Phenotypic Mutation 'bingo'

• Allele: bingo
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 78,449,168 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Rac2
• Gene Name: Rac family small GTPase 2
• Chromosomal Location: 78,443,369-78,456,983 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013] ; PHENOTYPE: Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Alanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000036384] [ENSMUSP00000154826]
• AlphaFold: Q05144
• SMART Domains: Protein: ENSMUSP00000036384; Gene: ENSMUSG00000033220; AA Change: T115A

Domain	Start	End	E-Value	Type
RHO	6	179	3.36e-135	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000043214)
• Predicted Effect: probably benign
• Predicted Effect: unknown
• Meta Mutation Damage Score: 0.9533
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• MMRRC Submission: 038186-MU
• Last Updated: 2019-09-04 9:48 PM by Anne Murray
• Record Created: 2014-06-16 10:33 PM by Kuan-Wen Wang
• Record Posted: 2015-04-20
• Science Writers: Anne Murray
• Illustrators: Peter Jurek, Katherine Timer
• Authors: Bruce Beutler, Jin Huk Choi, Kuan-Wen Wang, Ming Zeng

Accession Number

NCBI RefSeq: NM_009008; MGI:97846

Alleles Listed at MGI

All mutations/alleles(4) : Gene trapped(2) Radiation induced(1) Targeted(1)

Phenotypic Description

Figure 1. Homozygous bingo mice exhibited diminished T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The bingo phenotype was identified among G3 mice of the pedigree R0627, some of which showed a diminished T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll; Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-independent antibody response to NP-Ficoll using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted versus the chromosomal positions of 105 mutations (X-axis) identified in the G1 male of pedigree R0627. Normalized phenotype data were used for single locus linkage analysis without consideration for G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and P = 4.762 x 10 -4 for Bonferroni significance, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 105 mutations. The diminished T-independent antibody response to NP-Ficoll was linked by continuous variable mapping to a mutation in Rac2: an A to G transition at base pair 78,564,968 (v38) on chromosome 15, or base pair 7,816 in the GenBank genomic region NC_000081 encoding Rac2. Linkage was found with a recessive model of inheritance, wherein 7 variant homozygotes departed phenotypically from 10 homozygous reference mice and 19 heterozygous mice with a P value of 9.038 x 10^-6 (Figure 2). The mutation corresponds to residue 481 in the mRNA sequence NM_009008 within exon 5 of 7 total exons.

466 ATCATCCTGGTGGGTACCAAGCTGGACCTTCGC 110 -I--I--L--V--G--T--K--L--D--L--R-

The mutated nucleotide is indicated in red.  The mutation results in a threonine (T) to alanine (A) substitution at position 115 (T115A) in the Rac2 (Ras-related C3 botulinum toxin substrate 2) protein, and is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 1.00) (1).

Protein Prediction

Figure 3. Protein domains of Rac2. The amino acid altered in bingo is indicated. Rac proteins have 5 GTP binding and hydrolysis domains (G-boxes; G1-G5), 2 switch regions, and a C-terminal polybasic region.

Figure 4. Crystal structure of human Rac2. The structure is a Rac2 fragment of amino acids 2-179. The switch regions are indicated. The image was generated by Chimera and is based on PDB: 2W2X. The image is interactive; click to view.

Rac2 is a member of the Rac subfamily of Rho guanosine triphosphatases (Rho GTPases). Rho GTPases have several conserved domains including five GTP binding and hydrolysis domains (G-boxes; G1-G5), two switch regions (switch I and II), a polybasic domain, and a prenylation site [Figure 3; (2)]. G-boxes function in GDP binding and exhibit GTPase activity (3). In Rac2, these regions correspond to amino acids 10-17 (G1), Thr35 (G2), 57-61 (G3), and 115-118 (G4), and 157-160 (G5). The Rac proteins each have two highly conserved switch regions, switch I (amino acids 27-40) and switch II (amino acids 56-71), situated on either side of the bound nucleotide [Figure 3 and 4; PDB:2W2X; (4)]. Both switch regions are sites of interactions between the Rac proteins and guanine nucleotide exchange factors (GEFs) and guanine nucleotide-dissociation inhibitors (GDIs) as well as with downstream protein targets (5).

