Phenotypic Mutation 'swagger'

• Allele: swagger
• Mutation Type: synonymous
• Chromosome: 6
• Coordinate: 64,372,263 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Grid2
• Gene Name: glutamate receptor, ionotropic, delta 2
• Synonym(s): tpr, B230104L07Rik, GluRdelta2
• Chromosomal Location: 63,232,860-64,681,307 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014] ; PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q61625
• SMART Domains: Protein: ENSMUSP00000093536; Gene: ENSMUSG00000071424

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: Unknown
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos, Sperm, gDNA
• Last Updated: 2018-05-22 9:43 AM by Anne Murray
• Record Created: unknown
• Record Posted: 2009-05-15
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Lei Sun, Alyson Affleck, Bruce Beutler

Accession Number

NCBI RefSeq: NM_008167; MGI: 95813

Alleles Listed at MGI

All alleles(29) : Targeted, knock-out(2) Targeted, other(3) Gene trapped(2) Transgenic(2) Spontaneous(18) Chemically induced(2)

Repository

none

Phenotypic Description

The swagger phenotype was identified in three littermates among ENU-mutagenized G3 mice.  Homozygous swagger mice appear somewhat lethargic, with a wobbling gait that is more pronounced upon movement.  They have trouble keeping balance and exhibit an altered gait characterized by exaggerated high stepping of the hind legs.  Swagger mice can swim well; hind limbs perform actively in the water.  Homozygous male mice are sterile.

Nature of Mutation

The swagger mutation was mapped to Chromosome 6, and corresponds to a T to A transversion at position 1944 of the Grid2 transcript, in exon 12 of 16 total exons.

1927 ATTGTCATCTCATCTTATACAGCCAACCTTGCC
643  -I--V--I--S--S--*
 
The mutated nucleotide is indicated in red lettering, and converts the codon for tyrosine 648 to a stop codon.

Protein Prediction

Glutamate receptor ion channels (ionotropic glutamate receptors, iGluR), which are nonselective for monovalent cations (and sometimes Ca²⁺ permeable), are the major mediators of excitatory synaptic transmission in the central nervous system. Three subtypes, the AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate), kainate, and NMDA (N-methyl-D-aspartate) receptors, were identified pharmacologically, based on their activation by the exogenous agonists after which they are named. A fourth subfamily, which consists of the δ1 and δ2 glutamate receptors (GluRδ1 and GluRδ2), was discovered in 1993 by low stringency screening of mouse and rat brain cDNA libraries using AMPA receptor probes (1-3). The amino acid sequences of GluRδ1 and GluRδ2 are 56% identical to each other, approximately 20-25% identical to AMPA and kainate receptors, and approximately 15-20% identical to NMDA receptors (2;3). 

 

Figure 1. Domain organization (top) and membrane topography of GluRδ2 (bottom). The domains are labeled as explained in the text. The SYTANLAAF sequence motif in the M3 transmembrane helix is indicated, with the alanine mutated in Lurcher mice and the tyrosine mutated in swagger mice indicated. The ligand binding pocket formed by the two lobes D1 and D2 is shown as filled with either glycine or D-serine, which have been shown to bind to GluRd2 with low affinity. Not to scale.

iGluRs are tetramers arranged as a dimer of dimers (4-6). Biophysical and structural studies have revealed that each subunit has a characteristic modular architecture with four domains: the N-terminal domain (NTD), the ligand- or agonist-binding domain (LBD), the transmembrane region, and the C-terminal domain (CTD) (Figure 1) [reviewed in (7;8)]. The extracellular NTD, which shares homology with leucine-isoleucine-valine-binding protein (LIVBP), a bacterial periplasmic binding protein, mediates dimer formation and controls heteromer formation among members of the same iGluR subfamily (9). Also localized extracellularly is the LBD, encoded by two polypeptide segments, S1 and S2, which are separated by amino acids that make up part of the transmembrane portion of the protein. S1 and S2 share sequence and structural homology with the bacterial periplasmic proteins lysine-arginine-ornithine-binding protein (LAOBP) and glutamine-binding protein (QBP) (10). The most divergent region in iGluRs is the C-terminal cytoplasmic domain, which varies in size from less than 20 to 500 amino acids, and interacts with kinases, phosphatases, and other postsynaptic density (PSD) proteins. The CTD is important for proper delivery of the receptor to the membrane (11;12), for clustering the receptor at the PSD (13;14), and for maintaining stable localization of the receptor at the PSD (15).

 

Bacterial expression of the AMPA receptor GluR2 S1 and S2 segments joined by a linker produces a soluble, crystallizable protein representing the LBD (5;16;17), a strategy also used to crystallize the putative LBD of GluRδ2 (18). These studies revealed that S1 and S2 form a clam shell-like structure with two lobes, designated D1 and D2. S1 and S2 each contribute amino acids to both lobes. In the GluR2 LBD structure, the agonist binding site is located in the opening between the two lobes. Most iGluR agonists, such as glutamate, AMPA, and kainate, are amino acids, and their α-amino and α-carboxyl groups dock on the D1 lobe. D2 is then attracted by the γ-carboxyl group and rotates (approximately 21° for glutamate or AMPA binding to GluR2) to close the clam shell structure, locking the agonist in its binding pocket. Thus, agonist binding activates the receptor by inducing a switch from a relaxed, expanded conformation in which the two lobes are open, to a closed conformation that sequesters the agonist in the cleft between lobes. Full agonists induce tighter closure of the D1 and D2 lobes than partial agonists (5). Receptor dimers are held together by extensive interactions between D1 residues from their LBDs.

 

Figure 2. Crystal structure of the LBD formed by the fused S1 and S2 segments of GluRd2. Side (A) and top (B) views of the dimer, with Ca²⁺ ions at the dimer interface. The D-serine bound monomer is shown in (C). UCSF Chimera structure is based on PDB 2V3T (A and B) and 2V3U (C), Naur et al, Proc. Natl. Acad. Sci. U.S.A. 104, 14116-14121 (2007). Click on each 3D structure to view it rotate.

The unliganded GluRδ2 LBD forms a bi-lobed structure, and assembles into a twofold symmetric dimer similar to the GluR2 and NMDA receptor NR1 LBDs (PDB ID 2V3T; Figure 2A and 2B) (18;19). Two Ca²⁺ ions are bound at the GluRδ2 dimer interface. Isothermal titration calorimetry experiments showed that D-serine and glycine are able to bind to the GluRδ2 LBD with K_d values in the low millimolar range (i.e. with relatively low affinity), the first demonstration of the identity of GluRδ2 ligands. The crystal structure of GluRδ2 bound to D-serine revealed a similar binding mode as D-serine binding to the NMDA receptor NR1 (PDB ID 2V3U; Figure 2C) (19). However, an important hydrogen bond coordinating D-serine in the binding cavity is mediated by different amino acids in GluRδ2 and NR1. Whereas serine 688 anchors the β-hydroxy group of D-serine in NR1, a tyrosine residue (Y543) from the D1-D2 linker region provides this hydrogen bond in GluRδ2. Also, D-serine alone completely fills the ligand binding cavity of GluRδ2, but in NR1, three water molecules are present with D-serine in the binding cavity. Although it is assumedthat GluRδ2 forms ligand-gated ion channels, none of the iGluRagonists including D-serine and glycine, or any other known compound, induce measurable currentresponses from wild type GluRδ2 (3;18). Coexpression of GluRδ2 with other glutamate receptors also failed to elicit current flow. To date, no molecules able to open the GluRδ2 channel have been found.

 

The transmembrane regions of iGluRs form the ion channel pore, and consist of three α-helices (M1, M3, and M4) and a membrane-inserted pore loop (P or M2) (Figure 1). The pore loop determines the ion selectivity of the channel pore (20). The amino acid sequence of the channel pore is highly homologous to that of K⁺ channels, to which it is related evolutionarily (21;22) (see the record for mayday that describes Kir6.1, a member of inwardly rectifying K⁺ channels). However, in all iGluRs the channel orientation in the membrane is inverted compared to that of classical K⁺ channels, and contains an extra transmembrane helix (M4) with essential but unknown function (20;23). In addition, iGluRs are arranged as a dimer of dimers (4-6), while K⁺ channels are tetramers with four-fold symmetry. The major pore-lining domain of glutamate receptors is the M3 helix, which corresponds to the inner or M2 helix of K⁺ channels, and is extensively involved in channel gating (24-26). In the NMDA receptor, M3 domains allosterically interact with both the channel gate and the LBD and mediate their coupling, such that ligand binding changes the conformation of TM3 and in turn the probability of channel opening (26). Present in the M3 domain of all glutamate receptors is the sequence motif SYTANLAAF, which is the most highly conserved motif among glutamate receptors.  Mutation of residues in this motif strongly alter channel function (24;25).

 

The swagger mutation occurs within the most highly conserved iGluR motif, the SYTANLAAF sequence within the M3 helix, and converts the tyrosine residue to a stop.

Expression/Localization

GluRδ2 mRNA is exclusively expressed in Purkinje cells of the cerebellum (2;3)(Figure 3). In the adult rat brain, an antibody against a C-terminal domain peptide (also reactive against GluRδ1) detects GluRδ2 reactivity most strongly in the cerebellum, and there in Purkinje cell bodies and postsynaptic densities of spines forming synapses with parallel fibers (27). GluRδ2 mRNA is expressed as early as embryonic day 15 in Purkinje cell neuroblasts (28), but Western blotting shows little cerebellar protein expression until postnatal day 15, when GluRδ2 is dramatically upregulated (27). GluRδ2 appears to be expressed in both dendritic shafts and spines in the early postnatal period, but by postnatal day 21 when Purkinje cells have reached maturity, GluRδ2 becomes restricted to dendritic spines (28;29). Within spines, GluRδ2 is most highly localized at the postsynaptic density of synapses with parallel fibers. 

 

Purkinje cells receive two types of excitatory input, from parallel fibers of granule cells in the granular layer of the cerebellum, or climbing fibers that originate from inferior olivary neurons in the brainstem. Both types of input develop during the first two postnatal weeks, although the timecourse of development differs between them. Climbing fibers begin forming synapses by postnatal day 2, while parallel fibers begin between postnatal days 7-10. Inputs from climbing fibers are restricted to the proximal dendrites of Purkinje cells; parallel fibers synapses are found on the distal portion of the dendritic tree.  At postnatal day 10, GluRδ2 is expressed in both climbing fiber and parallel fiber synapses, but by adulthood, its expression becomes restricted to parallel fiber synapses (30-32). This selective targeting of GluRδ2 to parallel fiber synapses is activity-dependent. Block of neuronal activity with tetrodotoxin (TTX) induces a redistribution of GluRδ2 to all Purkinje cell spines (33). 

