Phenotypic Mutation 'scaffold' (pdf version)
Allelescaffold
Mutation Type missense
Chromosome10
Coordinate82,738,408 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Hcfc2
Gene Name host cell factor C2
Synonym(s) 1700129L13Rik
Chromosomal Location 82,696,160-82,742,428 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two proteins which interact with VP16, a herpes simplex virus protein that initiates virus infection. Both the encoded protein and the original Herpes host cell factor interact with VP16 through a beta-propeller domain. The original Herpes host cell factor, however, is effective at initiating viral infection while the encoded protein is not. Transcripts of varying length due to alternative polyadenylation signals have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null or severely hypomorphic allele exhibit reduced poly(I:C)-mediated TLR3 signaling and increased mortality following viral infection. [provided by MGI curators]
Accession Number

Ncbi RefSeq: NM_001081218; MGI: 1915183

Mapped No 
Amino Acid Change Phenylalanine changed to Isoleucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000020478] [ENSMUSP00000124489]
SMART Domains Protein: ENSMUSP00000020478
Gene: ENSMUSG00000020246
AA Change: F599I

DomainStartEndE-ValueType
Pfam:Kelch_1 22 60 2.1e-6 PFAM
Pfam:Kelch_5 68 106 1.1e-6 PFAM
Pfam:Kelch_3 81 135 8.8e-7 PFAM
Pfam:Kelch_5 186 230 8.4e-7 PFAM
Pfam:Kelch_3 206 253 1.6e-11 PFAM
Pfam:Kelch_1 244 302 7.5e-9 PFAM
Pfam:Kelch_3 254 323 3.4e-7 PFAM
Pfam:Kelch_5 312 356 1.4e-6 PFAM
FN3 357 591 8.43e-9 SMART
FN3 607 703 6.06e-1 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000020478)
SMART Domains Protein: ENSMUSP00000124489
Gene: ENSMUSG00000020246
AA Change: F139I

DomainStartEndE-ValueType
FN3 52 131 1.22e1 SMART
FN3 147 243 6.06e-1 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000160681)
Meta Mutation Damage Score 0.3353 question?
Is this an essential gene? Probably nonessential (E-score: 0.218) question?
Phenotypic Category
Phenotypequestion? Literature verified References
TLR signaling defect: TNF production by macrophages
Candidate Explorer Status CE: failed initial filter
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

None

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hcfc2 APN 10 82741278 splice site probably null
IGL01799:Hcfc2 APN 10 82700991 missense probably damaging 1.00
IGL01916:Hcfc2 APN 10 82734383 missense possibly damaging 0.94
IGL02150:Hcfc2 APN 10 82710018 missense probably damaging 1.00
IGL02378:Hcfc2 APN 10 82709071 missense possibly damaging 0.64
IGL02580:Hcfc2 APN 10 82728422 missense probably benign 0.00
IGL02641:Hcfc2 APN 10 82702549 missense probably damaging 1.00
Backstabbing UTSW 10 82711825 splice site probably null
feckless UTSW 10 82712061 missense probably damaging 1.00
Minions UTSW 10 82739245 missense probably damaging 1.00
R0380:Hcfc2 UTSW 10 82728438 splice site probably benign
R0528:Hcfc2 UTSW 10 82739245 missense probably damaging 1.00
R0534:Hcfc2 UTSW 10 82738408 missense probably damaging 1.00
R1646:Hcfc2 UTSW 10 82701027 missense probably damaging 1.00
R1903:Hcfc2 UTSW 10 82702558 missense probably damaging 0.98
R1939:Hcfc2 UTSW 10 82702450 missense probably damaging 0.99
R2014:Hcfc2 UTSW 10 82738980 missense probably benign 0.23
R2015:Hcfc2 UTSW 10 82738980 missense probably benign 0.23
R2571:Hcfc2 UTSW 10 82709023 missense probably damaging 1.00
R4540:Hcfc2 UTSW 10 82732647 missense probably benign 0.10
R4694:Hcfc2 UTSW 10 82723700 missense probably damaging 1.00
R4735:Hcfc2 UTSW 10 82712080 missense probably damaging 1.00
R4833:Hcfc2 UTSW 10 82709146 missense probably null 0.01
R6837:Hcfc2 UTSW 10 82739196 missense probably damaging 0.96
R7268:Hcfc2 UTSW 10 82709012 nonsense probably null
R7683:Hcfc2 UTSW 10 82699229 missense probably benign 0.00
R7733:Hcfc2 UTSW 10 82739179 missense probably benign 0.00
R7742:Hcfc2 UTSW 10 82711825 splice site probably null
V3553:Hcfc2 UTSW 10 82712061 missense probably damaging 1.00
X0022:Hcfc2 UTSW 10 82709967 missense probably damaging 0.99
Z1176:Hcfc2 UTSW 10 82699172 missense probably damaging 0.97
Mode of Inheritance Unknown
Local Stock Live Mice
Repository
Last Updated 2019-01-07 10:39 AM by Anne Murray
Record Created 2013-12-10 12:13 PM by Anne Murray
Record Posted 2017-10-04
Phenotypic Description
Figure 1. Macrophages from compound Scaffold/Feckless mice produce reduced levels of TNF in response to poly(I:C). TNF in the culture medium of macrophages from age-matched heterozygous Feckless, homozygous Feckless, compound heterozygous Feckless/Minions, compound heterozygous Feckless/Scaffold, and wild-type mice. Figure adapted from (1).