The main difference between the Rac family members is at the C-terminal polybasic tail. Rac1 has a stretch of basic amino acids, while Rac2 has several nonbasic residues that interrupt the region. The polybasic region of Rac2 (RQQKRP; amino acids 183-188) is required for its function as a regulator of NAPDH oxidase (see the Background section) (5;6). In addition, the polybasic domains of Rac1 and Rac2 regulate binding to effector proteins such as PAK1, phosphatidylinositol 5-kinase, and the adaptor Crk (7;8). Lipid prenylation at the C-terminus (Cys-A/S-L-L-COOH) and the polybasic domain regulate the localization of Rho GTPases to the membrane and facilitate protein-protein interactions (5;6;9;10). After prenylation, the C-terminal tripeptide (A/SLL) is preotylically removed and the new C-terminus is methylated (6;11).

The bingo mutation results in a threonine (T) to alanine (A) substitution at position 115 (T115A) within the G4 G-box.

Expression/Localization

Rac2 is expressed solely in hematopoietic cells (9;12;13). Rac2 is localized to the cytoplasm and perinuclear pool, but upon cell activation, Rac2 is translocated to the plasma membrane (6).

Background

Figure 5. Rho GTPase activation cycle. Rho GTPases cycle between the inactive GDP-bound state and active GTP-bound state which interacts with effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP. GTPase-activating proteins (GAPs) inactivate Rho GTPases by stimulating GTP hydrolysis. Rho guanine nucleotide-dissociation inhibitors (RhoGDIs) recruit inactive GDP-bound Rho GTPases from the membrane.

The Rho-like GTPases comprise several proteins including Rho, Rac1/2/3, Cdc42, RhoD, RhoG, RhoE, and TC10 [reviewed in (14)]. The Rho GTPases integrate receptor-mediated signals through binding to effectors and regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation, apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, and transcription. The Rho GTPases are active when bound to GTP and are inactive in their GDP-bound form [Figure 5; reviewed in (15;16)]. Regulation of Rho GTPase activity is complex and involves GEFs that promote the exchange of GDP for GTP, GTPase-activating proteins (GAPs) that enhance the GTPase activity of Rho proteins, and GDIs that sequester Rho GTPases in a GDP-bound state (17).

Rac2 (and the other Rac proteins) function in actin polymerization resulting in lamellopodial extension and membrane ruffling, directed migration, chemotaxis, and superoxide (O₂⁻) production in phagocytic cells as well as cytoskeleton organization in red blood cells and osteoclasts [(18-23)]. The Rac proteins regulate leukocyte migration by transducing signals from cell surface receptors (e.g., the Fcγ receptor, formylmethionyl-leucyl-phenylalanine (fMLP) receptor, and β₂ integrins) to the actin and microtubule cytoskeletons through cytoplasmic effectors (e.g., tyrosine kinases, scaffolding/adapter proteins, nucleotide exchange proteins, and phosphatases) upon binding of GTP (24). Rac2 dually regulates phospholipase D (PLD) activity (25). PLD is an enzyme at the plasma membrane that catalyzes the hydrolysis of phosphatidylcholine to phosphatidic acid, which regulates cytoskeleton dynamics, calcium mobilization, secretion, superoxide production, endocytosis, exocytosis, vesicle trafficking, glucose transport, mitogenesis, and cell survival (26). Rac2-mediated inhibitory responses on PLD can be reversed in the presence of phosphatidylinositol 4,5-bisphosphate (PIP₂), indicating a connection between Rac2-PIP₂-PLD that regulates cell migration (25). Rac2-associated cell type-specific functions are described in more detail, below.

Figure 6. Rac2 mediates activation of the NADPH oxidase. Upon cell activation by a stimulus (fMLP is shown), Rac2 migrates, along with cytosolic NAPDH subunits p40 PHOX , p47 PHOX , and p67 PHOX to the membrane-associated NADPH subunits Rap1A and cytochrome b 558 , a p22 PHOX · gp91 PHOX complex. The NADPH complex mediates superoxide production. See the text for more details.

