Phenotypic Mutation 'insouciant'

• Allele: insouciant
• Mutation Type: missense
• Chromosome: 5
• Coordinate: 64,954,583 bp (GRCm38)
• Base Change: A ⇒ G (forward strand)
• Gene: Tlr6
• Gene Name: toll-like receptor 6
• Chromosomal Location: 64,952,031-64,960,097 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011] ; PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Alanine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q9EPW9
• SMART Domains: Protein: ENSMUSP00000062096; Gene: ENSMUSG00000051498; AA Change: V327A

Domain	Start	End	E-Value	Type
LRR_TYP	86	109	7.67e-2	SMART
LRR	131	155	2.76e1	SMART
LRR	461	482	6.23e1	SMART
LRR	483	507	4.57e0	SMART
LRRCT	540	594	4.06e-11	SMART
transmembrane domain	596	618	N/A	INTRINSIC
TIR	652	795	5.37e-37	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
  (Using ENSMUST00000062315)
• SMART Domains: Protein: ENSMUSP00000143865; Gene: ENSMUSG00000051498

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
LRR_TYP	86	109	3.3e-4	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.113)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Embryos, gDNA
• MMRRC Submission: 010474-UCD
• Last Updated: 2018-12-14 11:07 AM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2007-10-16
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Zhengfan Jiang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_011604; MGI: 1341296

Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(1) Chemically induced(4) 

Phenotypic Description

Figure 1. TNF responses of peritoneal macrophages from i nsouciant (int) mice treated with TLR1/2 ligand (A), and TLR 2/6 ligands (B) and (C). Insouciant macrophages show reduced responses to TLR2/6 ligands, but show normal responses to TLR1/2. Macrophages from mice deficient in the TLR adaptor molecules, MyD88 or Mal, are used as controls. Values represent mean ± SEM (n = 6 mice or more). Figure reproduced from reference (1) .

The insouciant phenotype was identified in a G3 screen for mutants with altered response to Toll-like receptor (TLR) ligands (TLR Signaling Screen) (1).  Peritoneal macrophages from insouciant mice fail to produce tumor necrosis factor (TNF)-α in response to peptidoglycan, lipoteichoic acid and MALP-2 (macrophage-activating lipopeptide-2), all lipopeptides that activate the TLR2/6 heterodimer complex . Zymosan is also a TLR2/6 ligand, but it could partially activate insouciant macrophages to produce TNF-α; contamination from TLR2-independent ligands is suspected.  The diacyl lipopeptide Pam₂CSK₄ also elicited a partial response.  In contrast, TNF-α production is normal in response to Pam₃CSK₄ (triacyl lipopeptide), lipopolysaccharide (LPS), ssDNA (CpG-DNA), resiquimod, and dsRNA (poly I:C) (Figure 1 and data not shown).  Phosphorylation of c-JUN N-terminal kinase (JNK), extracellular signal-regulated kinase (ERK) and IκB in response to MALP-2 was greatly reduced in insouciant macrophages.

 

Nature of Mutation

Because the insouciant phenotype is almost identical to that of Tlr6^-/- mice, Tlr6 (Chromosome 5) from insouciant mice was sequenced.  A Tlr6 mutation corresponding to a T to C transition at position 1112 of the Tlr6 transcript, in exon 2 of 2 total exons, was identified.

 

1095 CACGTCAAAAACCAAGTGTTCCTCTTTTCAAAG

322  -H--V--K--N--Q--V--F--L--F--S--K-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of valine to alanine at residue 327 of the TLR6 protein.

Protein Prediction

TLR6 is an 806-amino acid type I transmembrane glycoprotein receptor (2).  TLR6 is most similar to TLR1, sharing 69% overall amino acid identity and 81% similarity (2).  TLR6 and TLR1 each heterodimerize with TLR2 to form receptors for distinct ligand types (diacyl lipopeptides for TLR6, triacyl lipopeptides for TLR1).  Like the other TLRs, the TLR6 cytoplasmic domain (at its C terminus) shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (2), which mediates homo- and heterotypic protein interactions during signal transduction.  TIR domains in TLRs and in IL receptors contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (3).  In addition, TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops (4;5).  The crystal structures of the TLR1 and TLR2 TIR domains revealed that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (5) (see the record for languid).  Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions.  This is true of a proline to histidine mutation in the BB loop of TLR4 (see record for lps3), which abolishes MyD88 binding (6) and LPS-induced signaling in mice (7).