 

GluRδ2 has also been detected in a population of glial-like cells in rat pineal glands in culture (34).

Background

The amino acid glutamate is the major excitatory amino acid in the mammalian brain, mediating an estimated 50% of all synaptic transmission in the CNS [reviewed in (35)]. Glutamate is synthesized, stored, released from the presynaptic terminal, and acts through both ligand-gated ion channels (ionotropic glutamate receptors) and G-protein coupled receptors (metabotropic glutamate receptors) on postsynaptic neurons. Activation of these receptors accounts for basal excitatory synaptic transmission and synaptic plasticity, such as long-term potentiation (LTP) and long-term depression (LTD) that are thought to underlie learning and memory. Glutamatergic synaptic transmission is implicated in nearly all aspects of normal brain function, including learning, memory, movement, cognition, and development. However, at elevated concentrations that excessively stimulate the same receptors, glutamate acts as a neurotoxin capable of causing extensive neuronal damage and death. Thus, the brain maintains very low intrasynaptic concentrations of glutamate by the action of glutamate transporters present in the plasma membrane of both glial cells and neurons.

 

An array of receptors representing homo- and heteromers of the three subtypes of glutamate receptor is present on neuronal membranes, and transduces signals through increased ion flux and second messenger signaling pathways (see Protein Prediction). The glutamate receptor ion channels display distinct electrophysiological properties, including channel selectivity for Na⁺, K⁺, and Ca²⁺. Glutamate receptors are also characterized by their pharmacological profiles, including sensitivity to glutamate analogues and by the features of the glutamate-elicited current. In these aspects, the two GluRδ proteins, designated as glutamate ion channels based on their sequence similarity to other iGluRs, remain mysterious (1-3). Both GluRδ1 and GluRδ2 are insensitive to common iGluR agonists, and so far no ligand able to activate the wild type channel has been identified (3;18;27). 

 

The discovery that the phenotype of Lurcher (Lc) mice is caused by a point mutation in GluRδ2 was an enormous breakthrough in the study of these channels (36). The Lurcher mutation is an alanine to threonine point mutation of the third alanine (A654) within the SYTANLAAF sequence motif of GluRδ2 (36). GluRδ2^Lc mutant channels are spontaneously active, permitting a large constitutive cationic current in the absence of ligand. Since no GluRδ2 agonists are known, all electrophysiological characterization of GluRδ2 receptors has focused on the spontaneous activity of mutant channels with the Lurcher mutation. Examination of the current-volage relationship revealed that GluRδ2^Lc channel currents are doubly rectified, in that current flows more easily at membrane potentials lower than +20 mV or higher than +70 mV (25;37). This property resembles that of AMPA and kainate receptors which contain, like GluRδ2, a glutamine residue at the tip of the pore loop. Spontaneous current through Lurcher channels is potentiated by extracellular Ca²⁺ (37), whereas extracellular protons reduce current flow as they do for the NMDA receptor (38). The open GluRδ2^Lc channels are blocked by several chemicals that also inhibit NMDA receptors (pentamidine; 9-tetrahydroaminoacridine, 9-THA) (38).

 

Figure 3. Overview of cell types in the cerebellum. The cerebellum functions in fine motor control. Cellular components of the cerebellum include Purkinje cells, granule cells, mossy fibers, and deep cerebellar nuclei. Mossy fibers enter the granule cell layer and synapse onto granule cells. Granule cells, which receive excitatory input from mossy fi bers, send axons into the molecular layer where they split to form parallel fi bers. Purkinje cell bodies are oriented in a single layer of the cerebellum (Purkinje cell layer), with their characteristic, extensive dendritic arbors occupying the molecular layer within which they receive synaptic input from the parallel fibers. Climbing fibers originating from the inferior olive split into multiple terminal branches that also innervate Purkinje cell dendrites in the molecular layer. The deep cerebellar nuclei receive inhibitory input from Purkinje cells and excitatory input from mossy fibers and climbing fibers. The deep cerebellar nuclear cells generate signals that can modify movements already begun.

The function of mutant GluRδ2^Lc channels is associated with the semidominant Lurcher phenotype that arose spontaneously in 1954 in the mouse colony of the MRC Harwell, England. Newborn homozygotes have a reduced body weight, lack milk in their stomach, and die within one day after birth, likely due to autonomous death between embryonic day 15 and birth of all large trigeminal motor neurons, which are required for suckling (39). Lurcher heterozygotes are smaller than normal at maturity, but are fertile and have a normal lifespan. Lc/+ mice show a swaying of the hindquarters, a jerky up and down movement, and a tendency to fall in their attempts to walk, which are visible by 12 to 14 days of age (40;41). Walking also involves exaggerated hindlimb flexion. These phenotypes result from the complete cell autonomous loss of Lc/+ cerebellar Purkinje cells from around postnatal day 8 through day 65 (42;43). This is followed by the loss of 90% of granule cells and 75% of inferior olivary neurons (44), due to the loss of their primary target neurons, the Purkinje cells (45)(Figure 3).  Depending on the age of the mutant, Purkinje cell appearance can range from normal to stunted, with multiple primary dendrites (43).

