Phenotypic Mutation 'christian'

• Allele: christian
• Mutation Type: missense
• Chromosome: 10
• Coordinate: 80,730,042 bp (GRCm38)
• Base Change: G ⇒ T (forward strand)
• Gene: Ap3d1
• Gene Name: adaptor-related protein complex 3, delta 1 subunit
• Synonym(s): mBLVR1, Bolvr
• Chromosomal Location: 80,706,956-80,742,264 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017] ; PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
• Mapped: No
• Amino Acid Change: Alanine changed to Glutamic Acid
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020420]
• AlphaFold: O54774
• SMART Domains: Protein: ENSMUSP00000020420; Gene: ENSMUSG00000020198; AA Change: A97E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000020420)
• Predicted Effect: unknown
• Meta Mutation Damage Score: 0.6467
• Is this an essential gene?: Probably essential (E-score: 0.950)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• MMRRC Submission: 037099-MU
• Last Updated: 2021-11-22 7:48 AM by Diantha La Vine
• Record Created: 2013-11-18 12:28 PM by Jennifer Weatherly
• Record Posted: 2014-03-28
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Jennifer Weatherly Tiana Purrington

Accession Number

NCBI RefSeq: NM_007460; MGI:107734

Alleles Listed at MGI

All alleles(14) : Targeted(3) Gene trapped(9) Spontaneous(2) 

Phenotypic Description

Figure 1. The christian phenotype. Christian homozygous mouse (left); C57BL/6J mouse (right).

The christian phenotype was initially identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 animals and is characterized by coat hypopigmentation (Figure 1). The christian homozygous mice have a gray coat. 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 126 mutations, one of which affected Ap3d1, a gene known to affect coat pigmentation (1). The coat color of christian homozygotes resembles that of Ap3d1 mutant mice [Ap3d1^mh-2J; MGI:1856084; (2)], strongly suggesting that the Ap3d1 mutation is causative for the christian phenotype. The Ap3d1 mutation is a C to A transversion at base pair 80,730,042 (v38) on Chromosome 10, or 12,170 in the GenBank genomic region NC_000076 encoding Ap3d1. The mutation corresponds to residue 510 in the mRNA sequence NM_007460 within exon 4 of 31 total exons.

 

494 CGTGTTGGCTACCTTGCGGCCTCCCAGTGCTTC

92  -R--V--G--Y--L--A--A--S--Q--C--F-

 

The mutated nucleotide is indicated in red.  The mutation results in an alanine (A) to glutamic acid (E) substitution at amino acid 97. 

Protein Prediction

Figure 2. The AP-3 molecule consists of β3A-, δ-, μ3-, and σ3- subunits. The β3A and δ-subunits have three domains: the trunk (alternatively, head or core) region, which mediates protein-protein interactions with the other subunits, the hydrophilic hinge region and the ear or appendage region. The approximate location of the christian mutation in the trunk domain is indicated by the red, wavy line.

Ap3d1 encodes the delta (δ) subunit (alternatively, δ-adaptin) of the adaptor protein 3 (AP-3) complex. AP-3 is one of four heterotetrameric adaptor protein complexes (i.e., AP-1 to AP-4) that regulate vesicle biogenesis in the endosomal and lysosomal pathways as well as cargo selection and subcellular trafficking of membrane cargo proteins (3-6). The AP-3 complex is comprised of the δ subunit, a large chain beta (β3) subunit (alternatively, β-NAP; see the record for bullet gray), a medium chain mu (μ3) subunit (alternatively, p47), and a small chain sigma (σ3) subunit [Figure 2; (4;7-13)].  β3, μ3, and σ3 each exist as two isoforms (β3A and β3B; μ3A and μ3B; σ3A and σ3, respectively (14); the δ subunit does not have two isoforms (12;14). AP-3 can form two different complexes, AP-3A and AP-3B, that have unique expression patterns; see “Expression and Localization” section for more details on the expression patterns of the AP-3 complexes. The ubiquitously expressed AP-3A complex is comprised of the δ, σ3A/B, β3A, and μ3A subunits, while the neuron-specific AP-3B complex is composed of the δ, σ3A/B, β3B, and μ3B subunits (7;13;14).

 

Delta-adaptin is homologous to the large chain gamma-1 (γ1)- and alpha-2 (α2)-adaptins of the AP-1 (comprised of γ1, β1, μ1, and σ1 subunits) and AP-2 (comprised of α2, β2, μ2, and σ2 subunits) adaptor complexes, respectively (15-17). However, δ-adaptin is only ~15% identical to the γ1- and α2-adaptins; most identity is restricted to the N-terminus of the proteins (7;8). Delta-adaptin shares high amino acid sequence similarity with the protein product of the Drosophila garnet gene; the proteins share greater than 96% identity at the N-terminus (amino acids 178-287 in δ) (7;8;18). The garnet protein is necessary for the biogenesis of eye color pigment granules.

