Phenotypic Mutation 'mount_tai' (pdf version)
Allelemount_tai
Mutation Type missense
Chromosome8
Coordinate71,683,377 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Jak3
Gene Name Janus kinase 3
Synonym(s) fae; wil
Chromosomal Location 71,676,296-71,690,575 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010589; NM_001190830; MGI:99928

MappedYes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000060073] [ENSMUSP00000105639] [ENSMUSP00000105640]
AlphaFold no structure available at present
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805
AA Change: Y607C

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000051995)
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805
AA Change: Y607C

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000110012)
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805
AA Change: Y607C

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000110013)
Meta Mutation Damage Score 0.9179 question?
Is this an essential gene? Possibly essential (E-score: 0.569) question?
Phenotypic Category
Phenotype question? Literature verified References
125-03 Response - decreased
FACS B cells - decreased
FACS CD4:CD8 - increased 9016869
FACS CD4+ T cells - decreased 16020505
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased 16020505
FACS CD8+ T cells in CD3+ T cells - decreased 16020505
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD+ B cell percentage - decreased
FACS IgM+ B cells - decreased
FACS macrophages - increased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased 10419884
FACS NK cells - decreased 22363534
FACS T cells - decreased
MCMV susceptibility
OVA-specific IgE - increased
post-MCMV FACS B cells - decreased
post-MCMV FACS CD11c+ DCs - decreased 16020505
post-MCMV FACS CD4:CD8 - increased
post-MCMV FACS CD8+ T cells in CD3+ T cells - decreased 16020505
post-MCMV FACS IgD+ B cell percentage - decreased
post-MCMV FACS IgM+ B cells - decreased
post-MCMV FACS naive CD4 T cells in CD4 T cells - decreased
post-MCMV FACS naive CD8 T cells in CD8 T cells - decreased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
total IgE level - increased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.975; ML prob: 0.986; human score: 5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(23) : Chemically induced (ENU)(3) Gene trapped(14) Spontaneous(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 71681697 splice site probably benign
IGL00720:Jak3 APN 8 71684037 missense probably damaging 1.00
IGL00966:Jak3 APN 8 71679012 missense probably benign 0.24
IGL01147:Jak3 APN 8 71683403 missense probably benign
IGL01308:Jak3 APN 8 71685166 missense probably damaging 1.00
IGL01328:Jak3 APN 8 71679620 missense probably damaging 1.00
IGL01386:Jak3 APN 8 71684289 missense probably damaging 1.00
IGL01515:Jak3 APN 8 71680562 splice site probably null
IGL01870:Jak3 APN 8 71680790 missense probably damaging 1.00
IGL02132:Jak3 APN 8 71678480 missense probably damaging 0.99
IGL02413:Jak3 APN 8 71686119 splice site probably null
IGL02752:Jak3 APN 8 71682951 missense possibly damaging 0.50
IGL03089:Jak3 APN 8 71686083 missense probably benign 0.15
IGL03177:Jak3 APN 8 71682370 missense probably damaging 1.00
beanstalk UTSW 8 71687288 missense probably benign 0.01
citron UTSW 8 71686976 splice site probably benign
daniels UTSW 8 71681655 missense possibly damaging 0.48
Deposuit UTSW 8 71685404 missense probably damaging 1.00
distortion UTSW 8 71683978 missense probably damaging 1.00
Downcast UTSW 8 71685511 missense probably benign 0.07
fake_news UTSW 8 71685957 missense probably damaging 1.00
Implevit UTSW 8 71678773 missense probably benign
potentes UTSW 8 71686058 missense probably damaging 0.99
Riot UTSW 8 71682316 missense probably damaging 1.00
thistle UTSW 8 71685383 critical splice acceptor site probably null
thistle2 UTSW 8 71685545 missense probably damaging 1.00
PIT4403001:Jak3 UTSW 8 71684349 missense probably benign 0.00
PIT4515001:Jak3 UTSW 8 71679642 missense probably benign 0.21
R0013:Jak3 UTSW 8 71684327 missense probably damaging 0.98
R0496:Jak3 UTSW 8 71682397 missense probably damaging 1.00
R0522:Jak3 UTSW 8 71682274 splice site probably benign
R0531:Jak3 UTSW 8 71686976 splice site probably benign
R0538:Jak3 UTSW 8 71685482 missense probably benign
R0612:Jak3 UTSW 8 71683377 missense probably damaging 1.00
R0744:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0833:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0836:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R1183:Jak3 UTSW 8 71684550 missense probably damaging 1.00
R1420:Jak3 UTSW 8 71681538 missense possibly damaging 0.75
R1793:Jak3 UTSW 8 71685946 splice site probably benign
R1967:Jak3 UTSW 8 71681535 missense probably damaging 1.00
R1983:Jak3 UTSW 8 71678375 missense possibly damaging 0.95
R1983:Jak3 UTSW 8 71688136 missense probably benign
R2058:Jak3 UTSW 8 71685383 critical splice acceptor site probably null