Neutrophils

In neutrophils, Rac2 is essential for F-actin polymerization, L-selectin (see the record for dim_sum)-mediated adhesion, primary granule release of the mediators myeloperoxidase and elastase (see the record for Ruo) in response to cytochalasin B/fMLP (CB/fMLP) and CB/leukotriene B₄ (CB/LTB₄), the formation of neutrophil extracellular traps (NETs) that bind invading pathogens  through the regulation of nitric oxide and reactive oxygen species, chemotaxis in response to fMLP, complement C5a, or LTB₄, and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase function [Figure 6; (21;27-29)]. NADPH oxidase is a multiprotein phagocytic oxidase complex that mediates the production of reactive oxygen species in response to growth factors or inflammatory cytokines. The NADPH is assembled from a membrane-spanning flavo-cytochrome b₅₅₈ (cyt b; composed of both gp91^phox and p22^phox) and four cytosolic factors (p47^phox, p67^phox, p40^phox, and Rac2). The cytosolic factors translocate to the cyt b to generate an active enzyme. Upon neutrophil activation, Rac2 is activated by a membrane-associated GEF and subsequently assembles into a membrane-localized NADPH oxidase through a mechanism coordinated with the translocation of the p47^phox–p67^phox complex (30;31). Rac2 acts independently of p67^phox to regulate initial transfer of electrons from NADPH to the to cyt b-associated flavin adenine dinucleotide (FAD). However, Rac2 binding to p67^phox is necessary for the subsequent electron transfer from FAD to molecular oxygen to form superoxide [(32); reviewed in (33)]. Rac2 ^-/- mice have delayed wound closure to defects in Rac2-dependent NAPDH oxidase activity during wound healing (34).

Macrophages

Rac2 is a component of the myeloid α₄β₁- and α_v-directed signalosome in macrophages through a myeloid-specific association with the nonreceptor protein tyrosine kinase Syk (see the record for poppy) (35). Rac2-deficient macrophages also exhibit a reduction in superoxide production and phagocytosis after phorbol ester (PMA), fMLP, or FcγR stimulation (36). Yamauchi et al. found that the cell morphology and actin responses in the Rac2-deficient macrophages was similar to those in wild-type macrophages (36). In contrast, Wheeler et al. determined that loss of Rac2 expression resulted in reduced levels of polymerized actin and podosome formation (24). Loss of Rac2 expression had little effect on macrophage migration speed (24).

Mast cells

Rac2 is required for the migration, degranulation, integrin-mediated adhesion to fibronectin, and growth-dependent survival of mast cells (22). The deficiency of mast cell growth upon loss of Rac2 expression correlated with increased apoptosis after growth factor simulation and a concomitant reduction in Akt activation (22). Also, loss of Rac2 expression resulted in increased expression of the proapoptotic protein BAD and decreased expression of the antiapoptotic protein Bcl-X_L (22). In mast cells, Rac2 is required for stem cell factor-induced activation of JNKs and the c-Jun pathway to regulate the expression of 38 genes including those of several mast cell proteases [e.g., mouse mast cell protease 7 (MMCP-7)] (37).

Figure 7. Rac2 during T cell activation. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. CD45 dephosphorylates C-terminal inhibitory tyrosine residues on Lck and Fyn, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2 (Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1. SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1). This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways. Tyrosine phosphorylated VAV1 stimulates the RHO family GTPases, preferentially Rac1 and Rac2. This leads to a signalling pathway that controls actin polymerization. Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively. PKCθ regulates nuclear factor-κB activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors.

T cells

Rac1 and Rac2 have redundant roles at several stages of T cell development through the regulation of survival and proliferation signals (38). Rac1 and Rac2 are both required for optimum T cell activation downstream of the T cell receptor and costimulatory proteins CD28 and CD5 (39-41). Antisense-mediated knockdown of Rac2 in Jurkat cells results in reduced actin polymerization triggered by L-selectin (42). Rac1 and Rac2 mediate the initial interaction between mature dendritic cells and naïve T cells by controlling the formation of dendrites from the mature dendritic cells, controlling the polarized short-range migration of dendritic cells toward T cells, and T cell priming (43).

Rac2 is essential for T cell activation in response to anti-CD3 and T cell receptor-specific antigens; costimulation with anti-CD28 or the addition of IL-2 partially compensates for the defects observed [Figure 7; (44)]. Rac2 is a substrate of Vav GEF activity and is proposed to relay Vav signaling during T cell activation (44). Rac2^-/- T cells exhibited reduced actin polymerization upon TCR cross-linking or antigen stimulation as well as reduced phosphorylation of ERK1/2 and p38. Calcium flux was also reduced upon antigen stimulation (44). Rac2 is required for normal IFN-γ production by activated CD4+ T Helper 1 (T_H1) cells through the activation of the NF-κB and p38 pathways (45).