Similar to other adaptins, δ-adaptin has a three domain structure that consists of an N-terminal core (alternatively, trunk) domain (amino acids 1-582), a highly hydrophilic linker (i.e., hinge domain; amino acids 583-945), and a C-terminal ear domain (amino acids 946-1153) [Figure 3; (7;9)]. Analysis of the C-terminally truncated δ-adaptin in the Ap3d1 mutant mh^2J mouse model (see “Background” for more details) determined that the N-terminal half of δ-adaptin is necessary and sufficient for the early steps in AP-3 complex formation and trans-Golgi network (TGN) localization (2). Delta-adaptin has a WI(I/L)GEY consensus sequence within the trunk domain [amino acids 396-401; WICGEF; (7)]. The function of the WI(I/L)GEY motif is unknown, but it is found in the α-, β-, and γ-adaptins as well as in the β-COP subunit of the COP I adaptor-related protein complex (19-21).

 

The ear domain of δ-adaptin interact with the C-terminus of the σ3 subunit (9). The σ3-δ-trunk portion of the AP-3 complex interacts with [DE]XXXL[LI]-type, dileucine-based sorting signals in cargo proteins, and with GTP bound ADP-ribosylation factor 1 (Arf1) (9;22). Arf1 is localized to the Golgi and is required for intra-Golgi transport as well as the recruitment of AP-3 to membranes (9). The ear domain of δ-adaptin inhibits AP-3 binding to Arf1 and prevents the recruitment of AP-3 to membranes (9).  Overexpression of the ear domain of δ-adaptin also interferes with Lamp-1 and CD63 trafficking (9). Lefrancois et al. propose that AP-3 exists in an equilibrium between “closed” and “open” conformations (9). In the closed conformation, the Arf1 binding site on the AP-3 core is covered by the ear region of δ-adaptin in order to block untimely interactions with the Arf1 binding site and preventing AP-3 recruitment to the membrane (9). In the open conformation, the ear domain releases the Arf1 binding site on σ3-δ-trunk, allowing Arf1 binding and subsequent recruitment of AP-3 to the membrane (9).

 

AP-3 interacts with several proteins through associations with δ-adaptin (Table 1). Amino acids 578-825 (within the ear domain) of δ-adaptin recognizes the YxDxE motif (i.e., an acidic tyrosine-based cytoplasmic sorting motif) of vesicular stomatitis virus glycoprotein (VSV-G), a transmembrane protein that functions as the surface coat of enveloped viral particles; AP-3 assists in the export of VSV-G from the TGN to the cell surface (23). An intact and stable AP-3 complex is required from human immunodeficiency virus type 1 (HIV-1) assembly and release; AP-3 deficiency decreased HIV-1 Gag localization at the plasma membrane and late endosomes (24;25). The findings on an association between Gag and δ-adaptin are conflicting. Earlier studies showed that the protein interactive domain (amino acids 641-742) of δ-adaptin interacted with the matrix domain at the N-terminus of HIV-1 Gag protein to facilitate virus-like particle assembly and the release of virus particles from HIV-1-infected dendritic cells (25;26). However, a later study determined that the HIV-1 matrix protein does not directly interact with the PID domain; this study did not rule out that an interaction between Gag and δ-adaptin  may be mediated by other factors not present in the assay used (27). Kyere et al. therefore proposed that δ-adaptin plays an unknown, alternative role to mediating Gag targeting in HIV-1 assembly (27). AP-3 recognizes the tyrosine- and di-leucine-based sorting signals of lysosome-associated membrane proteins (LAMPs) 1 and 2, lysosomal integral membrane protein 2 (LIMP2; alternatively, Scarb2), CD63, and CD1 and the melanosomal protein tyrosinase (Tyr; see the record for ghost) to facilitate the trafficking of these proteins to late endosome/lysosome compartments (5;11;28-33). AP-3B is known to traffic the zinc transporter ZnT3 [alternatively, solute carrier family 30, member 3 (Slc30a3)] in neurons (2;34;35). Loss of AP-3B expression/function in an Ap3d1 null mouse model (see below for more details) leads to deficiency of zinc in synaptic vesicles (12).  Newell-Litwa et al. showed that AP-3B determined synaptic vesicle composition and morphology distinctly in diverse brain regions through synaptic vesicle biogenesis regulation (10). 

