Phenotypic Mutation 'F480' (pdf version)
AlleleF480
Mutation Type missense
Chromosome17
Coordinate57,444,063 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Adgre1
Gene Name adhesion G protein-coupled receptor E1
Synonym(s) Emr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
Chromosomal Location 57,358,686-57,483,529 bp (+)
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010130; MGI: 106912

MappedYes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model not available
AlphaFold Q61549
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: Y579C

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000004850)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: Y579C

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000086763)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably nonessential (E-score: 0.158) question?
Phenotypic Category
Phenotype question? Literature verified References
immune system
normal phenotype
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(1) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57402519 missense unknown
R7939:Adgre1 UTSW 17 57449938 missense probably damaging 0.98
R7977:Adgre1 UTSW 17 57447987 missense possibly damaging 0.54
R7987:Adgre1 UTSW 17 57447987 missense possibly damaging 0.54
R8187:Adgre1 UTSW 17 57420349 missense probably benign 0.00
R8210:Adgre1 UTSW 17 57445061 missense possibly damaging 0.94
R8223:Adgre1 UTSW 17 57361692 missense probably damaging 0.99
R8344:Adgre1 UTSW 17 57408459 missense probably benign 0.12
R8698:Adgre1 UTSW 17 57402003 missense probably benign 0.05
Z1176:Adgre1 UTSW 17 57361729 missense possibly damaging 0.76
Z1177:Adgre1 UTSW 17 57419374 missense probably damaging 0.96
Mode of Inheritance Autosomal Semidominant
Local Stock Embryos, gDNA
MMRRC Submission 010465-UCD
Last Updated 2021-11-01 7:43 AM by Diantha La Vine
Record Created unknown
Record Posted 2008-05-21
Phenotypic Description

The F4/80 phenotype was identified among ENU-induced G3 mutants in the course of a screen for mice with defects in macrophage function. The screen used F4/80 immunostaining of thioglycolate-elicited peritoneal exudate cells to identify and isolate macrophages by flow cytometry (1).  Cells from homozygous F4/80 mice exhibited greatly reduced F4/80 surface expression relative to wild type, and cells from heterozygous mutants expressed F4/80 at levels intermediate between wild type and homozygous cells. However, F4/80 mutants displayed normal resistance to infections with mouse cytomegalovirus (MCMV) and Listeria monocytogenes. No other immunologic phenotypes were observed in F4/80 mice.

Nature of Mutation
The F4/80 mutation was mapped to Chromosome 17, and corresponds to an A to G transition at position 1776 of the Emr1 transcript, in exon 14 of 22 total exons.
 
1760 TCCAAGCCTATTATCTATACCCTCCAGCACATC
574  -S--K--P--I--I--Y--T--L--Q--H--I-
 
The mutated nucleotide is indicated in red lettering, and results in a tyrosine to cysteine change at amino acid 579 of the F4/80 protein.
Illustration of Mutations in
Gene & Protein
Protein Prediction
The F4/80 glycoprotein is a member of the superfamily of cell surface receptors containing seven transmembrane segments (TM7 receptors), specifically the class B or secretin TM7 receptor family [reviewed in (2)]. Class B TM7 receptors are themselves divided into three classes (B1, B2 and B3), and F4/80 belongs to the B2 class that is characterized by a long N-terminal extracellular region. The presence of EGF-like domains within the N-terminal extracellular region defines a group of six EGF-TM7 receptors in humans: CD97, EMR1, EMR2, EMR3, EMR4, and EGF-TM7-latrophilin-related protein (ETL). Mouse orthologs exist for CD97, EMR1 (F4/80 in mouse), EMR4 (F4/80-like receptor, FIRE, in mouse), and ETL. The F4/80 protein (931 amino acids in length) and EMR1 (886 amino acids in length) share 68% amino acid identity, and possess the same structural topology (3;4).
 
Following a signal peptide, the extracellular N-terminal third of F4/80 (amino acids 32-367) contains seven tandem EGF-like domains (3), approximately 50 amino acids in length and characterized by the presence of six cysteine residues positioned to form three disulfide bonds within each domain (Figure 1). Several alternatively spliced Emr1 transcripts also encode isoforms with varying numbers and arrangements of EGF-like domains (2). EGF-like domains mediate protein-protein interactions, such as between the Drosophila proteins Delta and Notch, and can also mediate Ca2+ binding. Five of the seven EGF-like domains of F4/80 contain consensus Ca2+-binding motifs. The C-terminal third of F4/80 (amino acids ~645-931) contains seven transmembrane segments, three extracellular loops, and three intracellular loops, with the C-terminus of the protein located intracellularly. The seven transmembrane-spanning region of F4/80 shares significant similarity with members of the TM7 hormone receptor family, such as receptors for parathyroid hormone, calcitonin, glucagon, and secretin, and contains a cysteine residue in each of the first and second extracellular loops, thought to form a disulfide bridge critical to the protein tertiary structure (3).
 
