the cell cycle, and the onset of V(D)J recombination correlates with the RAG2 protein expression level (i.e., RAG2 accumulates at G0/G1 and decreases rapidly at the G1/S transition); Rag2 mRNA levels remain constant throughout the entire cell cycle (32;33). RAG2 can shuttle between the nucleus and cytoplasm (see the “Protein Prediction” section) (32). Within the nucleus, RAG2 is distributed throughout, with the exception of the nucleolus (34). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background | The RAG1 and RAG2 proteins carry out the first enzymatic step of V(D)J recombination, the process by which the variable region of antigen receptor genes is assembled in developing B and T lymphocytes. The complex containing RAG1 and RAG2 recognizes, binds, and catalyzes two double-stranded DNA cleavages between the RSS heptamer and the flanking coding sequence.
Please see maladaptive for more information about the function of RAG2.
Mutations in RAG2 are linked to severe combined immunodeficiencies (SCID), disorders with varying degrees of defective cellular and humoral immune function. These include combined cellular and humoral immune defects with granulomas (CCHIDG; OMIM: #233650), Omenn syndrome (OMIM: #603554), and B cell-negative severe combined immunodeficiency (SCID; OMIM: #601457) (35-37). Null mutations in RAG1 or RAG2 underlie approximately half of the human T cell-negative, B cell-negative SCIDs (35). Affected patients begin to have problems with oral candidiasis, diarrhea, and failure to thrive in the first months of life, and are later identified after several more months of persistent infections by opportunistic organisms. CCHIDG is a less severe form of SCID that is accompanied by noninfectious granuloma formation; residual T and B cell function may exist, conferring some protection against infections. Hypomorphic mutations in RAG2 cause Omenn syndrome, an autosomal recessive SCID characterized by enlarged lymphoid tissue, severe erythroderma, hypereosinophilia, elevated serum IgE, few B cells, and oligoclonal expansion of T cells. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Rag2-deficient mice are viable, but B and T cell development are blocked at an early progenitor stage due to an inability to initiate V(D)J rearrangement (39). The snowcock mutation affects Cys419, a zinc-binding residue in the PHD zinc finger domain of RAG2 (Figure 7; (3)]. The mutation may destabilize the PHD domain, the integrity of which is necessary for RAG1/2 recombinase activity in vivo (3;26-28). The snowcock mutation may also cause disinhibition of RAG1/2-mediated transposition (16-18) and hybrid joint formation (19), and dysregulate recombinatorial order during V(D)J recombination (13). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer snowcock_pcr_F: AGGAGGAATCTCTGTCTCCAGTGC snowcock_pcr_R: AGGAGTCAAGACTTTCCCAGAGCC |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Snowcock genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. PCR Primers Snowcock(F): 5’- AGGAGGAATCTCTGTCTCCAGTGC -3’ Snowcock(R): 5’- AGGAGTCAAGACTTTCCCAGAGCC -3’
Sequencing Primer Snowcock_seq(F): 5’- TTCCTTGGCATACCAGGAGAC -3’
PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40X 6) 72°C 10:00 7) 4°C ∞
The following sequence of 790 nucleotides (from Genbank genomic region NC_000068 for linear DNA sequence of Rag2) is amplified:
aggaggaatc tctgtctcca gtgcaatcct cactcaaaca aacaatgatg aatttgttat tgtgggtggt tatcagctgg aaaatcagaa aaggatggtc tgcagccttg tctctctagg ggacaacacg attgaaatca gtgagatgga gactcctgac tggacctcag atattaagca tagcaaaata tggtttggaa gcaacatggg aaacgggact attttccttg gcataccagg agacaataag caggctatgt cagaagcatt ctatttctat actttgagat gctctgaaga ggatttgagt gaagatcaga aaattgtctc caacagtcag acatcaacag aagatcctgg ggactccact ccctttgaag actcagagga attttgtttc agtgctgaag caaccagttt tgatggtgac gatgaatttg acacctacaa tgaagatgat gaagatgacg agtctgtaac cggctactgg ataacatgtt gccctacttg tgatgttgac atcaatacct gggttccgtt ctattcaacg gagctcaata aacccgccat gatctattgt tctcatgggg atgggcactg ggtacatgcc cagtgcatgg atttggaaga acgcacactc atccacttgt cagaaggaag caacaagtat tattgcaatg aacatgtaca gatagcaaga gcattgcaaa ctcccaaaag aaaccccccc ttacaaaaac ctccaatgaa atccctccac aaaaaaggct ctgggaaagt cttgactcct
Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Kuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler |