Phenotypic Mutation 'gummi_bear' (pdf version)
Allelegummi_bear
Mutation Type missense
Chromosome8
Coordinate3,161,770 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Insr
Gene Name insulin receptor
Synonym(s) IR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220
Chromosomal Location 3,122,061-3,279,617 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010568, NM_001330056; MGI:96575

Mapped Yes 
Amino Acid Change Serine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000088837]
PDB Structure
1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: S1084P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Recep_L_domain 52 164 5e-28 PFAM
FU 231 274 1.66e-10 SMART
Pfam:Recep_L_domain 359 473 2.5e-30 PFAM
FN3 496 602 4.02e1 SMART
FN3 624 821 1.16e-6 SMART
FN3 841 924 3.17e-4 SMART
transmembrane domain 947 969 N/A INTRINSIC
TyrKc 1013 1280 3.11e-134 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1327 1336 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000091291)
Predicted Effect probably benign
Meta Mutation Damage Score 0.9433 question?
Is this an essential gene? Probably essential (E-score: 0.846) question?
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10
DSS: sensitive day 7
FACS neutrophils - increased
Candidate Explorer Status CE: excellent candidate; human score: 3; ML prob: 0.58
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(19) : Chemically induced (ENU)(3) Gene trapped(2) Targeted(8) Transgenic(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Insr APN 8 3258682 missense probably damaging 1.00
IGL01986:Insr APN 8 3158817 missense probably damaging 1.00
IGL02135:Insr APN 8 3258741 missense probably damaging 1.00
IGL02203:Insr APN 8 3155817 missense probably benign 0.18
IGL02220:Insr APN 8 3159578 missense probably damaging 1.00
IGL02678:Insr APN 8 3173570 missense probably benign 0.00
IGL02961:Insr APN 8 3258785 missense probably benign 0.08
IGL03099:Insr APN 8 3258715 missense probably damaging 1.00
IGL03125:Insr APN 8 3184972 missense possibly damaging 0.87
IGL03290:Insr APN 8 3258574 missense probably damaging 1.00
Patently UTSW 8 3159475 missense probably damaging 1.00
trolli UTSW 8 3198111 missense probably benign 0.31
R0047:Insr UTSW 8 3202947 missense probably damaging 0.97
R0053:Insr UTSW 8 3155683 missense probably damaging 1.00
R0053:Insr UTSW 8 3155683 missense probably damaging 1.00
R0480:Insr UTSW 8 3161770 missense probably damaging 1.00
R0748:Insr UTSW 8 3258841 missense probably damaging 1.00
R0919:Insr UTSW 8 3158769 missense probably damaging 1.00
R1348:Insr UTSW 8 3192635 missense probably damaging 1.00
R1467:Insr UTSW 8 3169720 missense probably damaging 0.99
R1467:Insr UTSW 8 3169720 missense probably damaging 0.99
R1568:Insr UTSW 8 3165576 missense probably benign
R1768:Insr UTSW 8 3159561 missense probably damaging 1.00
R2093:Insr UTSW 8 3204762 missense probably damaging 1.00
R2111:Insr UTSW 8 3169748 missense probably benign 0.17
R2112:Insr UTSW 8 3169748 missense probably benign 0.17
R2352:Insr UTSW 8 3192593 missense probably damaging 1.00
R2364:Insr UTSW 8 3174820 missense probably benign
R2842:Insr UTSW 8 3202986 missense probably damaging 1.00
R3162:Insr UTSW 8 3161416 missense possibly damaging 0.65
R3162:Insr UTSW 8 3161416 missense possibly damaging 0.65
R4081:Insr UTSW 8 3211391 missense probably benign 0.00
R4441:Insr UTSW 8 3194902 missense probably benign 0.00
R4672:Insr UTSW 8 3167501 critical splice donor site probably null
R4687:Insr UTSW 8 3161709 missense probably benign 0.42
R4708:Insr UTSW 8 3211346 intron probably benign
R4890:Insr UTSW 8 3198234 missense probably benign 0.16
R4949:Insr UTSW 8 3185059 missense probably benign 0.04
R4996:Insr UTSW 8 3192665 missense probably null 0.98
R5073:Insr UTSW 8 3159475 missense probably damaging 1.00
R5176:Insr UTSW 8 3158742 missense probably benign 0.03
R5200:Insr UTSW 8 3198059 critical splice donor site probably null
R5323:Insr UTSW 8 3202902 missense probably benign 0.02
R5453:Insr UTSW 8 3155694 missense probably benign 0.06
R5516:Insr UTSW 8 3155764 nonsense probably null
R5704:Insr UTSW 8 3185122 missense possibly damaging 0.52
R5820:Insr UTSW 8 3155976 missense probably damaging 1.00
R5879:Insr UTSW 8 3198173 nonsense probably null
R5894:Insr UTSW 8 3174869 missense possibly damaging 0.88
R5937:Insr UTSW 8 3174808 missense probably benign
R5966:Insr UTSW 8 3258697 missense probably benign 0.04
R6134:Insr UTSW 8 3192572 missense probably damaging 1.00
R6352:Insr UTSW 8 3173479 critical splice donor site probably null
R6423:Insr UTSW 8 3173566 missense probably benign
R6687:Insr UTSW 8 3198111 missense probably benign 0.31
R6985:Insr UTSW 8 3161372 missense possibly damaging 0.87
R6993:Insr UTSW 8 3258752 missense probably damaging 1.00
R7041:Insr UTSW 8 3258418 missense probably benign
R7109:Insr UTSW 8 3258481 missense probably benign 0.33
R7216:Insr UTSW 8 3203034 missense possibly damaging 0.53
R7287:Insr UTSW 8 3169717 missense probably benign 0.00
R7378:Insr UTSW 8 3198231 missense probably damaging 1.00
R7525:Insr UTSW 8 3192642 missense probably damaging 1.00
R7572:Insr UTSW 8 3173602 missense probably benign 0.11
R7636:Insr UTSW 8 3258709 missense probably damaging 1.00
R7684:Insr UTSW 8 3169753 missense possibly damaging 0.85
R7840:Insr UTSW 8 3258415 missense probably benign 0.04
R8075:Insr UTSW 8 3155862 missense probably benign 0.17
R8161:Insr UTSW 8 3258660 missense probably damaging 1.00
R8220:Insr UTSW 8 3158702 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-09-04 9:48 PM by Diantha La Vine
Record Created 2014-06-15 1:08 PM by Emre Turer
Record Posted 2018-10-25
Phenotypic Description