 

The mechanisms of GluRδ2^Lc-induced Purkinje cell death have yet to be definitively established, although much research has focused on this topic [reviewed in (46)]. Studies suggest that Lurcher Purkinje cells are apoptotic, as demonstrated by TUNEL staining, increased Bax and Bcl-x expression, and increased pro-caspase 3 levels (47-49). In addition, GluRδ2Lc has been proposed to trigger an autophagic cell death pathway through its failure to sequester the PDZ/coiled domain protein n-PIST and the Bcl-2-interacting protein Beclin (50). Autophagosome-like vesicles have been observed in Lc/+ Purkinje cells (50;51). However, the steps leading from autophagy to death in Lc/+ Purkinje cells are unknown. Increased oxidative stress may also contribute to Purkinje cell death in Lurcher mice (52).

 

The importance of GluRδ2 for other Purkinje cell functions has been demonstrated using mice with a targeted deletion of the protein. GluRδ2-deficient mice display impaired motor coordination, with ataxia observable by postnatal day 12 (53). These mice walk with tottering steps, and lose balance and roll when they rear up on their hind legs. In general they are less active than their wild type littermates. When made to walk on a narrow, elevated runway, Grid2^-/- mice walk slowly and frequently slip, unlike wild type mice that run quickly with few slips. Grid2^-/- mice also fall off a rotating rod more quickly than wild type mice. The cerebellum of adult Grid2^-/- mice shows a normal architecture and characteristic cellular organization, and Purkinje cells have dendritic arbors comparable in size and in number of spines to those of wild type mice. However, the number of spines forming synapses with parallel fibers is reduced by half, aberrant multiple innervation of Purkinje cells by climbing fibers persists in the adult (a one-to-one climbing fiber to Purkinje cell innervation is normal), and numerous free spines are found (54-56). In mice with a floxed allele of Grid2, induction of Cre recombinase specifically in GluRδ2-expressing cells, resulted in progressive shrinking of parallel fiber presynaptic active zones, mismatching between presynaptic active zones and Purkinje cell postsynaptic densities, and the emergence of free spines (57). Together, these findings suggest that GluRδ2 contributes to the stabilization of parallel fiber-Purkinje cell synapses, restricts climbing fiber synapses to proximal dendrites, and prevents ectopic climbing fiber synapse formation.

 

Long term depression (LTD), the persistent, activity-dependent depression of synaptic transmission, is the main form of synaptic plasticity at the parallel fiber-Purkinje cell synapse. GluRδ2 is required for cerebellar LTD, as shown in GluRδ2-deficient cerebellar slices and in cerebellar cultures after knockdown of GluRδ2 expression (53;58;59). LTD is thought to underlie motor learning, and Grid2^-/- mice display defects in eye movement, blink conditioning and vestibular compensation (60-62), and develop involuntary spontaneous eye movements synchronized with action potential firing by Purkinje cells (63). Surprisingly, transgenic expression of mutant GluRδ2 proteins in GluRδ2-deficient mice suggest that the CTD, but not the ligand-binding or ion channel capabilities of GluRδ2, is necessary for LTD (64-66). Functional studies with a blocking antibody showed that GluRδ2 may regulate LTD by controlling AMPA receptor endocytosis (67).

 

The 172 amino acid C-terminus of GluRδ2 interacts with a variety of postsynaptic proteins in yeast two-hybrid experiments, several of which are essential for the induction of LTD. GluRδ2 binds directly to the PDZ domain of Shank proteins, which are linked to AMPA receptors via glutamate receptor interacting protein 1 (GRIP1) and to mGluR1 via Homer (68). The CTD of GluRδ2 has also been shown to interact with protein interacting with C kinase 1 (PICK1), a protein required for LTD (69). Finally, GluRδ2 interacts with the MAGUK (membrane-associated guanylate kinase) S-SCAM (synaptic scaffolding molecule), an interaction enhanced upon phosphorylation of the receptor by PKC after LTD induction (14). Despite the identification of numerous interactors, the role of GluRδ2 in LTD is not understood.

Putative Mechanism

The phenotype of swagger mice resembles those of Grid2^-/- mice, as well as heterozygous Lurcher mice. Although protein expression of GluRδ2 has not been examined, two reasons suggest that the swagger mutation results effectively in a protein null phenotype rather than a gain-of-function phenotype causing massive Purkinje cell death such as that observed in Lurcher mice. First, the mutation creates a premature stop codon, which is likely to disrupt protein stability and lead to degradation. Second, like the Grid2 null allele and the hotfoot alleles (mainly deletions of portions of the CTD), the swagger mutation is recessive. In contrast, the Lurcher mutation causes death when present in homozygous form. Examination of cerebellar architecture has not been performed in swagger mice.

Primers

Primers cannot be located by automatic search.

Genotyping

Swagger genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.  This protocol has not been tested.