Between the EGF-like domains at the N-terminus and the TM7 structure at the C-terminus, the middle third, or stalk region, of F4/80 has no significant similarity to other known protein domains. This portion of the protein (amino acids ~399-642) contains 4 potential N-glycosylation sites and 47 potential O-glycosylation sites (i.e. approximately 20% serine/threonine content). Biochemical analysis demonstrates that F4/80 is highly N-glycosylated, with N-linked carbohydrates contributing 40 kD to the protein molecular mass under the reducing conditions of SDS-PAGE (5). F4/80 is only moderately O-glycosylated, with O-linked glycosylation contributing 5-10 kD of molecular mass. F4/80 also contains extensive intramolecular disulfide bonding (5). An Arg-Gly-Asp sequence, a characteristic integrin-binding motif located at amino acids 506-508, has been postulated to mediate cell adhesion by F4/80 (3).  In many of the EGF-TM7 receptors, a so-called “G-protein coupled receptor proteolytic site” (GPS) is found proximal to the first transmembrane segment, and consists of a proteolytic cleavage site within a cysteine motif (2). Upon cleavage at this site in the endoplasmic reticulum, a heterodimer of the extracellular and TM7/intracellular portions of these proteins is formed; the physiological significance of heterodimer formation is unknown. EMR1 has an imperfect GPS site with unknown functionality.
 
The mutation found in F4/80 mice converts tyrosine 579 to cysteine. This amino acid is located outside the cell, within the central region of the protein close to the first transmembrane segment of the seven transmembrane-spanning region.
Expression/Localization
F4/80 was first identified as a mouse macrophage-specific cell surface antigen that bound the F4/80 monoclonal antibody (mAb) (1). F4/80 is highly expressed on resident tissue macrophages in the bone marrow, thymic cortex, lymph node medulla, splenic red pulp, gastrointestinal tract, Kupffer cells in the liver, Langerhans cells in the skin, and microglia in the nervous system (6). Macrophages localized within T cell areas of lymph nodes and spleen do not express F4/80 (6). Blood monocytes express low levels of F4/80 (7). Expression of mouse F4/80 and human EMR1 has recently been demonstrated in other hematopoietic cells, including myeloid dendritic cells (8) and eosinophilic granulocytes (9;10). Notably, using an antibody against the EGF-like domain region, human EMR1 was shown to be exclusively expressed in eosinophils, but not macrophages, monocytes, PMN or lymphocytes (10). This study did not report on the ability of the F4/80 mAb to bind to human cell types.
Background
F4/80 is best known as a macrophage-specific marker, and the F4/80 mAb has been used extensively in the characterization of the mouse mononuclear phagocyte system (6;11), and for the identification and isolation of mouse macrophages for both in vitro and in vivo studies. An enhancer element in the proximal promoter of Emr1, consisting of an extended purine-rich sequence including 9 GGAA sequences, reportedly associates with the Ets transcription factor PU.1 and promotes high gene expression levels in macrophages (12). 
 
The physiological function of F4/80 has only begun to be investigated, and evidence of its function remains sparse. The expression of F4/80 on macrophages is known to be regulated developmentally and in response to several stimuli. Blood monocytes, the precursors of tissue macrophages, express lower levels of F4/80 than mature macrophages (7). F4/80 expression is downregulated by interferon (IFN)-γ (13), and in response to macrophage infection with bacillus Calmette-Guerin (14). These findings suggest that F4/80 functions in mature macrophages, and that its expression can be modulated by the activation status of macrophages.
 
The generation of mice lacking F4/80 has been undertaken by two independent groups. Both report that F4/80-/- mice are healthy and fertile, and display no gross abnormalities or phenotypes (15;16). Histological analysis showed that immune tissues appear normal, and flow cytometric analysis demonstrated normal populations of B and T cells. Furthermore, F4/80-/- macrophage development, as determined by examination of expression profiles of several macrophage-restricted cell surface proteins, is comparable to that of wild type mice. F4/80-/- macrophages phagocytose target cells normally, and produce normal levels of nitric oxide and cytokines stimulated by lipopolysaccharide (LPS) or IFN-γ (15).  F4/80-/- mice (and the ENU-induced Emr1F4/80/F4/80 mutants) also display normal resistance to infection by Listeria monocytogenes (16). This finding contrasts with previous work demonstrating that treatment with anti-F4/80 mAb impairs splenic macrophage production of tumor necrosis factor (TNF)-α and interleukin (IL)-12 induced by exposure to heat-killed Listeria (17). However, whether Listeria infection modulates the expression of F4/80 is unknown, as is the molecular effect of anti-F4/80 mAb treatment on cells.
 