Figure 1. Gummi bear mice exhibited susceptibility to DSS-induced colitis by day 7. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gummi bear phenotype was identified among G3 mice of the pedigree R0480, some of which showed susceptibility to low-dose DSS-induced colitis at day 7 (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the susceptibility to DSS-induced colitis using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 113 mutations (X-axis) identified in the G1 male of pedigree R0480.  Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 3. CRISPR-Insr mice exhibited susceptibility to DSS-induced colitis by day 7. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 113 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Insr: a T to C transition at base pair 3,161,770 (v38) on chromosome 8, or base pair 117,880 in the GenBank genomic region NC_000074 encoding Insr. The strongest association was found with a recessive model of inheritance to the raw DSS-induced susceptibility phenotype, wherein one variant homozygote departed phenotypically from 12 homozygous reference mice and 8 heterozygous mice with a P value of 2.779 x 10-8  (Figure 2).

 

The mutation corresponds to residue 3,739 in the mRNA sequence NM_010568 within exon 17 of 21 total exons.

 

3724 CTTCTTGGGGTGGTATCCAAAGGACAGCCAACG

1079 -L--L--G--V--V--S--K--G--Q--P--T-

 

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to proline (P) substitution at position 1,084 (S1084P) in the InsR protein, and is strongly predicted by Polyphen-2 to be probably damaging (score = 1.000).

 

The DSS-induced colitis phenotype was verifed by CRISPR-mediated replacement of the gummi_bear Insr mutation (P = 1.095 x 10-14; Figure 3).

Protein Prediction

Figure 4. Domain organization of InsR. The gummi_bear mutation results in a serine to proline substitution at position 1084. Domain information is from SMART and UniProt. This image is interactive. Click on each mutation for more information.

Figure 5. Structure of human insulin receptor ectodomain. The gummi_bear mutation occurs in an unsolved section of the protein. UCSF Chimera model is based on PDB 4ZXB, Croll, et al. Structure24, 469-476 (2016). Click on the 3D structure to view it rotate.

Insr encodes the insulin receptor (IR), a member of the receptor tyrosine kinase family. The IR forms either a heterodimer comprised of an extracellular α subunit and a membrane-spanning β subunit (αβ), or a heterotetramer of two α and two β  subunits (α2β2); the α and β subunits are both coded by Insr. The α and β subunits are joined by disulfide bonds, which are proteolytically processed at a precursor processing enzyme cleavage site to generate the individual subunits (1;2). IR can also form a heterodimer/heterotetramer (Insrαβ/Igf1rαβ) with insulin-like growth factor-1 receptor (IGF-1R), which alters the selectivity and affinity for insulin and IGF-1 (3). IR also can form a hybrid complex with Met, a receptor for hepatocyte growth factor (HGF) (4). The IR/Met hybrid can strongly activate IR-associated signaling cascades.