In Rac2^-/- mice, there is a 90% increase in peripheral blood CD4+ and CD8+ T-lymphocyte numbers compared to wild-type mice (46). The proportions and numbers of double-negative (CD4-CD8-), double-positive (CD4+CD8+), and single-positive (CD4+CD8-, CD4-CD8+) T lymphocytes in the thymus were similar between wild-type and Rac2^-/- mice (46). In the spleen, CD8+ and CD4+ T-lymphocyte numbers were increased in the Rac2 ^-/- mice compared to wild-type mice (46). Lymph node T lymphocyte (Thy1+, CD4+, CD8+) chemotaxis was reduced in Rac2^-/- mice (46). In addition, filamentous actin generation in T lymphocytes in response to chemoattractants was reduced in the Rac2 ^-/- mice compared to wild-type mice (46).

B cells

Rac2 is required for B cell development as well as for either B cell receptor (BCR) signal transduction and subsequent calcium mobilization or in determining the efficiency of BCR ligation (47;48). Rac2 is required for efficient signaling after the co-ligation of CD19 and BCR. Rac2-deficient mice exhibit a 30% reduction in B cell numbers due mainly be a reduced number of recirculating B lymphocytes in the bone marrow (47). In the peripheral blood, Rac2^-/- mice had an increase in total leukocyte number including both B and T cells (47). B cell numbers were reduced in the spleen due to a loss of mature and/or marginal zone B cells (47). The levels of IgG1 and IgG2b were increased in the serum of Rac2^-/- mice, while the levels of serum IgM and IgA were reduced (47). Rac2^-/- lymphocytes were able to class switch to IgG1 in response to a T-dependent stimulus. After immunization with the T-dependent antigen DNP-dextran, TNP-specific IgM was reduced in the Rac2^-/- mice compared to wild-type mice; the production of TNP-specific IgG3 was comparable between the Rac2^-/- and wild-type mice.

Dendritic cells

Loss of Rac2 expression in CD8⁺ DC cells resulted in loss of phagosomal ROS production and reduced efficiency of antigen cross-presentation to CD8⁺ T cells to subsequently initiate cytotoxic immune responses (49). The phenotype of the Rac2-deficient CD8⁺ DC cells resembled that of CD8^- DC cells in that they had reduced ROS production and increased acidification.

Osteoclasts

Rac1 and Rac2 have overlapping functions in the regulation of preosteoclast motility (50;51). Combined deletion of both Rac1 and Rac2 results in arrested bone resorption and severe osteopetrosis through the dysregulation of the osteoclast cytoskeleton (50). In mature osteoclasts, Rac2 has a nonredundant function in chemotaxis, resorptive activity, integrin-mediated actin remodeling, and motility (20). Osteoclasts and preosteoclasts from Rac2 ^-/- mice exhibited a reduced rate of bone resorption and reduced chemotaxis in response to colony stimulating factor 1 (CSF1) (20;51). In addition, male Rac2 ^-/- mice have increased trabecular bone mass when compared to wild-type mice (20;51).  

Endothelial cells

Rac2 is required for avβ3, α4β1 and α5β1 integrin-associated migration and for the control of angiogenesis (52). During endothelial cell migration via the avβ3 and α4β1 integrins, Syk mediates the activation of Rac2 (52). Rac2 is also required for the aortic ring endothelial outgrowth response and neovascularization of the hindlimb after ischemic injury (52).

Human conditions

Mutations in RAC2 are linked to neutrophil (alternatively, phagocytic) immunodeficiency syndrome [NIS; OMIM: #608203; (53-55)] and decreased numbers of peripheral T and B cells. Patients with NIS have severe, recurrent infections, poor wound healing, and exhibit reduced neutrophil migration, azurophilic granule secretion, and superoxide production (53-55).

Putative Mechanism

Rac2^-/- mice exhibit a normal frequency of peripheral T cells, but exhibit leukocytosis due to an increased frequency of mature neutrophils in the peripheral blood (21). Rac2 ^-/- neutrophils (21), B cells (47) and T cells (46) show reduced migration and F-actin polymerization in response to chemokines, although chemotaxis is not completely abolished.  Consistent with these observations, recruitment of Rac2^-/- neutrophils to sites of inflammation is impaired. The incomplete block in chemotaxis most likely reflects the continued presence of Rac1 in these cell types. Rac2^-/- mice also display a lack of peritoneal B-1 and MZB cells, as well as abnormal T-independent and T-dependent antibody responses (47). The reduction in T-independent antibody responses observed in the bingo mice indicates loss of Rac2 function. A change in neutrophil frequency in the peripheral blood was not observed, indicating that some Rac2 function remains or that Rac1 may be compensating for the loss of Rac2 function and/or expression.