Figure 2. F4/80 is required for the induction of peripheral tolerance. In the ACAID model, foreign antigens injected into the anterior chamber of the eye are captured by F4/80+ antigen presenting cells (APCs) of the iris and ciliary body and travel via the blood to the spleen where they promote the development of antigen-specific CD8+ Treg cells capable of suppressing delayed-type hypersensitivity responses toward eye-derived antigens.  Interaction between F4/80+ APCs, NKT cells, and conventional T cells may be required for Treg development in the ACAID model.
Further studies of F4/80-/- mice indicate that F4/80 is required for the induction of peripheral tolerance in the anterior chamber-associated immune deviation (ACAID) model (Figure 2). Peripheral tolerance prevents immune recognition by self-reactive lymphocytes, as well as inappropriate immune reactivity to antigens introduced to immunologically privileged sites such as the eye. ACAID-induced peripheral tolerance protects the eye from inappropriate immunogenic inflammation. In the ACAID model, foreign antigens injected into the anterior chamber of the eye are captured by antigen presenting cells (APCs) of the iris and ciliary body, and travel via the blood to the spleen where they promote the generation of CD4+ and CD8+ T regulatory (Treg) cells that suppress the immune response (18). Intravenous transfer of F4/80+ APCs derived from the iris and ciliary body of an AC-injected eye can induce antigen-specific splenic Treg cells in naïve mice (19;20). In addition, administration of anti-F4/80 mAb prevents suppression of the delayed-type hypersensitivity (DTH) response to injected antigen (21). In F4/80-/- mice, inoculation of antigen into the eye anterior chamber fails to induce CD8+ Treg cells and suppress antigen-specific DTH responses (15). A similar failure to induce CD8+ Treg cells and suppress DTH responses is observed in F4/80-/- mice in a low-dose oral tolerance model (15).
 
The ligand(s) for F4/80 and its downstream signaling partners have yet to be identified, and a full understanding of how F4/80 induces Treg cells and suppresses DTH responses awaits these discoveries. Engagement of F4/80 by its ligand(s) may elicit signaling leading to the production of cytokines that stimulate Treg cell development. An adhesive function for F4/80 has also been postulated based on the presence of the Arg-Gly-Asp motif in the protein sequence (3). This hypothesis is supported by the finding that Langerhans cells decrease their F4/80 expression after they take up antigens and become migrating veiled cells (7), and by the lower level of F4/80 expression on circulating blood monocytes relative to tissue macrophages. During tolerance induction, NKT cells must be recruited to the spleen where they form clusters with APCs (22;23), and F4/80 may mediate such NKT-APC interaction.
 
The functions of F4/80 in non-macrophage cells such as eosinophils and dendritic cells remain unknown.
Putative Mechanism
The mutated tyrosine in F4/80 mutants lies in the extracellular central or stalk region of the protein, N-terminal to the cysteine motif containing the putative GPS site. No specific function has been reported for this residue, but its position is directly adjacent to a potentially O-glycosylated threonine residue. Glycosylation can influence the structural stability, as well as dictate the local structure of proteins. Heavy glycosylation may also protect proteins from proteolytic degradation. The expression of F4/80 on macrophages is greatly reduced by the F4/80 mutation, which may render the protein unstable or subject to increased degradation relative to the wild type protein.
Primers Primers cannot be located by automatic search.
Genotyping
F4/80 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 
Primers
F4/80 (F): 5’- CCGCTGTCAGGAACTGGTGTTTGG -3’
F4/80(R): 5’-GCACTAATGCATCCTCACGGGAATG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:20
4) 68°C             1:00
5) repeat steps (2-4) 34X
6) 68°C             5:00
7) 4°C              ∞
 
Primers for sequencing
F4/80_seq(F): 5’- TGTCTCATTTGCACACATGGAATC -3’
F4/80_seq(R): 5’- CACGGGAATGAACACTTGTTGC -3’
 
The following sequence of 789 nucleotides (from Genbank genomic region NC_000083 for linear genomic sequence of Emr1) is amplified:
 
84848        ccg ctgtcaggaa ctggtgtttg gtgtcttaga cctgttgagg tttcttgact
84901 ctcagagagt aggaacggca gcctggagtt tgggtggggt ttctttcctt tcccatgtct
84961 cttctttccc tagtcttcca accctgcctc aactgatctg aaaattcttg gttatttaag
85021 tcctaagaat aaactgggga gagtctgtgt atgtacatgt cacatgtgtc gcatgagtgt
85081 acacatgttg ctgtgtgtac acatatttcc tgtgtgcaca tgtgccatct ataatatcta
85141 tggaacaagt aattctttcc ctctttgttt ttttttccct ctttgttttt attttgggga
85201 catgcagggg ccccaggagt ggcttttgtc tcatttgcac acatggaatc agttttaaat
85261 gaacgcttct ttgaagatgg ccagtccttc cggaagctga ggatgaattc ccgtgttgtt
85321 ggtggcactg tgaccgggga gaagaaggag gacttctcca agcctattat ctataccctc
85381 cagcacatcc aggtttgtgc ggtgtcttct gagacctctg attgtctatg gaggagtctt
85441 gctacccaag atgctctaac ctatttaaga aacgattgtt ttgtttccaa atgatcacag
85501 atttggatgc aaaaatgcac tcccattttt cctttactag agagatgctg tgtgcctttt
85561 tctaagtttc ctcaatagtg acacactaca acctacaatg caacaagtgt tcattcccgt
85621 gaggatgcat tagtgc
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsZuping Zhou, Bruce Beutler
Edit History
2011-03-22 9:22 AM (current)
2011-03-22 9:22 AM
2011-03-22 9:20 AM
2011-01-07 9:06 AM
2010-02-03 9:27 AM