 

IR has a 27-amino acid signal sequence (Figure 4). The α subunit has two leucine-rich domains, a cysteine-rich domain, a fibronectin type III (FnIII) domain, a partial FnIII domain, and a long carboxy-terminal segment that has the furin cleavage site (5;6). The β subunit begins (after a short amino-terminal segment) with the completion of the partial FnIII domain of the α subunit, a third FnIII domain, a transmembrane domain, a juxtamembrane region, a tyrosine kinase domain, and a carboxy-terminal region. The ectodomain of the IR forms an antiparallel “inverted V” [Figure 5; PDB: 4ZXB; (6;7)]. One leg of the V shape is formed from the first leucine-rich domain, the second cysteine-rich region, and the second leucine-rich domain (6). The second leg of the V is comprised of the three FNIII domains. Insulin binding is mediated by two sites in the ectodomain (8). The first site is formed by the first leucine-rich domain in one α subunit and the C-terminal segment of the other α subunit of α2β2 IR. The second site involves loops from the first and second FnIII domains of the other αβ half-receptor.

 

The IR kinase domain has a canonical kinase architecture with N- and C-lobes. The N-lobe has a five-stranded β sheet and a single α helix (αC), while the C-lobe is mainly helical. The C-lobe has most of the catalytic residues within the catalytic and activation loops. An α helix (αJ) at the carboxy-terminal end of the C-lobe is unique to the IR. The function of the αJ helix is unknown, but in a complex with the phosphastase PTP1B, the αJ helix is part of the phosphatase binding site (9). The kinase activity of the IR is regulated by phosphorylation of the activation loop (amino acids 1150 to 1172) in the C-lobe. Tyr1158, Tyr1162, and Tyr1163 within the activation loop are autophosphorylated after binding of insulin to the ectodomain.

 

INSR undergoes alternative splicing of exon 11 to generate two isoforms that differ by exclusion (isoform A; IR-A) or inclusion (isoform B; IR-B) of a 12- amino-acid sequence in the carboxy-terminal part of the α subunit (10). IR-A is predominantly expressed in fetal tissues, brain and leukocytes, while IR-B is highly expressed in the liver (11). Similar amounts of IR-A and IR-B are expressed in placenta, skeletal muscle, and adipose tissue (11). IR-A has higher affinity for both insulin and IGF-2 as well as a higher rate of internalization than IR-B, and IR-A is often upregulated in cancers (12).

 

The gummi_bear mutation results in a serine (S) to proline (P) substitution at position 1,084 (S1084P), which is within the kinase domain of the β subunit.

Expression/Localization

The IR is ubiquitously expressed.

Background
Figure 6. Binding of insulin to the insulin receptor (IR) propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways. Insulin binding to the IR promotes autophosphorylation of the receptor. IRS1/2 recruitment to the IR results in PI3K and GRB2 activation. Activated PI3K phosphorylates membrane phospholipids, the major product being phosphatidylinositol-3,4,5-trisphosphate (PIP3). PIP3 in turn activates PIP3-dependent kinase 1 (PDK1). PDK1 activates another kinase called protein kinase B (PKB; alternatively, AKT). Insulin-mediated activation of AKT2/PKBβ results in inhibition of lipolysis and gluoconeogenesis as well as activation of protein and glycogen synthesis. PDK1 phosphorylates some isoforms of protein kinase C (PKC). The PKC isoform, PKCλ/ζ, phosphorylates proteins associated with intracellular vesicles containing the glucose transporter, GLUT4, resulting in their migration to and fusion with, the plasma membrane and subsequent increased glucose uptake and metabolism in adipose tissue. GRB2 activation results in signal transduction via the monomeric G-protein, RAS. Activation of RAS ultimately leads to changes in the expression of numerous genes via activation of members of the extracellular signal-regulated kinases, ERK.