Macrophages from compound heterozgyous Feckless and Scaffold mice produce reduced amounts of TNF in response to poly(I:C) (1(Figure 1). 

Nature of Mutation

The Scaffold mutation is a T to A transversion at base pair 82,738,408 (v38) on chromosome 10, or base pair 39,402 in the GenBank genomic region NC_000076 encoding Hcfc2. The mutation corresponds to residue 1,932 in the NM_001081218 mRNA sequence in exon 13 or 15 total exons.

 

1917 AGTAAAGTCAGTGAATTTAAAACGTGTACTCCT
594  -S--K--V--S--E--F--K--T--C--T--P-
 

The mutated nucleotide is indicated in red. The mutation results in a phenylalanine (F) to isoleucine (I) substitution at residue 599 in the HCF-2 protein.

Protein Prediction
Figure 2. Domain structures of HCF-1, HCF-2, and VP16.  The human HCF proteins are depicted.  The β-propeller domain contains six kelch-like repeats predicted to fold into a six-bladed β-propeller structure.  A proline residue exists at the fourth position of every kelch repeat in each of HCF-1 and HCF-2; mutation of the proline residue in the third kelch repeat of HCF-1 (P) abrogates binding to VP16.  An enlarged schematic of the fifth kelch repeat is shown for HCF-2, with the position of the Scaffold mutation indicated by a red asterisk.  The eight HCFPRO repeats of HCF-1 are indicated by open (nonfunctional) and filled (functional) arrowheads.  The SASN, basic, and SASC regions are labeled.  The first 902 amino acids of HCF-1 comprising the β-propeller, SASN domain, and basic region are required to complement the tsBN67 defect.  The β-propeller domain of HCF-1 is necessary and sufficient to bind the HCF-binding motifs of VP16 and Luman.  VP16 contains a 355 amino acid central conserved core and a C-terminal transactivation domain (TAD).  Residues binding to HCF-1 and Oct-1 are indicated.  Image is interactive; click to see additional lab alleles of HCF-2 and to connect to the respective pages.

The Scaffold mutation (F599I) is within the C-terminal self-association domain (SASC). The SASC domain is a 190 amino acid region containing two tandem sequences with homology to fibronectin type 3 (Fn3) repeats (Figure 2(2)]. The function of the SASC domain is unknown, however in HCF-1 (host cell factor C1; HCF-1 shares 59% sequence identity with HCF-2 at the SASC domain), the SASC domain mediates non-covalent association of the N- and C-terminal portions of the protein after cleavage at one of the HCFPRO repeats. The SASC and another SAS domain at the N-terminus, SASN, are conserved between HCF-1. However, HCF-2 does not have the eight 26-amino acid HCFPRO repeats that serve as autoproteolytic cleavage sites for HCF-1 (3). The expression, localization, and stability of the mutant HCF-2 protein have not been examined.