 

Primers

swagger (F): 5’- TTGTGAATAGCCCAGTCCTTGGAAAC -3’

swagger (R): 5’-CTGTTACTGATGCTAGAGAAAGAGCAGC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

swagger_seq(F): 5’- GCCCAGTCCTTGGAAACAAAATATG -3’

swagger_seq(R): 5’- GTGACACCTGGAATTATGCCTAC -3’

 

The following sequence of 1135 nucleotides (from Genbank genomic region NC_000072 for linear genomic sequence of Grid2 [Chr6:64394888-64396022) is amplified:

 

ttgtgaatag cccagtcctt ggaaacaaaa tatgtatttg tgactataat aaggaattga
ttttagaatt aaaggagaaa gaattatcat ttcaatgtat tttgtagaat atttatcatg
cttcttttta acacagccag acataattcc atagaagatc atcaaaaacc aagtattaaa
atatggaggt ctccagagtt tttaagggaa acgtttcttg ttgtctgtct tggcactgaa
tgtgtatgac ttcagtttct caataaaagc atattgatgt tgttgtcatc tctcctcttt
ccacaggtgg ggaagtccca tacacaactc tggcaacccg aatgatgatg ggggcttggt
ggttatttgc tctgattgtc atctcatctt atacagccaa ccttgccgct ttcctcacta
tcacccgcat tgagagctcc atccagtaag taggcataat tccaggtgtc accaaacctg
acaaatgctg ggcatgccac aaggaaagcc ctctgcacat aaagttgcac taccttataa
taaattgtca ctctcttttt gacaagaagc ttaatcctat gattcttcag aatatcaatc
ctaaataatt tattttataa aatgttgatt ataacttaat tctgtatttt cctggaataa
taacagatca tcaaaaattt aaccttcata gaggatagct atgtcagggc aggagaaatt
attcaaaacc atcctcaact tcatttcaca gagatctcat atcctctatt gactctaaca
tcattgcaca tgcatagtga cagacataca tggatgcaga agcataaaat aaaaataagt
aaatctttaa acataaacta tgtcagagaa aaattatgaa aaaaaaagta taaataattt
taggaaatta aaatgccctt ttttaaaata agtttgtgca atcacagttg atggctaaat
ttattctgtg ggtgagggag taaggagaga agaggacaat ggaagataag aagagagagg
ggaaaagagg atagcaggta acagaaactc tatcatagtg accacattct gtttcttgtc
tgcattaata cccacgtggc caacactgct gctctttctc tagcatcagt aacag

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

   1. Yamazaki, M., Araki, K., Shibata, A., and Mishina, M. (1992) Molecular Cloning of a cDNA Encoding a Novel Member of the Mouse Glutamate Receptor Channel Family. Biochem. Biophys. Res. Commun. 183, 886-892.

   2. Araki, K., Meguro, H., Kushiya, E., Takayama, C., Inoue, Y., and Mishina, M. (1993) Selective Expression of the Glutamate Receptor Channel Delta 2 Subunit in Cerebellar Purkinje Cells. Biochem. Biophys. Res. Commun. 197, 1267-1276.

   3. Lomeli, H., Sprengel, R., Laurie, D. J., Kohr, G., Herb, A., Seeburg, P. H., and Wisden, W. (1993) The Rat Delta-1 and Delta-2 Subunits Extend the Excitatory Amino Acid Receptor Family. FEBS Lett. 315, 318-322.

   4. Sobolevsky, A. I., Yelshansky, M. V., and Wollmuth, L. P. (2004) The Outer Pore of the Glutamate Receptor Channel has 2-Fold Rotational Symmetry. Neuron. 41, 367-378.

   5. Armstrong, N., and Gouaux, E. (2000) Mechanisms for Activation and Antagonism of an AMPA-Sensitive Glutamate Receptor: Crystal Structures of the GluR2 Ligand Binding Core. Neuron. 28, 165-181.

   6. Sun, Y., Olson, R., Horning, M., Armstrong, N., Mayer, M., and Gouaux, E. (2002) Mechanism of Glutamate Receptor Desensitization. Nature. 417, 245-253.

   7. Mayer, M. L. (2006) Glutamate Receptors at Atomic Resolution. Nature. 440, 456-462.

   8. Dingledine, R., Borges, K., Bowie, D., and Traynelis, S. F. (1999) The Glutamate Receptor Ion Channels. Pharmacol. Rev. 51, 7-61.

   9. Ayalon, G., Segev, E., Elgavish, S., and Stern-Bach, Y. (2005) Two Regions in the N-Terminal Domain of Ionotropic Glutamate Receptor 3 Form the Subunit Oligomerization Interfaces that Control Subtype-Specific Receptor Assembly. J. Biol. Chem. 280, 15053-15060.

 10. Stern-Bach, Y., Bettler, B., Hartley, M., Sheppard, P. O., O'Hara, P. J., and Heinemann, S. F. (1994) Agonist Selectivity of Glutamate Receptors is Specified by Two Domains Structurally Related to Bacterial Amino Acid-Binding Proteins. Neuron. 13, 1345-1357.

 11. Matsuda, I., and Mishina, M. (2000) Identification of a Juxtamembrane Segment of the Glutamate Receptor delta2 Subunit Required for the Plasma Membrane Localization. Biochem. Biophys. Res. Commun. 275, 565-571.

 12. Matsuda, S., Hannen, R., Matsuda, K., Yamada, N., Tubbs, T., and Yuzaki, M. (2004) The C-Terminal Juxtamembrane Region of the Delta 2 Glutamate Receptor Controls its Export from the Endoplasmic Reticulum. Eur. J. Neurosci. 19, 1683-1690.

 13. Roche, K. W., Ly, C. D., Petralia, R. S., Wang, Y. X., McGee, A. W., Bredt, D. S., and Wenthold, R. J. (1999) Postsynaptic Density-93 Interacts with the delta2 Glutamate Receptor Subunit at Parallel Fiber Synapses. J. Neurosci. 19, 3926-3934.