The insulin signaling pathway regulates glucose uptake and release as well as the synthesis and storage of carbohydrates and lipids (Figure 6). Binding of insulin to the IR activates IR intrinsic tyrosine kinase activity, which propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways (13). Insulin growth factor 1 (IGF1) and IGF2 are also traditional IR ligands. Binding of insulin to the ectodomain of IR activates the insulin signaling pathway by triggering a conformational change that facilitates IR autophosphorylation of the kinase domain. Phosphorylation of the kinase activation loop stimulates IR catalytic activity. Phosphorylation of the juxtamembrane region of the IR recruits downstream signaling proteins (e.g., insulin receptor substrate proteins [Irs1 (see the record for runt) and Irs2 (see the record for dum_dum)] and Shc [see the record for shrine (Sch2)]). Shc activates the Shc-Grb2-Sos-Ras-Raf-MAPK pathway, which controls cellular proliferation and gene transcription. Phosphorylated IRS1 docks with SH2 domain-containing proteins and mediates signal transduction to downstream factors. IRS1 and IRS2 activate many similar downstream pathways (e.g., the PI3K and Akt pathways), but are not functionally redundant. The IRS proteins recruit and activate PI3K, which leads to the generation of the second messenger PIP3. PIP3 recruits and activates PDK-1, which phosphorylates and activates Akt and atypical PKCs. Akt regulates glucose transport, lipid synthesis, gluconeogenesis, glycogen synthesis, cell cycle, and survival. Activated IR can also phosphorylate several “alternative” substrates, some of which provide docking sites for recruitment of other downstream signaling proteins (Table 1).

 

Table 1. Select alternative substrates of IR

Substrate

Description of substrate

IR-associated effect

References

ADRB2 (beta-2-adrenergic receptor)

G-protein coupled receptor

Recruits GRB2 and other proteins to promote the internalization of ADRB2

(14;15)

Calmodulin

Calcium-dependent messenger protein

Attenuates biological activity

(16;17)

CEACAM1 (carcinoembryonic antigen-related cell adhesion molecule 1)

Cell-cell adhesion molecule

Initiates IR internalization as well as competes with IR for Shc binding (attenuating IR-associated signaling

(18;19)

Dok1 (docking protein 1)

Scaffolding protein

Enhances its binding to GAP (an inhibitor of Ras)

(20)

FAK1 (focal adhesion kinase 1)

Cytosolic tyrosine kinase in integrin signaling

Unknown; IR promotes FAK1 phosphorylation in suspended cells, but stimulates IR dephosphorylation in attached cells

(21;22)

FRS2 (fibroblast growth factor receptor substrate 2)

Adaptor protein that links fibroblast growth factor receptors to downstream signaling

Putatively recruits SHP2 to the IR

(23)

PTP1C

Protein tyrosine phosphatase

Unknown; no evidence demonstrating that it can directly dephosphorylate IR

(24)

SH2B1 and SH2B2

SH2 domain-containing proteins

Phosphorylated SH2B2 docks c-Cbl to IR and promotes IR ubiquitination and internalization; may function as docking sites for downstream insulin signaling factors

(25;26)

STAT5B (signal transducer and activator of transcription 5B)

Transcription factor

Activates a series of target genes, including glucokinase and SOCS proteins

(27-30)

SYNCRIP (synaptotagmin-binding cytoplasmic RNA-interacting protein) and Sam68 (the 68 kDa Src substrate associated during mitosis)

Cytoplasmic RNA-binding proteins

Sam68 docks p85 PI3K and GAP proteins; affects RNA-binding activity

 

(31-34)

Vav3

Guanine nucleotide exchange factor

Promotes Rac-1 activation, actin cytoskeletal rearrangement, and the formation of cell membrane ruffles

(35)

 

Several factors negatively regulate IR-associated signaling [reviewed in (36)]. Adaptor proteins Grb7, Grb10, and Grb14 (37-40) reduce IR activity through direct interaction. The Grb proteins are recruited to the IR whereby they compete with IRS for IR binding, inhibiting IR activity. The protein tyrosine phosphatases PTP1B, PTP1C, TCPTP, and PTPRF dephosphorylate the IR, subsequently negatively regulating its activity (41-43). The phosphatases are recruited to the IR through their SH2 domains after insulin stimulation and IR autophosphorylation. Suppressors of cytokine signaling (SOCS) proteins (SOCS1 [see the record for minipad], SOCS3, and SOCS6) directly interact with the IR to block downstream signal transduction by competing for binding to the IR (44;45). Protein kinase C isoforms (PKCδ [see the record for Rigged] and PKCε [see the record for pinnacles]) also negatively regulate IR-associated signaling (46). The PKCs phosphorylate the IR, which lowers its tyrosine kinase activity (46).