R2060:Jak3 UTSW 8 71680714 nonsense probably null
R2060:Jak3 UTSW 8 71683415 nonsense probably null
R3705:Jak3 UTSW 8 71681522 missense probably damaging 1.00
R3734:Jak3 UTSW 8 71676581 unclassified probably benign
R4231:Jak3 UTSW 8 71685545 missense probably damaging 1.00
R4596:Jak3 UTSW 8 71684631 missense probably damaging 0.99
R4844:Jak3 UTSW 8 71681655 missense possibly damaging 0.48
R4897:Jak3 UTSW 8 71685404 missense probably damaging 1.00
R5038:Jak3 UTSW 8 71686058 missense probably damaging 0.99
R5469:Jak3 UTSW 8 71678773 missense probably benign
R5538:Jak3 UTSW 8 71678773 missense probably benign
R5718:Jak3 UTSW 8 71684354 missense probably damaging 1.00
R5799:Jak3 UTSW 8 71678700 missense probably damaging 1.00
R5909:Jak3 UTSW 8 71684231 missense possibly damaging 0.68
R5959:Jak3 UTSW 8 71682071 missense probably damaging 1.00
R6260:Jak3 UTSW 8 71679310 missense probably benign 0.00
R6798:Jak3 UTSW 8 71680971 missense probably damaging 0.99
R7013:Jak3 UTSW 8 71678781 missense possibly damaging 0.88
R7070:Jak3 UTSW 8 71684611 missense probably damaging 1.00
R7122:Jak3 UTSW 8 71685957 missense probably damaging 1.00
R7166:Jak3 UTSW 8 71682316 missense probably damaging 1.00
R7225:Jak3 UTSW 8 71685511 missense probably benign 0.07
R7440:Jak3 UTSW 8 71680718 missense probably benign 0.02
R7489:Jak3 UTSW 8 71684292 missense probably damaging 1.00
R7773:Jak3 UTSW 8 71679042 missense probably benign
R7779:Jak3 UTSW 8 71687288 missense probably benign 0.01
R8511:Jak3 UTSW 8 71685550 missense probably damaging 1.00
R8808:Jak3 UTSW 8 71685520 missense possibly damaging 0.71
R8859:Jak3 UTSW 8 71678516 missense probably benign 0.37
R9079:Jak3 UTSW 8 71679254 missense probably benign 0.05
Z1176:Jak3 UTSW 8 71680683 missense possibly damaging 0.93
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, gDNA
MMRRC Submission 038160-MU
Last Updated 2019-09-04 9:49 PM by Diantha La Vine
Record Created 2014-01-27 6:17 PM by Ming Zeng
Record Posted 2015-02-10
Phenotypic Description
Figure 1. Homozygous mount tai mice exhibit a reduced frequency of peripheral T cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Homozygous mount tai mice exhibit an increase in the CD4+ to CD8+ T cell ratio. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homozygous mount tai mice exhibit an increased frequency of CD4+ T cells in CD3+ T cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Homozygous mount tai mice exhibit an reduced frequency of CD8+ T cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Homozygous mount tai mice exhibit a reduced frequency of CD8+ T cells in CD3+ T cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Homozygous mount tai mice exhibit an increased frequency of effector memory CD4+ T cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Homozygous mount tai mice exhibit an increased frequency of effector memory CD8+ T cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Homozygous mount tai mice exhibit a decreased frequency of naïve CD8+ T cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Homozygous mount tai mice exhibit enhanced CD44 mean fluorescence intensity on CD4+ T cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Homozygous mount tai mice exhibit increased total IgE levels in the peripheral blood. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Homozygous mount tai mice exhibit an increased frequency of peripheral neutrophils. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Homozygous mount tai mice exhibit a decreased frequency of peripheral natural killer (NK) cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13.  Homozygous mount tai mice exhibit susceptibility to MCMV. Viral titers were measured in the liver. Log of the data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Homozygous mount tai mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The mount tai phenotype was identified among G3 mice of the pedigree R0612, some of which showed a reduced frequency of T cells (Figure 1), an increase in the CD4+ to CD8+ T cell ratio (Figure 2) due to an increased frequency of CD4+ T cells in CD3+ T cells (Figure 3) with a concomitant reduced frequency of CD8+ T cells (Figure 4) and CD8+ T cells in CD3+ T cells (Figure 5), all in the peripheral blood. Some mice also exhibited an increased frequency of effector memory CD4+ (Figure 6) and CD8+ (Figure 7) T cells, a decreased frequency of naïve CD8+ T cells (Figure 8), an increase in the CD44 mean fluorescence intensity (MFI) on CD4+ T cells (Figure 9), an increased level of total IgE (Figure 10), an increased frequency of neutrophils (Figure 11), and a decreased frequency of natural kller (NK) cells (Figure 12), all in the peripheral blood. Some mice also exhibited increased mouse cytomegalovirus (MCMV) viral titer in the liver after MCMV infection (Figure 13). The T-dependent antibody response to ovalbumin administered with aluminum hydroxide was also diminished (Figure 14).