 14. Yap, C. C., Muto, Y., Kishida, H., Hashikawa, T., and Yano, R. (2003) PKC Regulates the delta2 Glutamate Receptor Interaction with S-SCAM/MAGI-2 Protein. Biochem. Biophys. Res. Commun. 301, 1122-1128.

 15. Matsuda, S., Matsuda, K., and Yuzaki, M. (2006) A New Motif Necessary and Sufficient for Stable Localization of the delta2 Glutamate Receptors at Postsynaptic Spines. J. Biol. Chem. 281, 17501-17509.

 16. Armstrong, N., Sun, Y., Chen, G. Q., and Gouaux, E. (1998) Structure of a Glutamate-Receptor Ligand-Binding Core in Complex with Kainate. Nature. 395, 913-917.

 17. Chen, G. Q., and Gouaux, E. (1997) Overexpression of a Glutamate Receptor (GluR2) Ligand Binding Domain in Escherichia Coli: Application of a Novel Protein Folding Screen. Proc. Natl. Acad. Sci. U. S. A. 94, 13431-13436.

 18. Naur, P., Hansen, K. B., Kristensen, A. S., Dravid, S. M., Pickering, D. S., Olsen, L., Vestergaard, B., Egebjerg, J., Gajhede, M., Traynelis, S. F., and Kastrup, J. S. (2007) Ionotropic Glutamate-Like Receptor delta2 Binds D-Serine and Glycine. Proc. Natl. Acad. Sci. U. S. A. 104, 14116-14121.

 19. Furukawa, H., and Gouaux, E. (2003) Mechanisms of Activation, Inhibition and Specificity: Crystal Structures of the NMDA Receptor NR1 Ligand-Binding Core. EMBO J. 22, 2873-2885.

 20. Wollmuth, L. P., and Sobolevsky, A. I. (2004) Structure and Gating of the Glutamate Receptor Ion Channel. Trends Neurosci. 27, 321-328.

 21. Panchenko, V. A., Glasser, C. R., and Mayer, M. L. (2001) Structural Similarities between Glutamate Receptor Channels and K(+) Channels Examined by Scanning Mutagenesis. J. Gen. Physiol. 117, 345-360.

 22. Chen, G. Q., Cui, C., Mayer, M. L., and Gouaux, E. (1999) Functional Characterization of a Potassium-Selective Prokaryotic Glutamate Receptor. Nature. 402, 817-821.

 23. Schorge, S., and Colquhoun, D. (2003) Studies of NMDA Receptor Function and Stoichiometry with Truncated and Tandem Subunits. J. Neurosci. 23, 1151-1158.

 24. Beck, C., Wollmuth, L. P., Seeburg, P. H., Sakmann, B., and Kuner, T. (1999) NMDAR Channel Segments Forming the Extracellular Vestibule Inferred from the Accessibility of Substituted Cysteines. Neuron. 22, 559-570.

 25. Kohda, K., Wang, Y., and Yuzaki, M. (2000) Mutation of a Glutamate Receptor Motif Reveals its Role in Gating and delta2 Receptor Channel Properties. Nat. Neurosci. 3, 315-322.

 26. Jones, K. S., VanDongen, H. M., and VanDongen, A. M. (2002) The NMDA Receptor M3 Segment is a Conserved Transduction Element Coupling Ligand Binding to Channel Opening. J. Neurosci. 22, 2044-2053.

 27. Mayat, E., Petralia, R. S., Wang, Y. X., and Wenthold, R. J. (1995) Immunoprecipitation, Immunoblotting, and Immunocytochemistry Studies Suggest that Glutamate Receptor Delta Subunits Form Novel Postsynaptic Receptor Complexes. J. Neurosci. 15, 2533-2546.

 28. Takayama, C., Nakagawa, S., Watanabe, M., Mishina, M., and Inoue, Y. (1996) Developmental Changes in Expression and Distribution of the Glutamate Receptor Channel Delta 2 Subunit According to the Purkinje Cell Maturation. Brain Res. Dev. Brain Res. 92, 147-155.

 29. Takayama, C., Nakagawa, S., Watanabe, M., Mishina, M., and Inoue, Y. (1995) Light- and Electron-Microscopic Localization of the Glutamate Receptor Channel Delta 2 Subunit in the Mouse Purkinje Cell. Neurosci. Lett. 188, 89-92.

 30. Zhao, H. M., Wenthold, R. J., Wang, Y. X., and Petralia, R. S. (1997) Delta-Glutamate Receptors are Differentially Distributed at Parallel and Climbing Fiber Synapses on Purkinje Cells. J. Neurochem. 68, 1041-1052.

 31. Landsend, A. S., Amiry-Moghaddam, M., Matsubara, A., Bergersen, L., Usami, S., Wenthold, R. J., and Ottersen, O. P. (1997) Differential Localization of Delta Glutamate Receptors in the Rat Cerebellum: Coexpression with AMPA Receptors in Parallel Fiber-Spine Synapses and Absence from Climbing Fiber-Spine Synapses. J. Neurosci. 17, 834-842.

 32. Petralia, R. S., Zhao, H. M., Wang, Y. X., and Wenthold, R. J. (1998) Variations in the Tangential Distribution of Postsynaptic Glutamate Receptors in Purkinje Cell Parallel and Climbing Fiber Synapses during Development. Neuropharmacology. 37, 1321-1334.

 33. Morando, L., Cesa, R., Rasetti, R., Harvey, R., and Strata, P. (2001) Role of Glutamate Delta -2 Receptors in Activity-Dependent Competition between Heterologous Afferent Fibers. Proc. Natl. Acad. Sci. U. S. A. 98, 9954-9959.