Table 1. Select AP-3-associated cargo

Protein Known function Associated AP-3 complex References VSV-G Surface coat of enveloped viral particles AP-3A (23) HIV-1 Gag* Virus-like particle assembly AP-3A (26) LAMP1 and LAMP2 Lysosomal membrane proteins that maintain lysosome structure AP-3A (11) LIMP2 Lysosomal membrane protein that maintains lysosome structure and participates in membrane transportation AP-3A (29) CD63 Lysosomal membrane protein that complexes with integrins; blood platelet activation marker AP-3A (11;33) Tyr Melanosomal protein; see the record for ghost AP-3A (28-30) ZnT3 Zinc transporter on synaptic vesicles AP-3B (2;34;35) vGLUT1 Presynaptic marker of excitatory glutamatergic synapses AP-3B (10;34) CLC-3 Voltage-sensitive chloride channel on synaptic vesicles AP-3B (36) PI4K2A Phosphorylates PtdIns at the D-4 position in the process of PtdInsP synthesis AP-3A and AP-3B (37) CHT1 (alternatively, SLC5A7) Choline transporter in cholinergic neurons that controls the synthesis of acetylcholine; see the record for jimbee for information about the SLC5 family of solute carriers AP-3B (38) CD1/CD1d Functions in presentation of glycolipids (i.e., antigens) to natural killer T cells AP-3A (39;40) M5 Muscarinic acetylcholine receptor that promotes dopamine release from midbrain dopaminergic neurons AP-3B (41) Abbreviations: Arf1, ADP-ribosylation factor 1; VSV-G, vesicular stomatitis virus glycoprotein; HIV-1, human immunodeficiency virus type 1; LAMP1, lysosome-associated membrane proteins; LIMP2, lysosomal integral membrane protein 2; ZnT3, zinc transporter member 3; vGLUT1, vesicular glutamate transporter-1; CLC-3, voltage-sensitive chloride channel 3; PI4K2A, phosphatidylinositol-4-kinase type 2α; CHT, choline transporter   *The role of AP-3 in HIV-1 particle assembly through the transport of Gag is unclear (see text).

 

The christian mutation results in the conversion of alanine 97 to glutamic acid within the trunk domain of δ-adaptin.

Expression/Localization

Ap3d1 is expressed ubiquitously, but highest expression is in the skeletal muscle, heart, pancreas, and testis (7). Within the brain, Ap3d1 is distributed in neuronal, but not white matter, regions of the forebrain, brainstem, and cerebellum (12).

 

The AP-3A complex is ubiquitously expressed. Neuronal AP-3B is expressed throughout the brain (e.g., amygdala, cortex, hippocampus, and striatum), with abundant expression in the striatum and hippocampus at the pre-synaptic axonal compartments (10;41).  AP-3B is also expressed in dendrites, spines, unmyelinated axons, axon terminals, myelinated axons, and glia (10;12).

 

The AP-3 (both AP-3A and AP-3B) complex is mainly localized to the perinuclear region including in vesicles budding from the TGN, as well as to peripheral endosomes (7;12;13;42;43).  In melanocytes, AP-3 is localized to clathrin-coated buds on tubulovesicular elements adjacent to endosomal vacuoles and melanosomes (28). 

Background

Figure 4 . The HPS proteins form several protein complexes (AP-3, BLOC-1, BLOC-2, and BLOC-3) that are involved in trafficking of proteins to lysosomal-related organelles (LROs) from the TGN and affect the synthesis of these organelles (see the bullet gray entry for more information about the HPS complexes). Particular HPS complexes may affect only a subset of LROs. It is thought that BLOC-1 and AP-3 mediate early steps of vesicle trafficking from the early endosome, while BLOC-2 and BLOC-3 are likely involved at later stages. For simplicity, only the major cargo proteins affected by each HPS complex are shown (ATP7A, tyrosinase, Tyrp1, LAMP1). The presence of ATP7A in maturing melanosomes allows the influx of copper and activates tyrosinase. BLOC-2 and AP-3 may interact with clathrin. Melanosomal maturation is shown separately, along with the stages affected by mutations in each HPS complex. Mutations in the δ subunit of the AP-3 complex affect melanosomal maturation between stages III and IV, but, as mentioned above, the AP-3 complex likely mediates early vesicle trafficking.

Trafficking of proteins from a donor to acceptor membrane compartment involves the formation of a transport vesicle, a process mediated by protein complexes such as COP-II, AP-1, AP-2, and AP-3 (7;18;44). The AP complexes facilitate intracellular vesicle transport by interacting with signal motifs in the cytoplasmic domains of transmembrane proteins as well as by recruiting clathrin to form clathrin-coated vesicles and recruiting accessory proteins for vesicle formation (7;45). The AP-1 and AP-3 complexes bud from the TGN, while AP-2 buds from the plasma membrane to concentrate cargo proteins for delivery to endosomal compartments (7).