 

Mutations in INSR are associated with insulin-resistant diabetes mellitus with acanthosis nigricans [OMIM: #610549; (47-49)]. Acanthosis nigricans is a skin condition characterized by areas of discoloration in body folds and creases often in the armpits, groin, and neck. INSR mutations are also linked to familial hyperinsulinemic hypoglycemia 5 [HHF5; OMIM: #609968; (50)], leprechaunism [alternatively, Donohue syndrome; OMIM: #246200; (51-55)], and Rabson-Mendenhall syndrome [OMIM: #262190; (56;57)]. Patients with leprechaunism have growth delays, skin abnormalities, reduced muscle mass, phallic enlargement, and insulin resistance. Patients with Rabson-Mendenhall syndrome exhibit dental and skin abnormalities, abdominal distention, and phallic enlargement.

 

Insr-deficient (Insr-/-) mice exhibited postnatal lethality within 72 hours after birth due to hyperglycemia, diabetic ketoacidosis, and hepatic steatosis (58;59). Insr-/- mice exhibit reduced body weights compared to wild-type controls. Rescue of IR expression in brain, liver, and pancreatic beta cells rescued the Insr-/- mice from neonatal death, prevented diabetes in most mice, and normalized adipose tissue content, lifespan, and reproductive function (60). Heterozygous Insr mice (Insr+/-) mice exhibited increased circulating insulin levels and insulin resistance (61;62). Heterozygous mice for an ENU-induced Insr alleles exhibited hyperglycemia and increased circulating insulin levels (MGI). Mice with muscle-specific IR knockout showed increased fat mass, serum triglycerides, and fatty acids; however blood glucose, serum insulin, and glucose tolerance were normal (63). Mice with fat-specific IR knockout showed reduced fat mass, were protected from age-related obesity and obesity-related glucose intolerance, and had increased mean life spans (64;65). Mice with brown adipose tissue-specific IR knockout showed an age-dependent loss of interscapular brown fat and developed an insulin-secretion defect resulting in a progressive glucose intolerance, without insulin resistance (66). Mice with pancreatic beta cell-specific IR knockout showed loss of insulin secretion in response to glucose and a progressive impairment of glucose tolerance (67). Mice with hepatocyte-specific IR knockout showed insulin resistance, glucose intolerance, hyperinsulinemia, and a failure of insulin to suppress hepatic glucose production (68). Mice with cardiomyocyte-specific IR knockout showed subendocardial fibrosis and left ventricular dysfunction four weeks after a transverse aortic constriction (69).

Putative Mechanism

The role of IR-associated signaling in colonic inflammation is unclear. Increased IGF bioactivity leads to increased epithelial proliferation and mucosal barrier repair, thereby lessening inflammation (70). Aberrant IGF bioactivity in the gummi_bear mice may be leading to reduced epithelial proliferation and mucosal barrier repair after exposure of the mice to DSS.

Primers PCR Primer
gummi_bear_pcr_F: GCGTTCAAGTATGCCATGCCATC
gummi_bear_pcr_R: TGCAGGGAAGACAGTTCCCAAAC

Sequencing Primer
gummi_bear_seq_F: TTCTAAAGTCAAAACAGGGGTTGC
gummi_bear_seq_R: ccgaggaacagtaggcaag
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 786 nucleotides is amplified (chromosome 8, - strand):


1   tgcagggaag acagttccca aactagtagt ggcatgttac gagacaaatg cttgaagaaa
61  ttgaaaaaga gagaggaaga ggattgtact ctacctgagc aaagtcttaa agggatgaac
121 catgtgtcca tgggagtgag ggaccagact aaggagagca ggaagtgcga aggtctggag
181 gtggaaatat ggtttatata ccgaggaaca gtaggcaagt gagatttgct tgggatgttc
241 tatatatgag tgggtctgtt tgctccctca ttctagggct gcctatgctc catccaaaca
301 cagggtggcc cgtgttttac tgttaccaga gagagcattg tgaattgaag taaaacctgg
361 accctcttct aataacctcc ctgcttgttc tcatgcttgt tctgcaggtc cgccttcttg
421 gggtggtatc caaaggacag ccaacgctgg tagtgatgga attgatggct catggagacc
481 tgaaaagtca cctccgttct ctgaggccag atgctgaggt aagctgcctc taggtaagac
541 ccataacagg gtacctgatc ttacgtatac caacctcact aaatgcaaac ccatgtttta
601 acttcagaaa taccctggct acacccctga cccacacacc ctataagaga tgatttagat
661 ggaatcagag tgctaattgc aacccctgtt ttgactttag aataacccag gccgccctcc
721 ccctaccttg caagaaatga ttcagatgac agcagaaatt gctgatggca tggcatactt
781 gaacgc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer and Bruce Beutler