Nature of Mutation

Figure 9. Linkage mapping of the increased amount of total IgE levels in the peripheral blood using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 87 mutations (X-axis) identified in the G1 male of pedigree R0612.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 87 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Jak3: an A to G transition at base pair 71,683,377 (v38) on chromosome 8, or base pair 6,995 in the GenBank genomic region NC_000074 encoding Jak3. The strongest association was found with a recessive model of linkage to the normalized total IgE levels in the peripheral blood, wherein two variant homozygotes departed phenotypically from 9 homozygous reference mice and 13 heterozygous mice with a P value of 1.09 x 10-18 (Figure 15).  The mutation corresponds to residue 2,030 in the mRNA sequence NM_010589 within exon 14 of 25 total exons.

 
2014 GGAGCAATTGACATGTACCTGCGCAAGCGTGGC
602  -G--A--I--D--M--Y--L--R--K--R--G-

 

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to cysteine (C) substitution at position 607 (Y607C) in the JAK3 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 16. Domain structure of JAK3. The mount_tai mutation results in a tyrosine to cysteine substitution at position 607. Abbreviations: B41, 4.1, ezrin, radixin, moesin (FERM) homology domain; SH2, Src Homology 2-like. This image is interactive. Other mutations found in JAK3 are noted in red. Click on each mutation for more information.

Jak3 encodes Janus kinase 3 (JAK3). JAK3 has seven different highly conserved JAK homology (JH) regions (JH1-JH7) [Figure 16; reviewed in (1)]. The JH1 region corresponds to the kinase domain located at the JAK3 C-terminus (amino acids 818-1091). Amino acids 824-832 within the kinase domain comprise an ATP-binding motif (GXGXXG). Lys851 is also essential for ATP binding; mutation of Lys851 to arginine (Lys851Arg) results in loss of kinase activity (2;3). Amino acids 988-993 comprise a conserved FWYAPE consensus motif found in kinase domains of proteins within the JAK kinase family (3). A pseudokinase domain [i.e., the JH2 region; (amino acids 517-773)] is N-terminal to the JH1 region. The pseudokinase domain does not have catalytic activity, but it is required for suppression of basal JAK3 activity as well as for cytokine-inducible activation of JAK3-assoiciated signal transduction through interactions with signal transducers and activators of transcription (STAT) proteins [see the domino page for information about STAT proteins; (4)]. Mutations within the JH2 domain can result in increased JAK3 kinase activity (5;6) or can increase the inhibitory effect of the JH2 domain, resulting in suppression of the kinase activity and subsequent abolished interleukin (IL)-2 signaling (7;8). The JH3 and JH4 regions comprise an Src Homology 2 (SH2)-like domain (amino acids 370-460). The function of the SH2-like domain is unknown [(4); reviewed in (1)]. The JH6 and JH7 regions consist of a 4.1, ezrin, radixin, moesin (FERM) homology domain (alternatively, B41 domain; amino acids 20-254). The FERM domain is required for the interactions between JAK3 and gamma chain (γc) subunit-containing cytokine receptors (see the “Background” section for more details). The FERM domain interacts with the kinase domain as well as the SH2 domain to modulate JAK3 kinase activity [(9); reviewed in (1)]. Mutations with the FERM domain have been show to either reduce or increase the kinase activity (10;11).