 34. Yatsushiro, S., Hayashi, M., Morita, M., Yamamoto, A., and Moriyama, Y. (2000) Glutamate Receptor Subunit delta2 is Highly Expressed in a Novel Population of Glial-Like Cells in Rat Pineal Glands in Culture. J. Neurochem. 75, 1115-1122.

 35. Rousseaux, C. G. (2008) A Review of Glutamate Receptors I: Current Understanding of their Biology. J Toxicol Pathol. 21, 25-51.

 36. Zuo, J., De Jager, P. L., Takahashi, K. A., Jiang, W., Linden, D. J., and Heintz, N. (1997) Neurodegeneration in Lurcher Mice Caused by Mutation in delta2 Glutamate Receptor Gene. Nature. 388, 769-773.

 37. Wollmuth, L. P., Kuner, T., Jatzke, C., Seeburg, P. H., Heintz, N., and Zuo, J. (2000) The Lurcher Mutation Identifies Delta 2 as an AMPA/kainate Receptor-Like Channel that is Potentiated by Ca(2+). J. Neurosci. 20, 5973-5980.

 38. Williams, K., Dattilo, M., Sabado, T. N., Kashiwagi, K., and Igarashi, K. (2003) Pharmacology of delta2 Glutamate Receptors: Effects of Pentamidine and Protons. J. Pharmacol. Exp. Ther. 305, 740-748.

 39. Cheng, S. S., and Heintz, N. (1997) Massive Loss of Mid- and Hindbrain Neurons during Embryonic Development of Homozygous Lurcher Mice. J. Neurosci. 17, 2400-2407.

 40. Phillips, R. (1960) 'Lurcher', a New Gene in Linkage Group XI of the House Mouse. J Genet. 57, 35-42.

 41. Fortier, P. A., Smith, A. M., and Rossignol, S. (1987) Locomotor Deficits in the Mutant Mouse, Lurcher. Exp. Brain Res. 66, 271-286.

 42. Wetts, R., and Herrup, K. (1982) Interaction of Granule, Purkinje and Inferior Olivary Neurons in Lurcher Chimeric Mice. II. Granule Cell Death. Brain Res. 250, 358-362.

 43. Caddy, K. W., and Biscoe, T. J. (1979) Structural and Quantitative Studies on the Normal C3H and Lurcher Mutant Mouse. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 287, 167-201.

 44. Wetts, R., and Herrup, K. (1982) Interaction of Granule, Purkinje and Inferior Olivary Neurons in Lurcher Chimaeric Mice. I. Qualitative Studies. J. Embryol. Exp. Morphol. 68, 87-98.

 45. Wetts, R., and Herrup, K. (1983) Direct Correlation between Purkinje and Granule Cell Number in the Cerebella of Lurcher Chimeras and Wild-Type Mice. Brain Res. 312, 41-47.

 46. Vogel, M. W., Caston, J., Yuzaki, M., and Mariani, J. (2007) The Lurcher Mouse: Fresh Insights from an Old Mutant. Brain Res. 1140, 4-18.

 47. Norman, D. J., Feng, L., Cheng, S. S., Gubbay, J., Chan, E., and Heintz, N. (1995) The Lurcher Gene Induces Apoptotic Death in Cerebellar Purkinje Cells. Development. 121, 1183-1193.

 48. Wullner, U., Loschmann, P. A., Weller, M., and Klockgether, T. (1995) Apoptotic Cell Death in the Cerebellum of Mutant Weaver and Lurcher Mice. Neurosci. Lett. 200, 109-112.

 49. Selimi, F., Doughty, M., Delhaye-Bouchaud, N., and Mariani, J. (2000) Target-Related and Intrinsic Neuronal Death in Lurcher Mutant Mice are both Mediated by Caspase-3 Activation. J. Neurosci. 20, 992-1000.

 50. Yue, Z., Horton, A., Bravin, M., DeJager, P. L., Selimi, F., and Heintz, N. (2002) A Novel Protein Complex Linking the Delta 2 Glutamate Receptor and Autophagy: Implications for Neurodegeneration in Lurcher Mice. Neuron. 35, 921-933.

 51. Selimi, F., Lohof, A. M., Heitz, S., Lalouette, A., Jarvis, C. I., Bailly, Y., and Mariani, J. (2003) Lurcher GRID2-Induced Death and Depolarization can be Dissociated in Cerebellar Purkinje Cells. Neuron. 37, 813-819.

 52. McFarland, R., Blokhin, A., Sydnor, J., Mariani, J., and Vogel, M. W. (2007) Oxidative Stress, Nitric Oxide, and the Mechanisms of Cell Death in Lurcher Purkinje Cells. Dev. Neurobiol. 67, 1032-1046.

 53. Kashiwabuchi, N., Ikeda, K., Araki, K., Hirano, T., Shibuki, K., Takayama, C., Inoue, Y., Kutsuwada, T., Yagi, T., and Kang, Y. (1995) Impairment of Motor Coordination, Purkinje Cell Synapse Formation, and Cerebellar Long-Term Depression in GluR Delta 2 Mutant Mice. Cell. 81, 245-252.