 

Please see the record Feckless for information about Hcfc2.

Putative Mechanism

HCFC2 facilitates the binding of IRF1/2 to the Tlr3 promoter (namely to the Tlr3 IRF-E) by forming complexes with IRF1/2 (1). In addition to regulating Tlr3 transcription, IRF1/2 and HCFC2 regulate the transcription of several interferon-regulated genes (1). ChIP sequencing determined that 381 DNA binding sites were differentially enriched in either wild-type or Hcfc2-deficient (Hcfc2-/-) mouse embryonic fibroblasts: 365 DNA sequences were immunoprecipitated at higher levels in wild-type samples, while 16 were immunoprecipitated at higher levels in the Hcfc2-/- samples. RNA sequencing of Hcfc2-/- bone marrow-derived macrophages (BMDM) found that 571 genes were differentially expressed in both Hcfc2-/- and Irf2-/- BMDMs compared to that in wild-type BMDMs. Analysis of the ChIP and RNA sequencing data showed that 31 genes exhibited reduced association with IRF2 and altered transcript levels in Hcfc2-/- samples compared to wild-type samples: 13 were significantly reduced and 18 were significantly increased in the Hcfc2-/- samples. Taken together, HCFC2 is proposed to facilitate IRF2 binding to several target genes, supporting the function of IRF2 as both a transcriptional activator and a repressor. Further analysis determined that HCFC2/IRF2 promotes the expression of known immune response genes that function in immune defens

Primers PCR Primer
scaffold_pcr_F: CTGAGAGGTTCAGCTCACGTTTCC
scaffold_pcr_R: TGATGCAGGCAAGACAGTACACAC

Sequencing Primer
scaffold_seq_F: TAAGAATCCCTGGTTCAGGC
scaffold_seq_R: ATAATCCGGCTTGCGATCTG
Genotyping

Scaffold genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Scaffold(F): 5’- CTGAGAGGTTCAGCTCACGTTTCC-3’

Scaffold(R): 5’- TGATGCAGGCAAGACAGTACACAC-3’

 

Sequencing Primer

Scaffold_seq(F): 5’- TAAGAATCCCTGGTTCAGGC-3’
 

Scaffold_seq(R): 5’- ATAATCCGGCTTGCGATCTG-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 643 nucleotides (from Genbank genomic region NC_000076 for linear DNA sequence of Hcfc2) is amplified:

 

40644                          ctgagag gttcagctca cgtttcctct ggataagaat

40681 ccctggttca ggcaggggct tgatgggttc tgtattagag tttactcttt gtgtgataga

40741 gagaaataca ttatggaact gggtccttaa aatacactca ttcttaaaaa gttttgttgt

40801 ttaataaaaa tagaatttta actttgacgt attatatgtg ccttttctct gactctgtat

40861 attttacatt tcaggtagga aatgcagacg tgcctgacta cagtttgctt aagaaacagg

40921 atcttgttcc aggaacagta tataagttca gggttgctgc gatcaatggc tgtggaatag

40981 gccctctcag taaagtcagt gaatttaaaa cgtgtactcc tggtttccct ggagccccat

41041 ctacagtccg catctctaag gtagtctgtc aggtccagca cgacttgact gtgatacaaa

41101 tgatttgaaa ctcctatgtt gaaacattcg tattagcact tatgaaaagt acctaagaga

41161 ggtggattaa atgttaaacg ttttagtagc catgcatggt atttttcagt accagatcgc

41221 aagccggatt ataatatgcg cagcacagaa ggactgaagt cagtgtgtac tgtcttgcct

41281 gcatca

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsLei Sun and Bruce Beutler