Primers

PCR Primer
bingo_pcr_F: GGACCAAGTCATTTTACCCAGGCAC
bingo_pcr_R: AGGGTCACTAGTACCACACAGGAC

Sequencing Primer
bingo_seq_F: tgacagagaaacacaggcatag
bingo_seq_R: ACAGTGAGGGTTCCTCCTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 731 nucleotides is amplified (chromosome 15, - strand):

1   agggtcacta gtaccacaca ggaccaatga gaggagagtc tccttgggct gtgtgtgtgt
61  tgtgggggga ggggtgggac agtgagggtt cctcctgcct ctgagccctg tccctttgtc
121 tatccaacct cgtgcctctt cttatcaaca cacaaactcg cttgactctt atctccaaaa
181 aaagtcttgc catttttttg tttttgcatg cctgctcaga tcctgctctg ccttgtgacc
241 ctcccgctag gggggctctt accccccttt tcctggtgcc ttgggcgtct ttgtcccact
301 ccccactgct ccctctcact ctccactccc ccacctccag tggttccctg aggtacggca
361 ccactgcccc agcaccccca tcatcctggt gggtaccaag ctggaccttc gcgatgacaa
421 ggacaccatc gagaagctga aggagaagaa gctggctccc atcacctacc cgcagggcct
481 ggcactggcc aaggatattg gtatggggct tgagctcaga gagagagggt atctgggggt
541 tggaggtgcc tgaacacagc cttgtcttag cgctatgctg catggtcaaa ctctgttctc
601 ccaaccattg taccagctgt gtgacctagg ctggtccctt ggcctctcta tgcctgtgtt
661 tctctgtcac aaaggtataa cagcagtgat ggcttctgcc atgtcagtgc ctgggtaaaa
721 tgacttggtc c

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Hirshberg, M., Stockley, R. W., Dodson, G., and Webb, M. R. (1997) The Crystal Structure of Human rac1, a Member of the Rho-Family Complexed with a GTP Analogue. Nat Struct Biol. 4, 147-152.

  3. Bourne, H. R., Sanders, D. A., and McCormick, F. (1991) The GTPase Superfamily: Conserved Structure and Molecular Mechanism. Nature. 349, 117-127.

  4. Bunney, T. D., Opaleye, O., Roe, S. M., Vatter, P., Baxendale, R. W., Walliser, C., Everett, K. L., Josephs, M. B., Christow, C., Rodrigues-Lima, F., Gierschik, P., Pearl, L. H., and Katan, M. (2009) Structural Insights into Formation of an Active Signaling Complex between Rac and Phospholipase C Gamma 2. Mol Cell. 34, 223-233.

  5. Yamauchi, A., Marchal, C. C., Molitoris, J., Pech, N., Knaus, U., Towe, J., Atkinson, S. J., and Dinauer, M. C. (2005) Rac GTPase Isoform-Specific Regulation of NADPH Oxidase and Chemotaxis in Murine Neutrophils in Vivo. Role of the C-Terminal Polybasic Domain. J Biol Chem. 280, 953-964.

  6. Filippi, M. D., Harris, C. E., Meller, J., Gu, Y., Zheng, Y., and Williams, D. A. (2004) Localization of Rac2 Via the C Terminus and Aspartic Acid 150 Specifies Superoxide Generation, Actin Polarity and Chemotaxis in Neutrophils. Nat Immunol. 5, 744-751.

  7. van Hennik, P. B., ten Klooster, J. P., Halstead, J. R., Voermans, C., Anthony, E. C., Divecha, N., and Hordijk, P. L. (2003) The C-Terminal Domain of Rac1 Contains Two Motifs that Control Targeting and Signaling Specificity. J Biol Chem. 278, 39166-39175.

  8. Knaus, U. G., Wang, Y., Reilly, A. M., Warnock, D., and Jackson, J. H. (1998) Structural Requirements for PAK Activation by Rac GTPases. J Biol Chem. 273, 21512-21518.

  9. Didsbury, J., Weber, R. F., Bokoch, G. M., Evans, T., and Snyderman, R. (1989) Rac, a Novel Ras-Related Family of Proteins that are Botulinum Toxin Substrates. J Biol Chem. 264, 16378-16382.

  10. Tao, W., Filippi, M. D., Bailey, J. R., Atkinson, S. J., Connors, B., Evan, A., and Williams, D. A. (2002) The TRQQKRP Motif Located Near the C-Terminus of Rac2 is Essential for Rac2 Biologic Functions and Intracellular Localization. Blood. 100, 1679-1688.