 

The AP-3A complex is involved in the biogenesis of lysosome-related organelles (LROs; e.g., platelet-dense granules and melanosomes) by directing the sorting of transmembrane cargo to those organelles (12;30;46;47) as well as the sorting of lysosomal membrane proteins to lysosomes [Figure 4; (5;11;18;46)]. Loss of AP-3 function results in defects of lysosomes and LROs as well as trafficking defects of integral lysosomal membrane proteins [see Table 1; (5;11;29;33;40;46)]. The neuron-specific isoform of AP-3 (AP-3B) mediates the biogenesis of endosome-derived synaptic vesicles and regulates protein sorting to these organelles in diverse brain regions (10;44;48). Loss of AP-3B function resulted in increased synaptic vesicle size in the dentate gyrus; in the striatum, loss of AP-3B resulted in decreased synaptic vesicle size in excitatory synaptic terminals (10). BLOC-1 regulates the brain region-specific effects of AP-3 by forming a complex with AP-3 in brain nerve terminals (10).

 

The mocha mouse model (Ap3d1^mh; MGI:1856083) is a naturally occurring Ap3d1 null mutant. The mocha mutation is an out-of-frame 10,639 base pair deletion corresponding to exons 2 to 6 in Ap3d1 that leads to an in-frame stop codon shortly after the deletion (12;49). Premature truncation of δ-adaptin leads to loss of both the AP-3A and AP-3B isoforms (12). Protein expression analysis of the other subunits of the AP-3 complex (β3, μ3, σ3) determined that each of the subunits were expressed at reduced or undetectable levels (12;49). The mRNA level of σ3A was normal, indicating that the changes in subunit expression were due to protein instability, not mRNA degradation (12;49). In addition, the existing AP-3 complex subunits in mocha assembled into heterodimers composed of the β3 and μ3 subunits; σ3 remained a monomer (18). The mocha model exhibits coat and eye pigment dilution due to melanosome trafficking defects, prolonged bleeding due to platelet dense granule trafficking defects, lytic granule defects in cytotoxic T cells, lysosomal abnormalities, trafficking defects in cytotoxic T lymphocytes and natural killer cell lytic granules, inner ear degeneration and balance problems due to otolith defects and degeneration of the organ of Corti, progressive cochlear degeneration leading to deafness by 3-6 months of age, photoreceptor degeneration leading to blindness by around postnatal day 10-15, neurological defects (i.e., hyperactivity and seizures) due to exocytosis (and possibly turnover) defects in a subset of synaptic vesicles in some neurons, and high perinatal mortality by 4 weeks of age (1;12;41;49-59). The mocha mice resemble mice with defects in the β3 AP-3 subunit (i.e., the pearl (Ap3b1^pe (MGI:1856989) and bullet gray models) with the exception of the neurological defects observed only in mocha mice that are caused by changes in the expression of the AP-3B subunits; the pearl neurons express functional β3B-containing complexes (55). A second spontaneous Ap3d1 allele, mocha^2J (mh^2J; MGI:1856084; (2)), results in a less severe phenotype than observed in mocha mice (12;55;56). The mh^2J mutation is an intracisternal A particle (IAP) insertion into intron 21 that results in a C-terminally truncated δ-adaptin protein of 858 amino acids (as opposed to wild type δ-adaptin at 1198 amino acids); small amounts of wild-type protein are expressed in mh^2J (2). Homozygous mh^2J mice exhibit variable decreased pigmentation of the eyes and coat depending on the genetic background, prolonged bleeding caused by storage pool defects in platelets, and a neurological phenotype of hyperactivity and tonic-clonic behavioral seizures (2). In contrast to the mocha strain, the mh^2J mice do not exhibit hearing loss (2).

 

AP-3 deficiency (often due to loss of δ-adaptin expression as well as mutations in other subunits of the AP-3 complex) is linked to Hermansky-Pudlak Syndrome 2 (HPS2; OMIM: #608233), a condition in which patients exhibit hypopigmentation, prolonged bleeding due to the platelet dense granule deficiency, reduced secretion of lysosomal enzymes into the urine, and pulmonary fibrosis; humans deficient in β3A are neurologically normal (18;60;61). The phenotypes associated with HPS2 are linked to defects in the sorting of membrane proteins from endosomes to lysosomes and LROs (60;61). 

Putative Mechanism

Similar to other Ap3d1 mutant mouse models, christian mice exhibit hypopigmentation. Studies using the mocha and mh^2J have established that the pigmentation defects are due to a loss of AP-3 function and, subsequently, trafficking defects in melanosomes of pigment cells (1;2;12). Other phenotypes associated with Ap3d1 deficiency have not been examined in the christian mice.