 

JAK3 function is regulated by phosphorylation/dephosphorylation, inhibitor binding, and ubiquitin proteasome-mediated degradation (12). JAK3 autophosphorylation at Tyr781 upon IL-2 stimulation promotes binding of the SH2 domain-containing adaptor protein SH2-Bβ, which can both inhibit the basal activity of JAK3 and enhance the cytokine-stimulated kinase activity of JAK3 [reviewed in (1)]. Tyr976 and Tyr991 within the activation loop (A-loop) are autophosphorylated upon activation of JAK3 [(4); reviewed in (13)]. Src homology 2 domain-containing phosphatase-1 (SHP-1) as well as T cell protein-tyrosine phosphatase (TCPTP) dephosphorylate JAK3 (14). The E3 ubiquitin ligases suppressors of cytokine signaling (SOCS) and cytokine signaling inducible SH2 domain-containing proteins ubiquitinate JAK3, promoting proteasome-dependent degradation of JAK3 (15).

 

The mount_tai mutation (Y607C) is within the pseudokinase domain of JAK3.

Expression/Localization

JAK3 is mainly expressed in hematopoietic cells (3;16-18). Highest JAK3 expression is in the adult and fetal thymus, followed by slightly lower levels in bone marrow, spleen, fetal liver, and adult CD4 CD8 double-negative (DN) thymocytes (2). JAK3 is expressed at comparable levels in human peripheral blood B cells and T cells (18). Expression of JAK3 has also been noted in erythrocytes (19) and in the colonic mucosa of mice (20). Slight expression of JAK3 has also been detected in the brain, spinal cord, heart, skeletal muscle, liver, pancreas, prostate, kidney, and lung as well as in epithelial cancer cells, including primary breast cancer and cell lines (SW480: colorectal adenocarcinoma, A549: lung carcinoma, and G361: melanoma) [reviewed in (13)].

Background
Figure 17. JAK-STAT Pathway. Cytokine receptors are associated with the normally dephosphorylated and inactive JAK tyrosine kinases. Latent STAT1 exists in the cytoplasm as a monomer. Upon receptor stimulation, JAK proteins phosphorylate the receptor cytoplasmic domains. STAT proteins are recruited to the receptor, tyrosine phosphorylated by JAKs, and dimerize for translocation to the nucleus with the assistance of importin-α5 (associated with importin-β). Once STAT1 binds to its DNA target, importin-α5 is recycled to the cytoplasm by the cellular apoptosis susceptibility protein (CAS) export receptor. Suppressors of cytokine signaling (SOCS) proteins can directly bind and suppress JAKs or can compete with STATs for receptor binding. The tyrosine phosphatases SHP1 and SHP2 inhibit signaling by dephosphorylating STAT proteins.

The canonical signaling pathway activating STAT proteins, called the JAK-STAT pathway, begins with the binding of one or more cytokines to their cognate cell-surface receptors (Figure 17). These receptors are associated with JAK tyrosine kinases, which are normally dephosphorylated and inactive. Receptor stimulation results in dimerization/oligomerization and subsequent apposition of JAK proteins, which are now capable of trans-phosphorylation as they are brought in close proximity. This activates JAKs to phosphorylate the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT proteins. Once recruited to the receptor, STAT proteins are also tyrosine phosphorylated by JAKs, a phosphorylation event which occurs on a single tyrosine residue that is found at around residue 700 of all STATs. Tyrosine phosphorylation of STATs may allow formation and/or conformational reorganization of the activated STAT dimer, involving reciprocal SH2 domain-phosphotyrosine interactions between STAT monomers. Phosphorylated, activated STATs enter the nucleus and accumulate there to promote transcription (21). For more information on JAK/STAT signaling, please see the record for domino.

 

JAK3 binding is restricted to hematopoietic-specific cytokine receptors that have a γc receptor subunit (i.e., the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors) [reviewed in (1)]. The γc receptor-associated cytokines have known functions. For example, IL-7 is necessary for T and B cell development, IL-2 functions in peripheral T cell homeostasis and antigen-driven T-cell expansion, IL-15 functions in NK cell differentiation, IL-4 functions in B-cell maturation and isotype switching (22). JAK3 mutations result in defective γc receptor-associated signaling and subsequent defects in lymphocyte development (22-24). For example, JAK3 expression is required for T cell proliferation and maintenance of T cell number (25). Jak3 knockout (Jak3-/-) mice exhibit defects in early T cell development (26;27). In the rudimentary thymus of the Jak3-/- mice there are normal ratios of DN, CD4+ CD8+ double-positive (DP), and CD4+ and CD8+ single-positive cells, but in the periphery, the numbers of CD8+ cells is reduced (17;28). Thymocytes and peripheral T cells in Jak3-/- mice exhibited defective negative selection of self-reactive T cells in the thymus and the periphery (29). Soldevilla et al. proposed that the T cell developmental defect was partially caused by decreased migration of thymic progenitors from the bone marrow to the thymus and/or reduced migration through the thymic compartments due to impaired chemokine receptor signaling (30).