  11. Zhang, F. L., and Casey, P. J. (1996) Protein Prenylation: Molecular Mechanisms and Functional Consequences. Annu Rev Biochem. 65, 241-269.

  12. Ou, X., Pollock, J., Dinauer, M. C., Gharehbaghi-Schnell, E., and Skalnik, D. G. (1999) Identification and Functional Characterization of the Murine Rac2 Gene Promoter. DNA Cell Biol. 18, 253-263.

  13. Shirsat, N. V., Pignolo, R. J., Kreider, B. L., and Rovera, G. (1990) A Member of the Ras Gene Superfamily is Expressed Specifically in T, B and Myeloid Hemopoietic Cells. Oncogene. 5, 769-772.

  14. Mackay, D. J., and Hall, A. (1998) Rho GTPases. J Biol Chem. 273, 20685-20688.

  15. Jaffe, A. B., and Hall, A. (2005) Rho GTPases: Biochemistry and Biology. Annu Rev Cell Dev Biol. 21, 247-269.

  16. Troeger, A., and Williams, D. A. (2013) Hematopoietic-Specific Rho GTPases Rac2 and RhoH and Human Blood Disorders. Exp Cell Res. 319, 2375-2383.

  17. Bos, J. L., Rehmann, H., and Wittinghofer, A. (2007) GEFs and GAPs: Critical Elements in the Control of Small G Proteins. Cell. 129, 865-877.

  18. Gu, Y., Filippi, M. D., Cancelas, J. A., Siefring, J. E., Williams, E. P., Jasti, A. C., Harris, C. E., Lee, A. W., Prabhakar, R., Atkinson, S. J., Kwiatkowski, D. J., and Williams, D. A. (2003) Hematopoietic Cell Regulation by Rac1 and Rac2 Guanosine Triphosphatases. Science. 302, 445-449.

  19. Kalfa, T. A., Pushkaran, S., Mohandas, N., Hartwig, J. H., Fowler, V. M., Johnson, J. F., Joiner, C. H., Williams, D. A., and Zheng, Y. (2006) Rac GTPases Regulate the Morphology and Deformability of the Erythrocyte Cytoskeleton. Blood. 108, 3637-3645.

  20. Itokowa, T., Zhu, M. L., Troiano, N., Bian, J., Kawano, T., and Insogna, K. (2011) Osteoclasts Lacking Rac2 have Defective Chemotaxis and Resorptive Activity. Calcif Tissue Int. 88, 75-86.

  21. Roberts, A. W., Kim, C., Zhen, L., Lowe, J. B., Kapur, R., Petryniak, B., Spaetti, A., Pollock, J. D., Borneo, J. B., Bradford, G. B., Atkinson, S. J., Dinauer, M. C., and Williams, D. A. (1999) Deficiency of the Hematopoietic Cell-Specific Rho Family GTPase Rac2 is Characterized by Abnormalities in Neutrophil Function and Host Defense. Immunity. 10, 183-196.

  22. Yang, F. C., Kapur, R., King, A. J., Tao, W., Kim, C., Borneo, J., Breese, R., Marshall, M., Dinauer, M. C., and Williams, D. A. (2000) Rac2 Stimulates Akt Activation Affecting BAD/Bcl-XL Expression while Mediating Survival and Actin Function in Primary Mast Cells. Immunity. 12, 557-568.

  23. Yang, F. C., Atkinson, S. J., Gu, Y., Borneo, J. B., Roberts, A. W., Zheng, Y., Pennington, J., and Williams, D. A. (2001) Rac and Cdc42 GTPases Control Hematopoietic Stem Cell Shape, Adhesion, Migration, and Mobilization. Proc Natl Acad Sci U S A. 98, 5614-5618.

  24. Wheeler, A. P., Wells, C. M., Smith, S. D., Vega, F. M., Henderson, R. B., Tybulewicz, V. L., and Ridley, A. J. (2006) Rac1 and Rac2 Regulate Macrophage Morphology but are Not Essential for Migration. J Cell Sci. 119, 2749-2757.

  25. Peng, H. J., Henkels, K. M., Mahankali, M., Marchal, C., Bubulya, P., Dinauer, M. C., and Gomez-Cambronero, J. (2011) The Dual Effect of Rac2 on Phospholipase D2 Regulation that Explains both the Onset and Termination of Chemotaxis. Mol Cell Biol. 31, 2227-2240.

  26. Oude Weernink, P. A., Lopez de Jesus, M., and Schmidt, M. (2007) Phospholipase D Signaling: Orchestration by PIP2 and Small GTPases. Naunyn Schmiedebergs Arch Pharmacol. 374, 399-411.