Primers

PCR Primer
christian_pcr_F: ATGTGAAGGCCCATGCTTGCTG
christian_pcr_R: TATGAGAACTAGGGTGCTGCCTCC

Sequencing Primer
christian_seq_F: GATCTCTCATCTGCTGAGACACAG
christian_seq_R: GCAATGAAGCTAGAACCATCTG

Genotyping

Christian genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Christian(F): 5’- ATGTGAAGGCCCATGCTTGCTG-3’

Christian(R): 5’- TATGAGAACTAGGGTGCTGCCTCC-3’

 

Sequencing Primer

Christian_seq(F): 5’- GATCTCTCATCTGCTGAGACACAG-3’
 

Christian_seq(R): 5’- GCAATGAAGCTAGAACCATCTG-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 477 nucleotides is amplified (Chr. 10: 80729820-80730296, GRCm38; NCBI RefSeq NC_000076):

 

atgtgaaggc ccatgcttgc tgagaccaga tctctcatct gctgagacac aggggatatg

agtgagaaag ctttgaaaag ctaccccagg caggtgggac tgtcagctag ctgatctttt

gtggctcact tgagtggcag gaaagcatca gggcctacct ttcggatctg gttggtggtc

agcatgatga cgtcggtacc ttcatggaag cactgggagg ccgcaaggta gccaacacgc

tgcagagtca acagccacag tgtcagaacc agagctacct aaagccccac caggagcact

caacaaacac cgggaaacac tgagggtgac agcagcaggg cacctggatc cccagctgag

cactgggcac agggttctga ggcctcctcc cctactgccc ctcccagcac atgcagatgg

ttctagcttc attgctgtac acacatgcac aggggaggca gcaccctagt tctcata

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (G>T, Chr. + strand (shown); C>A, sense strand).

References

  1. Lane, P. W., and Deol, M. S. (1974) Mocha, a New Coat Color and Behavior Mutation on Chromosome 10 of the Mouse. J Hered. 65, 362-364.

  2. Kantheti, P., Diaz, M. E., Peden, A. E., Seong, E. E., Dolan, D. F., Robinson, M. S., Noebels, J. L., and Burmeister, M. L. (2003) Genetic and Phenotypic Analysis of the Mouse Mutant mh2J, an Ap3d Allele Caused by IAP Element Insertion. Mamm Genome. 14, 157-167.

  3. Simpson, F., Bright, N. A., West, M. A., Newman, L. S., Darnell, R. B., and Robinson, M. S. (1996) A Novel Adaptor-Related Protein Complex. J Cell Biol. 133, 749-760.

  4. Dell'angelica, E. C., Ooi, C. E., and Bonifacino, J. S. (1997) Beta3A-Adaptin, a Subunit of the Adaptor-Like Complex AP-3. J Biol Chem. 272, 15078-15084.

  5. Le, B. R., Alconada, A., Bauer, U., and Hoflack, B. (1998) The Mammalian AP-3 Adaptor-Like Complex Mediates the Intracellular Transport of Lysosomal Membrane Glycoproteins. J Biol Chem. 273, 29451-29461.

  6. Schmid, S. L. (1997) Clathrin-Coated Vesicle Formation and Protein Sorting: An Integrated Process. Annu Rev Biochem. 66, 511-548.

  7. Simpson, F., Peden, A. A., Christopoulou, L., and Robinson, M. S. (1997) Characterization of the Adaptor-Related Protein Complex, AP-3. J Cell Biol. 137, 835-845.

  8. Ooi, C. E., Moreira, J. E., Dell'Angelica, E. C., Poy, G., Wassarman, D. A., and Bonifacino, J. S. (1997) Altered Expression of a Novel Adaptin Leads to Defective Pigment Granule Biogenesis in the Drosophila Eye Color Mutant Garnet. EMBO J. 16, 4508-4518.

  9. Lefrancois, S., Janvier, K., Boehm, M., Ooi, C. E., and Bonifacino, J. S. (2004) An Ear-Core Interaction Regulates the Recruitment of the AP-3 Complex to Membranes. Dev Cell. 7, 619-625.

  10. Newell-Litwa, K., Chintala, S., Jenkins, S., Pare, J. F., McGaha, L., Smith, Y., and Faundez, V. (2010) Hermansky-Pudlak Protein Complexes, AP-3 and BLOC-1, Differentially Regulate Presynaptic Composition in the Striatum and Hippocampus. J Neurosci. 30, 820-831.

  11. Peden, A. A., Oorschot, V., Hesser, B. A., Austin, C. D., Scheller, R. H., and Klumperman, J. (2004) Localization of the AP-3 Adaptor Complex Defines a Novel Endosomal Exit Site for Lysosomal Membrane Proteins. J Cell Biol. 164, 1065-1076.

  12. Kantheti, P., Qiao, X., Diaz, M. E., Peden, A. A., Meyer, G. E., Carskadon, S. L., Kapfhamer, D., Sufalko, D., Robinson, M. S., Noebels, J. L., and Burmeister, M. (1998) Mutation in AP-3 Delta in the Mocha Mouse Links Endosomal Transport to Storage Deficiency in Platelets, Melanosomes, and Synaptic Vesicles. Neuron. 21, 111-122.