 

Resting T cells in the Jak3-/- mice were larger than those in wild-type mice and they expressed high levels of CD44 and CD69 and low levels of CD62L (see the record for dim­_sum), hallmarks of activated T cells (28;31). Jak3-deficient T cells could be activated in vitro by CD3 plus CD28 stimulation. The T cells from the Jak3-/- mice were anergic, exhibiting reduced proliferation in response to mitogenic stimuli and exogenous IL-2 and increased rates of apoptosis (17;25;27;31-34). The reduced rate of proliferation was due to impaired IL-2- and IL-7-associated signaling with a concomitant increase in the anti-proliferative cytokines, IL-10 and transforming growth factor (TGF)-β. Th2 cell differentiation was not induced upon the loss of JAK3 expression due to loss of IL-4-associated signaling (i.e., STAT6 activation and GATA binding protein 3 induction) (35;36). Loss of JAK3 expression led to reduced T-bet binding to the IFN-γ promoter and subsequent impaired production of IFN-γ (37). Thymocytes from Jak3-/- mice were apoptotic at or just before TCRβ-chain selection (38). JAK3 regulated T lymphopoiesis by repressing Bax expression as well Bcl-2 induction in the IL-7 survival pathway (34;38).

 

JAK3 has several additional functions: (i) In T lymphocytes, JAK3 functions in CXCR4-, CCR9-, and CCR7-mediated signaling in response to CXCL12, CCL25, and CCL21/19, respectively (30;39). CCL25 and CXCL12 are known to function in thymocyte migration (30). (ii) JAK3 is a putative negative regulator of STAT1- and STAT3-mediated myogenic differentiation (40). (iii) JAK3 functions during mucosal differentiation in the colon, basal colonic inflammation, and susceptibility to dextran sulfate sodium (DSS)-induced colitis through the regulation β-catenin localization to adherens junctions, expression of differentiation markers (villin, carbonic anhydrase, Muc2), and maintenance of epithelial barrier functions (20;41;42). (iv) JAK3 regulates cytoskeletal remodeling and wound repair through an interaction with the actin-binding protein villin (9;42). (v) Inhibition of JAK3 led to loss of thrombin-induced STAT1 and STAT3 phosphorylation as well as thrombin-induced degranulation and platelet aggregation (43). (vi) JAK3 expression in nonhematopoietic cells is required for the recruitment of inflammatory cells (Th2 and eosinophils) to the airways of OVA-sensitized mice challenged with ovalbumin (44). (vii) JAK3 functions in mast cell-mediated recruitment of neutrophils to the sites of infection in a mouse model of E. coli-induced acute peritonitis (45). Jak3-/- mice exhibit an impaired efficiency to clear the bacteria compared to wild-type mice (45). Jak3-/- mast cells released less TNFα in response to E. coli and exhibited a reduced ability to kill phagocytized bacteria (45). (viii) JAK3 negative regulates TLR4-mediated inflammatory responses through the differential regulation of pro- and anti-inflammatory cytokine production (46). JAK3 inhibition in human primary monocytes and macrophages resulted in attenuated TLR4-associated PI3K activation resulting in reduced Akt and GSK3β phosphorylation leading to increased pro-inflammatory cytokine (TNF-α, IL-6, and IL-12) expression and repressed IL-10 production (46). (ix) Dendritic cells (DCs) from Jak3-/- mice exhibited reduced expression of costimulatory molecules compared to those in wild-type mice (47). In addition, exposure of mature Jak3-/- DCs to CCL19 and CCL21 resulted in impaired chemotactic responses compared to that in wild-type DCs (47). DC-mediated T cell activation was reduced upon the loss of Jak3 expression. JAK3 is not required for DC development, but is required to negatively regulated DC apoptosis and cytokine production (48). Jak3-/- DCs produced higher levels of IL-12 and IL-10 upon TLR ligand (LPS, peptidoglycan (PGN), zymosan, and CpG oligonucleotides) stimulation. Wild-type T cells responded to Jak3-/- DCs and produced high levels of IFN-γ (48). (x) JAK3 mediates actin cytoskeleton rearrangement in response to CXCL12 and CCL21 and through an interaction with cofilin and regulation of Rac1 and RhoA activation (49). Upon chemokine stimulation, the JAK3 signaling pathway is activated leading to activation of Rac1 and actin polymerization at the cell edge sensing the chemokine gradient. JAK3-mediated Rac1 activation promotes leading edge formation (49).