  27. Abdel-Latif, D., Steward, M., Macdonald, D. L., Francis, G. A., Dinauer, M. C., and Lacy, P. (2004) Rac2 is Critical for Neutrophil Primary Granule Exocytosis. Blood. 104, 832-839.

  28. Lim, M. B., Kuiper, J. W., Katchky, A., Goldberg, H., and Glogauer, M. (2011) Rac2 is Required for the Formation of Neutrophil Extracellular Traps. J Leukoc Biol. 90, 771-776.

  29. Gomez, J. C., Soltys, J., Okano, K., Dinauer, M. C., and Doerschuk, C. M. (2008) The Role of Rac2 in Regulating Neutrophil Production in the Bone Marrow and Circulating Neutrophil Counts. Am J Pathol. 173, 507-517.

  30. Quinn, M. T., Evans, T., Loetterle, L. R., Jesaitis, A. J., and Bokoch, G. M. (1993) Translocation of Rac Correlates with NADPH Oxidase Activation. Evidence for Equimolar Translocation of Oxidase Components. J Biol Chem. 268, 20983-20987.

  31. Heyworth, P. G., Bohl, B. P., Bokoch, G. M., and Curnutte, J. T. (1994) Rac Translocates Independently of the Neutrophil NADPH Oxidase Components p47phox and p67phox. Evidence for its Interaction with Flavocytochrome b558. J Biol Chem. 269, 30749-30752.

  32. Diebold, B. A., and Bokoch, G. M. (2001) Molecular Basis for Rac2 Regulation of Phagocyte NADPH Oxidase. Nat Immunol. 2, 211-215.

  33. Bokoch, G. M. (2005) Regulation of Innate Immunity by Rho GTPases. Trends Cell Biol. 15, 163-171.

  34. Ojha, N., Roy, S., He, G., Biswas, S., Velayutham, M., Khanna, S., Kuppusamy, P., Zweier, J. L., and Sen, C. K. (2008) Assessment of Wound-Site Redox Environment and the Significance of Rac2 in Cutaneous Healing. Free Radic Biol Med. 44, 682-691.

  35. Pradip, D., Peng, X., and Durden, D. L. (2003) Rac2 Specificity in Macrophage Integrin Signaling: Potential Role for Syk Kinase. J Biol Chem. 278, 41661-41669.

  36. Yamauchi, A., Kim, C., Li, S., Marchal, C. C., Towe, J., Atkinson, S. J., and Dinauer, M. C. (2004) Rac2-Deficient Murine Macrophages have Selective Defects in Superoxide Production and Phagocytosis of Opsonized Particles. J Immunol. 173, 5971-5979.

  37. Gu, Y., Byrne, M. C., Paranavitana, N. C., Aronow, B., Siefring, J. E., D'Souza, M., Horton, H. F., Quilliam, L. A., and Williams, D. A. (2002) Rac2, a Hematopoiesis-Specific Rho GTPase, Specifically Regulates Mast Cell Protease Gene Expression in Bone Marrow-Derived Mast Cells. Mol Cell Biol. 22, 7645-7657.

  38. Guo, F., Cancelas, J. A., Hildeman, D., Williams, D. A., and Zheng, Y. (2008) Rac GTPase Isoforms Rac1 and Rac2 Play a Redundant and Crucial Role in T-Cell Development. Blood. 112, 1767-1775.

  39. Arrieumerlou, C., Randriamampita, C., Bismuth, G., and Trautmann, A. (2000) Rac is Involved in Early TCR Signaling. J Immunol. 165, 3182-3189.

  40. Gringhuis, S. I., de Leij, L. F., Coffer, P. J., and Vellenga, E. (1998) Signaling through CD5 Activates a Pathway Involving Phosphatidylinositol 3-Kinase, Vav, and Rac1 in Human Mature T Lymphocytes. Mol Cell Biol. 18, 1725-1735.

  41. Jacinto, E., Werlen, G., and Karin, M. (1998) Cooperation between Syk and Rac1 Leads to Synergistic JNK Activation in T Lymphocytes. Immunity. 8, 31-41.

  42. Brenner, B., Gulbins, E., Busch, G. L., Koppenhoefer, U., Lang, F., and Linderkamp, O. (1997) L-Selectin Regulates Actin Polymerisation Via Activation of the Small G-Protein Rac2. Biochem Biophys Res Commun. 231, 802-807.