 54. Kurihara, H., Hashimoto, K., Kano, M., Takayama, C., Sakimura, K., Mishina, M., Inoue, Y., and Watanabe, M. (1997) Impaired Parallel Fiber-->Purkinje Cell Synapse Stabilization during Cerebellar Development of Mutant Mice Lacking the Glutamate Receptor delta2 Subunit. J. Neurosci. 17, 9613-9623.

 55. Hashimoto, K., Ichikawa, R., Takechi, H., Inoue, Y., Aiba, A., Sakimura, K., Mishina, M., Hashikawa, T., Konnerth, A., Watanabe, M., and Kano, M. (2001) Roles of Glutamate Receptor Delta 2 Subunit (GluRdelta 2) and Metabotropic Glutamate Receptor Subtype 1 (mGluR1) in Climbing Fiber Synapse Elimination during Postnatal Cerebellar Development. J. Neurosci. 21, 9701-9712.

 56. Ichikawa, R., Miyazaki, T., Kano, M., Hashikawa, T., Tatsumi, H., Sakimura, K., Mishina, M., Inoue, Y., and Watanabe, M. (2002) Distal Extension of Climbing Fiber Territory and Multiple Innervation Caused by Aberrant Wiring to Adjacent Spiny Branchlets in Cerebellar Purkinje Cells Lacking Glutamate Receptor Delta 2. J. Neurosci. 22, 8487-8503.

 57. Takeuchi, T., Miyazaki, T., Watanabe, M., Mori, H., Sakimura, K., and Mishina, M. (2005) Control of Synaptic Connection by Glutamate Receptor delta2 in the Adult Cerebellum. J. Neurosci. 25, 2146-2156.

 58. Hirano, T., Kasono, K., Araki, K., and Mishina, M. (1995) Suppression of LTD in Cultured Purkinje Cells Deficient in the Glutamate Receptor Delta 2 Subunit. Neuroreport. 6, 524-526.

 59. Hirano, T., Kasono, K., Araki, K., Shinozuka, K., and Mishina, M. (1994) Involvement of the Glutamate Receptor Delta 2 Subunit in the Long-Term Depression of Glutamate Responsiveness in Cultured Rat Purkinje Cells. Neurosci. Lett. 182, 172-176.

 60. Kishimoto, Y., Kawahara, S., Suzuki, M., Mori, H., Mishina, M., and Kirino, Y. (2001) Classical Eyeblink Conditioning in Glutamate Receptor Subunit Delta 2 Mutant Mice is Impaired in the Delay Paradigm but Not in the Trace Paradigm. Eur. J. Neurosci. 13, 1249-1253.

 61. Funabiki, K., Mishina, M., and Hirano, T. (1995) Retarded Vestibular Compensation in Mutant Mice Deficient in Delta 2 Glutamate Receptor Subunit. Neuroreport. 7, 189-192.

 62. Katoh, A., Yoshida, T., Himeshima, Y., Mishina, M., and Hirano, T. (2005) Defective Control and Adaptation of Reflex Eye Movements in Mutant Mice Deficient in either the Glutamate Receptor delta2 Subunit Or Purkinje Cells. Eur. J. Neurosci. 21, 1315-1326.

 63. Yoshida, T., Katoh, A., Ohtsuki, G., Mishina, M., and Hirano, T. (2004) Oscillating Purkinje Neuron Activity Causing Involuntary Eye Movement in a Mutant Mouse Deficient in the Glutamate Receptor delta2 Subunit. J. Neurosci. 24, 2440-2448.

 64. Kakegawa, W., Miyazaki, T., Emi, K., Matsuda, K., Kohda, K., Motohashi, J., Mishina, M., Kawahara, S., Watanabe, M., and Yuzaki, M. (2008) Differential Regulation of Synaptic Plasticity and Cerebellar Motor Learning by the C-Terminal PDZ-Binding Motif of GluRdelta2. J. Neurosci. 28, 1460-1468.

 65. Hirai, H., Miyazaki, T., Kakegawa, W., Matsuda, S., Mishina, M., Watanabe, M., and Yuzaki, M. (2005) Rescue of Abnormal Phenotypes of the delta2 Glutamate Receptor-Null Mice by Mutant delta2 Transgenes. EMBO Rep. 6, 90-95.

 66. Kakegawa, W., Miyazaki, T., Hirai, H., Motohashi, J., Mishina, M., Watanabe, M., and Yuzaki, M. (2007) Ca2+ Permeability of the Channel Pore is Not Essential for the delta2 Glutamate Receptor to Regulate Synaptic Plasticity and Motor Coordination. J. Physiol. 579, 729-735.

 67. Hirai, H., Launey, T., Mikawa, S., Torashima, T., Yanagihara, D., Kasaura, T., Miyamoto, A., and Yuzaki, M. (2003) New Role of delta2-Glutamate Receptors in AMPA Receptor Trafficking and Cerebellar Function. Nat. Neurosci. 6, 869-876.

 68. Uemura, T., Mori, H., and Mishina, M. (2004) Direct Interaction of GluRdelta2 with Shank Scaffold Proteins in Cerebellar Purkinje Cells. Mol. Cell. Neurosci. 26, 330-341.

 69. Yawata, S., Tsuchida, H., Kengaku, M., and Hirano, T. (2006) Membrane-Proximal Region of Glutamate Receptor delta2 Subunit is Critical for Long-Term Depression and Interaction with Protein Interacting with C Kinase 1 in a Cerebellar Purkinje Neuron. J. Neurosci. 26, 3626-3633.