  13. Dell'Angelica, E. C., Ohno, H., Ooi, C. E., Rabinovich, E., Roche, K. W., and Bonifacino, J. S. (1997) AP-3: An Adaptor-Like Protein Complex with Ubiquitous Expression. EMBO J. 16, 917-928.

  14. Newell-Litwa, K., Seong, E., Burmeister, M., and Faundez, V. (2007) Neuronal and Non-Neuronal Functions of the AP-3 Sorting Machinery. J Cell Sci. 120, 531-541.

  15. Suzuki, T., and Ikeda, H. (1998) The Mouse Homolog of the Bovine Leukemia Virus Receptor is Closely Related to the Delta Subunit of Adaptor-Related Protein Complex AP-3, Not Associated with the Cell Surface. J Virol. 72, 593-599.

  16. Robinson, M. S. (1989) Cloning of cDNAs Encoding Two Related 100-kD Coated Vesicle Proteins (Alpha-Adaptins). J Cell Biol. 108, 833-842.

  17. Robinson, M. S. (1990) Cloning and Expression of Gamma-Adaptin, a Component of Clathrin-Coated Vesicles Associated with the Golgi Apparatus. J Cell Biol. 111, 2319-2326.

  18. Peden, A. A., Rudge, R. E., Lui, W. W., and Robinson, M. S. (2002) Assembly and Function of AP-3 Complexes in Cells Expressing Mutant Subunits. J Cell Biol. 156, 327-336.

  19. Duden, R., Griffiths, G., Frank, R., Argos, P., and Kreis, T. E. (1991) Beta-COP, a 110 Kd Protein Associated with Non-Clathrin-Coated Vesicles and the Golgi Complex, shows Homology to Beta-Adaptin. Cell. 64, 649-665.

  20. Kirchhausen, T., Nathanson, K. L., Matsui, W., Vaisberg, A., Chow, E. P., Burne, C., Keen, J. H., and Davis, A. E. (1989) Structural and Functional Division into Two Domains of the Large (100- to 115-kDa) Chains of the Clathrin-Associated Protein Complex AP-2. Proc Natl Acad Sci U S A. 86, 2612-2616.

  21. Ponnambalam, S., Robinson, M. S., Jackson, A. P., Peiperl, L., and Parham, P. (1990) Conservation and Diversity in Families of Coated Vesicle Adaptins. J Biol Chem. 265, 4814-4820.

  22. Janvier, K., Kato, Y., Boehm, M., Rose, J. R., Martina, J. A., Kim, B. Y., Venkatesan, S., and Bonifacino, J. S. (2003) Recognition of Dileucine-Based Sorting Signals from HIV-1 Nef and LIMP-II by the AP-1 Gamma-sigma1 and AP-3 Delta-sigma3 Hemicomplexes. J Cell Biol. 163, 1281-1290.

  23. Nishimura, N., Plutner, H., Hahn, K., and Balch, W. E. (2002) The Delta Subunit of AP-3 is Required for Efficient Transport of VSV-G from the Trans-Golgi Network to the Cell Surface. Proc Natl Acad Sci U S A. 99, 6755-6760.

  24. Liu, L., Sutton, J., Woodruff, E., Villalta, F., Spearman, P., and Dong, X. (2012) Defective HIV-1 Particle Assembly in AP-3-Deficient Cells Derived from Patients with Hermansky-Pudlak Syndrome Type 2. J Virol. 86, 11242-11253.

  25. Garcia, E., Nikolic, D. S., and Piguet, V. (2008) HIV-1 Replication in Dendritic Cells Occurs through a Tetraspanin-Containing Compartment Enriched in AP-3. Traffic. 9, 200-214.

  26. Dong, X., Li, H., Derdowski, A., Ding, L., Burnett, A., Chen, X., Peters, T. R., Dermody, T. S., Woodruff, E., Wang, J. J., and Spearman, P. (2005) AP-3 Directs the Intracellular Trafficking of HIV-1 Gag and Plays a Key Role in Particle Assembly. Cell. 120, 663-674.

  27. Kyere, S. K., Mercredi, P. Y., Dong, X., Spearman, P., and Summers, M. F. (2012) The HIV-1 Matrix Protein does Not Interact Directly with the Protein Interactive Domain of AP-3delta. Virus Res. 169, 411-414.

  28. Theos, A. C., Tenza, D., Martina, J. A., Hurbain, I., Peden, A. A., Sviderskaya, E. V., Stewart, A., Robinson, M. S., Bennett, D. C., Cutler, D. F., Bonifacino, J. S., Marks, M. S., and Raposo, G. (2005) Functions of Adaptor Protein (AP)-3 and AP-1 in Tyrosinase Sorting from Endosomes to Melanosomes. Mol Biol Cell. 16, 5356-5372.