 

Mutations in JAK3 are linked to autosomal recessive T- and NK-cell negative/B-cell positive type of severe combined immunodeficiency [TB+NK- SCID; OMIM: #600802; (8;50;51); reviewed in (22)]. Patients with TB+NK- SCID do not have T or NK cells (50;51). The patients have normal to elevated numbers of immature B lymphocytes, but the cells are nonfunctional. Patients with SCID have persistent, recurring infections due to loss of T cell-associated immunity. Mutations in JAK3 have also been linked to adult T cell leukemia/lymphoma, early T cell precursor acute lymphoblastic leukemia (TdT+:ALL), T-cell prolymphocytic leukemia (T-PLL), acute megakaryoblastic leukemia (AMKL), cutaneous T cell lymphoma, and extranodal nasal-type natural killer cell lymphoma (5;11;52-54).

Putative Mechanism

A mouse (Jak3W81R) with a missense mutation (W81R) affecting the FERM domain had low numbers of CD8+ T cells in the spleen and thymus, a low number of NK cells in the thymus and spleen, low numbers of B cells in the bone marrow, and an atrophied thymus (55). Six weeks after exposure to M. bovis BCG, the Jak3W81R mice exhibited splenomegaly and increased splenic bacterial counts compared to the wild-type control (55). After exposure to M. tuberculosis H37Rv, most Jak3W81R mice exhibited lethality (55). The Jak3W81R mice exhibited a cerebral malaria protective effect (55). Jak3-/- mice have reduced numbers of T, B, γδ T, and NK cells (17;27;28;32;38;44). Jak3-/- mice had defects in B cell maturation and NK cell development (17;27;32;56). B cell maturation in the Jak3-/- mice was blocked at the pre-B stage, leading to a reduced frequency IgM+ B cells (32;33). Jak3-/- mice had increased immature neutrophils and monocytes in the periphery as well as splenomegaly and a lack of peripheral lymph nodes and Peyer’s patches (24;39). Bone marrow-derived dendritic cell maturation was normal (48). Jak3-/- mice exhibited reduced responses to LPS, PMA, ionomycin, concanavalin A, IL-2, IL-7, anti-CD3, and anti-CD28 alone or in combination (56). Mutations in the pseudokinase domain of JAK3 can either cause increased or suppressed JAK3 kinase activity (5-8). The phenotype observed in the mount_tai mice indicates that JAK3mount_tai exhibits loss of JAK3 function.

Primers PCR Primer
mount_tai_pcr_F: CCTTGCCAGCTAATTGCTATGCAAC
mount_tai_pcr_R: TTGACACTTACAGCCCTCTGAGCC

Sequencing Primer
mount_tai_seq_F: CAGCTAATTGCTATGCAACATTCC
mount_tai_seq_R: GAGCCTGCTCACGTCATTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 473 nucleotides is amplified (chromosome 8, + strand):


1   ccttgccagc taattgctat gcaacattcc ctcccacccc accccgtgcc aacccctcct
61  gaatcttggc tgtatctatt cagttgagct gataggaaac agaagtccag cctgtgcaaa
121 gagcagaggg aagatggggg cagggcctgc tgagtacctg tcacctgaat caccaccacc
181 ccactctccc cctgtcccca ggcatcatgg tgcaggaatt tgtgtatcta ggagcaattg
241 acatgtacct gcgcaagcgt ggccacctgg tgtcagccag ctggaaactg caggtgacca
301 agcagctggc atatgccctt aactacttgg tgagtgtccc tgtgtccata aggaggcttc
361 ctctatggat ggggaaatga gagtaggttc tgtagtttgg ataggagctt ggtaaggaca
421 caagcaaacg ttccagaatg acgtgagcag gctcagaggg ctgtaagtgt caa


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Kuanwen Wang, Jin Choi, Bruce Beutler