  43. Benvenuti, F., Hugues, S., Walmsley, M., Ruf, S., Fetler, L., Popoff, M., Tybulewicz, V. L., and Amigorena, S. (2004) Requirement of Rac1 and Rac2 Expression by Mature Dendritic Cells for T Cell Priming. Science. 305, 1150-1153.

  44. Yu, H., Leitenberg, D., Li, B., and Flavell, R. A. (2001) Deficiency of Small GTPase Rac2 Affects T Cell Activation. J Exp Med. 194, 915-926.

  45. Li, B., Yu, H., Zheng, W., Voll, R., Na, S., Roberts, A. W., Williams, D. A., Davis, R. J., Ghosh, S., and Flavell, R. A. (2000) Role of the Guanosine Triphosphatase Rac2 in T Helper 1 Cell Differentiation. Science. 288, 2219-2222.

  46. Croker, B. A., Handman, E., Hayball, J. D., Baldwin, T. M., Voigt, V., Cluse, L. A., Yang, F. C., Williams, D. A., and Roberts, A. W. (2002) Rac2-Deficient Mice Display Perturbed T-Cell Distribution and Chemotaxis, but Only Minor Abnormalities in T(H)1 Responses. Immunol Cell Biol. 80, 231-240.

  47. Croker, B. A., Tarlinton, D. M., Cluse, L. A., Tuxen, A. J., Light, A., Yang, F. C., Williams, D. A., and Roberts, A. W. (2002) The Rac2 Guanosine Triphosphatase Regulates B Lymphocyte Antigen Receptor Responses and Chemotaxis and is Required for Establishment of B-1a and Marginal Zone B Lymphocytes. J Immunol. 168, 3376-3386.

  48. Walmsley, M. J., Ooi, S. K., Reynolds, L. F., Smith, S. H., Ruf, S., Mathiot, A., Vanes, L., Williams, D. A., Cancro, M. P., and Tybulewicz, V. L. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302, 459-462.

  49. Savina, A., Peres, A., Cebrian, I., Carmo, N., Moita, C., Hacohen, N., Moita, L. F., and Amigorena, S. (2009) The Small GTPase Rac2 Controls Phagosomal Alkalinization and Antigen Crosspresentation Selectively in CD8(+) Dendritic Cells. Immunity. 30, 544-555.

  50. Croke, M., Ross, F. P., Korhonen, M., Williams, D. A., Zou, W., and Teitelbaum, S. L. (2011) Rac Deletion in Osteoclasts Causes Severe Osteopetrosis. J Cell Sci. 124, 3811-3821.

  51. Wang, Y., Lebowitz, D., Sun, C., Thang, H., Grynpas, M. D., and Glogauer, M. (2008) Identifying the Relative Contributions of Rac1 and Rac2 to Osteoclastogenesis. J Bone Miner Res. 23, 260-270.

  52. De, P., Peng, Q., Traktuev, D. O., Li, W., Yoder, M. C., March, K. L., and Durden, D. L. (2009) Expression of RAC2 in Endothelial Cells is Required for the Postnatal Neovascular Response. Exp Cell Res. 315, 248-263.

  53. Williams, D. A., Tao, W., Yang, F., Kim, C., Gu, Y., Mansfield, P., Levine, J. E., Petryniak, B., Derrow, C. W., Harris, C., Jia, B., Zheng, Y., Ambruso, D. R., Lowe, J. B., Atkinson, S. J., Dinauer, M. C., and Boxer, L. (2000) Dominant Negative Mutation of the Hematopoietic-Specific Rho GTPase, Rac2, is Associated with a Human Phagocyte Immunodeficiency. Blood. 96, 1646-1654.

  54. Ambruso, D. R., Knall, C., Abell, A. N., Panepinto, J., Kurkchubasche, A., Thurman, G., Gonzalez-Aller, C., Hiester, A., deBoer, M., Harbeck, R. J., Oyer, R., Johnson, G. L., and Roos, D. (2000) Human Neutrophil Immunodeficiency Syndrome is Associated with an Inhibitory Rac2 Mutation. Proc Natl Acad Sci U S A. 97, 4654-4659.

  55. Gu, Y., Jia, B., Yang, F. C., D'Souza, M., Harris, C. E., Derrow, C. W., Zheng, Y., and Williams, D. A. (2001) Biochemical and Biological Characterization of a Human Rac2 GTPase Mutant Associated with Phagocytic Immunodeficiency. J Biol Chem. 276, 15929-15938.