  29. Honing, S., Sandoval, I. V., and von Figura, K. (1998) A Di-Leucine-Based Motif in the Cytoplasmic Tail of LIMP-II and Tyrosinase Mediates Selective Binding of AP-3. EMBO J. 17, 1304-1314.

  30. Huizing, M., Sarangarajan, R., Strovel, E., Zhao, Y., Gahl, W. A., and Boissy, R. E. (2001) AP-3 Mediates Tyrosinase but Not TRP-1 Trafficking in Human Melanocytes. Mol Biol Cell. 12, 2075-2085.

  31. Calvo, P. A., Frank, D. W., Bieler, B. M., Berson, J. F., and Marks, M. S. (1999) A Cytoplasmic Sequence in Human Tyrosinase Defines a Second Class of Di-Leucine-Based Sorting Signals for Late Endosomal and Lysosomal Delivery. J Biol Chem. 274, 12780-12789.

  32. Ogata, S., and Fukuda, M. (1994) Lysosomal Targeting of Limp II Membrane Glycoprotein Requires a Novel Leu-Ile Motif at a Particular Position in its Cytoplasmic Tail. J Biol Chem. 269, 5210-5217.

  33. Rous, B. A., Reaves, B. J., Ihrke, G., Briggs, J. A., Gray, S. R., Stephens, D. J., Banting, G., and Luzio, J. P. (2002) Role of Adaptor Complex AP-3 in Targeting Wild-Type and Mutated CD63 to Lysosomes. Mol Biol Cell. 13, 1071-1082.

  34. Salazar, G., Craige, B., Love, R., Kalman, D., and Faundez, V. (2005) Vglut1 and ZnT3 Co-Targeting Mechanisms Regulate Vesicular Zinc Stores in PC12 Cells. J Cell Sci. 118, 1911-1921.

  35. Salazar, G., Love, R., Werner, E., Doucette, M. M., Cheng, S., Levey, A., and Faundez, V. (2004) The Zinc Transporter ZnT3 Interacts with AP-3 and it is Preferentially Targeted to a Distinct Synaptic Vesicle Subpopulation. Mol Biol Cell. 15, 575-587.

  36. Salazar, G., Love, R., Styers, M. L., Werner, E., Peden, A., Rodriguez, S., Gearing, M., Wainer, B. H., and Faundez, V. (2004) AP-3-Dependent Mechanisms Control the Targeting of a Chloride Channel (ClC-3) in Neuronal and Non-Neuronal Cells. J Biol Chem. 279, 25430-25439.

  37. Salazar, G., Craige, B., Wainer, B. H., Guo, J., De Camilli, P., and Faundez, V. (2005) Phosphatidylinositol-4-Kinase Type II Alpha is a Component of Adaptor Protein-3-Derived Vesicles. Mol Biol Cell. 16, 3692-3704.

  38. Misawa, H., Fujigaya, H., Nishimura, T., Moriwaki, Y., Okuda, T., Kawashima, K., Nakata, K., Ruggiero, A. M., Blakely, R. D., Nakatsu, F., and Ohno, H. (2008) Aberrant Trafficking of the High-Affinity Choline Transporter in AP-3-Deficient Mice. Eur J Neurosci. 27, 3109-3117.

  39. Elewaut, D., Lawton, A. P., Nagarajan, N. A., Maverakis, E., Khurana, A., Honing, S., Benedict, C. A., Sercarz, E., Bakke, O., Kronenberg, M., and Prigozy, T. I. (2003) The Adaptor Protein AP-3 is Required for CD1d-Mediated Antigen Presentation of Glycosphingolipids and Development of Valpha14i NKT Cells. J Exp Med. 198, 1133-1146.

  40. Sugita, M., Cao, X., Watts, G. F., Rogers, R. A., Bonifacino, J. S., and Brenner, M. B. (2002) Failure of Trafficking and Antigen Presentation by CD1 in AP-3-Deficient Cells. Immunity. 16, 697-706.

  41. Bendor, J., Lizardi-Ortiz, J. E., Westphalen, R. I., Brandstetter, M., Hemmings, H. C.,Jr, Sulzer, D., Flajolet, M., and Greengard, P. (2010) AGAP1/AP-3-Dependent Endocytic Recycling of M5 Muscarinic Receptors Promotes Dopamine Release. EMBO J. 29, 2813-2826.

  42. Sevilla, L. M., Richter, S. S., and Miller, J. (2001) Intracellular Transport of MHC Class II and Associated Invariant Chain in Antigen Presenting Cells from AP-3-Deficient Mocha Mice. Cell Immunol. 210, 143-153.

