Phenotypic Mutation 'galak' (pdf version)
List |< first << previous [record 52 of 132] next >> last >|
Allelegalak
Mutation Type nonsense
Chromosome15
Coordinate11,012,667 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Slc45a2
Gene Name solute carrier family 45, member 2
Synonym(s) blanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
Chromosomal Location 11,000,721-11,029,233 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
Q252* in Ensembl: ENSMUSP00000022851 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:MFS_1 36 364 1.3e-9 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(11) : Targeted, other(1) Spontaneous(5) Chemically induced(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 start codon destroyed probably null 0.80
IGL02283:Slc45a2 APN 15 11001182 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023354 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012687 missense probably benign
IGL03123:Slc45a2 APN 15 11012655 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022192 missense probably damaging 1.00
cardigan UTSW 15 11022172 nonsense
cheng UTSW 15 11025868 missense probably damaging 0.99
Draco2 UTSW 15 11000817 missense probably benign 0.05
goku UTSW 15 11000855 nonsense probably null
grey_goose UTSW 15 11002981 missense probably damaging 1.00
june_gloom UTSW 15 11023443 missense probably damaging 0.96
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
sweater UTSW 15 11012610 missense probably damaging 0.96
voldemort UTSW 15 unclassified
yuki UTSW 15 11001092 missense probably damaging 1.00
zuckerkuss UTSW 15 11025935 critical splice donor site
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025746 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022128 missense probably null 0.00
R1824:Slc45a2 UTSW 15 11022086 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012714 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012576 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11027930 nonsense probably null
R4990:Slc45a2 UTSW 15 11001150 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012607 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5210:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5500:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012607 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022083 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001133 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000855 nonsense probably null
R6236:Slc45a2 UTSW 15 11022072 missense probably benign 0.00
R6709:Slc45a2 UTSW 15 11001130 missense possibly damaging 0.46
Mode of Inheritance Autosomal Recessive
Local Stock Embryos
Repository

none

Last Updated 2018-08-01 4:36 PM by Diantha La Vine
Record Created unknown
Record Posted 2008-04-15
Phenotypic Description

The galak mutation was induced by ENU mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals.  Homozygous mutant mice exhibit a "dirty white" coat color associated with a light ocular albinism.  Newborn mutants have very light-colored skin and eyes in comparison with their heterozygote littermates.  Their eyes darken during development until only a light red glint remains in adults.  Galak mutants are viable and fertile.  Galak mutants bear a strong resemblance to cardigan, sweater, and grey goose mutant animals.

Nature of Mutation
The galak mutation was mapped to Chromosome 15, and corresponds to a C to T transition at position 850 of the Slc45a2 transcript, in exon 3 of 7 total exons.
 

835 ACTGACCCTCCCTCACAGCAGGACCCTCAGGGC

247 -T--D--P--P--S--Q--Q--D--P--Q--G-

 

The mutated nucleotide is indicated in red lettering, and changes codon 252 (glutamine) to a stop codon.

Protein Prediction
Figure 1. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The galak mutation (red asterisk) results in protein truncation at amino acid 252 in the large cytosolic loop between transmembrane domains 6 and 7 of the SLC45A2 protein.  This image is interactive. Click on the mutations for more specific information. 
The galak mutation results in protein truncation at amino acid 252 in the large cytosolic loop between transmembrane domains 6 and 7 (Figure 1).  It is unknown whether normal levels of the truncated MATP protein exist in galak mice or whether this protein is localized to the membrane.
 
Please see the record for cardigan for more information on Slc45a2.
Putative Mechanism
The galak mutation results in truncation of SLC45A2 before the seventh transmembrane domain.  Humans with SLC45A2 mutations causing protein truncation in the seventh or ninth transmembrane domains have very little pigmentation in their skin and eyes (1), much like galak homozygotes.  The classical underwhite mutation causes a frameshift and a premature stop codon at amino acid 308 in the seventh transmembrane domain (2).  These mice, like galak mutants, are nearly white with dark red eyes (3), and they do not express Slc45a2 mRNA (4). These results suggest that the truncated protein encoded by Slc45a2galak would probably not be expressed, resulting in a functionally null allele of Slc45a2.
Primers Primers cannot be located by automatic search.
Genotyping
Galak genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  
 
Primers for PCR amplification
Galak(F): 5’- CAAGCATGTAGCTAGACCTTCCACAGAGATGAAG -3’
Galak(R): 5’- CAATGACATTGTCATCTGAAGGAACAAAGTTG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             2:00
5) repeat steps (2-4) 40X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Galak_seq(F): 5’- GTGGGAAATAAACATGACTGACTGAATATG -3’
Galak_seq(R): 5’- TTCACAAAGAACAAAGTGACTTAGCAAG -3’
 
The following sequence of 1277 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Slc45a2) is amplified:
 
   1 caagcatgta gctagacctt ccacagagat gaagatagat gtcaaggttc ttagatcatc
  61 ccaagctagt ttgtattttc tcaagaagct tggtggtgga ggaggataat aaaatcatct
 121 ctttttactg ccactggaaa ttgattttta tggactaatt tgggtcaata atttgagttt
 181 tttgcttgtt gttacgtttt tgttgtcttt aagtagtata gaggatacag gttgggaagg
 241 tgacagtatc tccaaggacg gtattttatt tgctgtgcgt tcactgctgt attgaacatt
 301 tttcatttcc ataccattga ccttcttggt aggttacttg tatgttatta ctccataaaa
 361 gatacacagg actaaggtca cagcaaataa atgccagaga tgagtcttga acccacactg
 421 tcttagcctc ttgctgtgtt ggcgcttcat cactacaggc agtctctgct ttcctcaggg
 481 agcttttcca cagaagggga aggtctgtgc atggtgggaa ataaacatga ctgactgaat
 541 atgctaatgc atatctctct ctgtctctct ctctctctct cccaccccct ttgctttcta
 601 ggttttggag gtgcccttgg ctacattttg ggtgccatag actgggtgca tctagatctg
 661 ggaaggctgc tgggcacaga attccaggtc atgttcttct tctctgccct ggttctcatc
 721 ttgtgcttca tcacacacct gtgcagtatc cctgaagctc cactcagaga tgctgcaact
 781 gaccctccct cacagcagga ccctcagggc tcgtcgctgt cagccagtgg gatgcatgaa
 841 tacggttcta ttgagaaagt taaaaatgga ggtgcagaca cagagcagcc agtacaggaa
 901 tggaaaaaca aaaagccttc tggccaggta aagatgcaaa ttcttttttc tttttctcca
 961 catgggggaa gttttcttgc taagtcactt tgttctttgt gaaatttgtc ttgtttgctt
1021 gtctgatgtg aagttttgtg aagtctattt gaacctttaa aacctccctt agtcattccc
1081 tgttggaatg agaattttgt gcctcagtgg ttctcttgcc tcttactcct ttcaaagcat
1141 caaactgggg aaggtgagac atctgtaaca gtgagaccat gtgagaactc tccagccacc
1201 ttctggccac aggacatagt cttttagata aagaattaca atctacaact ttgttccttc
1261 agatgacaat gtcattg
                                                          
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsKarine Crozat, Xin Du, Bruce Beutler
List |< first << previous [record 52 of 132] next >> last >|
Edit History
2011-08-25 12:01 PM (current)
2011-01-07 9:08 AM
2010-07-07 2:48 PM
2010-07-07 2:48 PM
2010-02-03 9:33 AM