  43. Odorizzi, G., Cowles, C. R., and Emr, S. D. (1998) The AP-3 Complex: A Coat of Many Colours. Trends Cell Biol. 8, 282-288.

  44. Blumstein, J., Faundez, V., Nakatsu, F., Saito, T., Ohno, H., and Kelly, R. B. (2001) The Neuronal Form of Adaptor Protein-3 is Required for Synaptic Vesicle Formation from Endosomes. J Neurosci. 21, 8034-8042.

  45. Nakatsu, F., and Ohno, H. (2003) Adaptor Protein Complexes as the Key Regulators of Protein Sorting in the Post-Golgi Network. Cell Struct Funct. 28, 419-429.

  46. Dell'Angelica, E. C., Shotelersuk, V., Aguilar, R. C., Gahl, W. A., and Bonifacino, J. S. (1999) Altered Trafficking of Lysosomal Proteins in Hermansky-Pudlak Syndrome due to Mutations in the Beta 3A Subunit of the AP-3 Adaptor. Mol Cell. 3, 11-21.

  47. Rohn, W. M., Rouille, Y., Waguri, S., and Hoflack, B. (2000) Bi-Directional Trafficking between the Trans-Golgi Network and the endosomal/lysosomal System. J Cell Sci. 113 ( Pt 12), 2093-2101.

  48. Faundez, V., Horng, J. T., and Kelly, R. B. (1998) A Function for the AP3 Coat Complex in Synaptic Vesicle Formation from Endosomes. Cell. 93, 423-432.

  49. Drasbek, K. R., Holm, M. M., Delenclos, M., and Jensen, K. (2008) Mapping of the Spontaneous Deletion in the Ap3d1 Gene of Mocha Mice: Fast and Reliable Genotyping. BMC Res Notes. 1, 119-0500-1-119.

  50. Baguma-Nibasheka, M., and Kablar, B. (2009) Altered Retinal Cell Differentiation in the AP-3 Delta Mutant (Mocha) Mouse. Int J Dev Neurosci. 27, 701-708.

  51. Grabner, C. P., Price, S. D., Lysakowski, A., Cahill, A. L., and Fox, A. P. (2006) Regulation of Large Dense-Core Vesicle Volume and Neurotransmitter Content Mediated by Adaptor Protein 3. Proc Natl Acad Sci U S A. 103, 10035-10040.

  52. Swank, R. T., Reddington, M., Howlett, O., and Novak, E. K. (1991) Platelet Storage Pool Deficiency Associated with Inherited Abnormalities of the Inner Ear in the Mouse Pigment Mutants Muted and Mocha. Blood. 78, 2036-2044.

  53. Rolfsen, R. M., and Erway, L. C. (1984) Trace Metals and Otolith Defects in Mocha Mice. J Hered. 75, 159-162.

  54. Jones, S. M., Erway, L. C., Johnson, K. R., Yu, H., and Jones, T. A. (2004) Gravity Receptor Function in Mice with Graded Otoconial Deficiencies. Hear Res. 191, 34-40.

  55. Seong, E., Wainer, B. H., Hughes, E. D., Saunders, T. L., Burmeister, M., and Faundez, V. (2005) Genetic Analysis of the Neuronal and Ubiquitous AP-3 Adaptor Complexes Reveals Divergent Functions in Brain. Mol Biol Cell. 16, 128-140.

  56. Miller, C. L., Burmeister, M., and Stevens, K. E. (1999) Hippocampal Auditory Gating in the Hyperactive Mocha Mouse. Neurosci Lett. 276, 57-60.

  57. Noebels, J. L., and Sidman, R. L. (1989) Persistent Hypersynchronization of Neocortical Neurons in the Mocha Mutant of Mouse. J Neurogenet. 6, 53-56.

  58. Jones, S. M., Johnson, K. R., Yu, H., Erway, L. C., Alagramam, K. N., Pollak, N., and Jones, T. A. (2005) A Quantitative Survey of Gravity Receptor Function in Mutant Mouse Strains. J Assoc Res Otolaryngol. 6, 297-310.

  59. Qiao, X., Pennesi, M., Seong, E., Gao, H., Burmeister, M., and Wu, S. M. (2003) Photoreceptor Degeneration and rd1 Mutation in the grizzled/mocha Mouse Strain. Vision Res. 43, 859-865.

  60. Di Pietro, S. M., and Dell'Angelica, E. C. (2005) The Cell Biology of Hermansky-Pudlak Syndrome: Recent Advances. Traffic. 6, 525-533.

  61. Li, W., Rusiniak, M. E., Chintala, S., Gautam, R., Novak, E. K., and Swank, R. T. (2004) Murine Hermansky-Pudlak Syndrome Genes: Regulators of Lysosome-Related Organelles. Bioessays. 26, 616-628.