 

Figure 2. Crystal structure of the ligand-bound human TLR1/TLR2 heterodimer. A, Side view of the heterodimer complex. Shown are the extracellular domains of TLR1 (blue) and TLR2 (cyan). β-strands are represented by flat arrows and α-helices by coils. The structure of TLR6 is very similar to TLR1, with important differences (see text). The residues of TLR1/6 that are involved in the dimer interface with TLR2 are shown in yellow. The insouciant mutation is indicated. The ligand-binding site is indicated by a black arrow. Click on the 3D structure to view it rotate. B, A view looking down at the TLR1/2 dimer interface. UCSF Chimera structure is based on PDB 2Z7X, Jin et al, Cell 130, 1071-1082 (2007).

Figure 3. Protein and domain structure of TLR6. A, Schematic representation of TLR6 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the insouciant mutation is highlighted. 3D image was created using UCSF Chimera. B, TLR6 is an 806 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The insouciant mutation (red asterisk) results in a conversion of valine to alanine at residue 327 of the TLR6 protein.This image is interactive. Click on the image to view other mutations found in TLR6 (red). Click on the mutations for more specific information.

The N-terminus of TLR6 contains a signal peptide followed by an extracellular domain containing twenty tandem leucine-rich repeats (LRRs) and a transmembrane domain.  LRR domains, which mediate ligand recognition by TLRs, consist of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) and XØXXØX₄FXXLX (variable in length, sequence and structure), where X is any amino acid and Ø is a hydrophobic amino acid [discussed in (8)].  Crystal structures of TLR1, TLR2 (9) and other LRR-containing proteins revealed that the XLXXLXLXX sequence folds into a β-strand (8).  Each LRR forms a loop such that the juxtaposition of several LRR loops forms a horseshoe structure, with the hydrophobic residues of the LRR consensus sequence pointed inward (8).  The structure of TLR6 was modeled using the structure of TLR1 as a template, and its analysis suggests that unlike TLR1 in the TLR2/1 heterodimer, no lipid-binding pocket exists in TLR6 (9).  In TLR1, this channel accommodates one of the acyl chains of Pam₃CSK₄ (the others bind in a pocket in TLR2) (9).  The presence of phenylalanine in place of Met338 and Leu360 in TLR6 is predicted to block such a lipid channel in TLR6, providing the basis of TLR2/6 specificity for diacylated versus triacylated lipopeptides (9).  Discrimination between diacylated and triacylated lipopeptides has previously been attributed to LRR modules 9-12 of TLR6 and TLR1 (10), in agreement with the crystal structure (9).

 

The insouciant mutation substitutes an alanine for valine at position 327 of TLR6 (Figure 2; PDB ID 2Z7X).  This valine, and the six amino acids surrounding it, are conserved in both human and mouse TLR6 (2).  A stretch of about 50 amino acids including valine 327 forms the TLR1 or TLR6 dimer interface with TLR2.  The structure of the TLR2/1 heterodimer shows that the corresponding valine in TLR1 participates in hydrophobic interactions with TLR2 at the dimer interface, as well as making contacts with the ligand (9).  However, because diacylated TLR2/6 ligands do not bridge these two receptors through precisely the same mechanism as triacylated ligands would for TLR2/1, the authors of the study propose that the structure of the dimer interface of TLR2/6 is likely to differ from that of TLR2/1.  Their model of the TLR6 structure does not predict direct participation of valine 327 in the dimer interface, although the adjacent glutamine is indicated to form either hydrogen or ionic bonds with TLR2 (9).  Because of its position at the center of the dimer interface, although perhaps not in direct contact with TLR2, the valine mutated in insouciant may be hypothesized to disrupt heterodimerization between TLR2 and TLR6 and prevent signaling from this receptor complex.

Expression/Localization

Tlr6 transcript is detected by RT-PCR in mouse thymus, spleen, ovary and lung (2).  No expression is detected in liver, kidney and heart (2).  TLR6 has been demonstrated to localize and function at the cell membrane (11).  However, TLR2, its obligate binding partner, can be recruited to and activated by ligands in macrophage phagosomes, suggesting that TLR6 may also be found in phagosomes (12).

Background

Figure 4. Overview of Toll-like receptor (TLR) signaling pathways. Shown are the signaling events downstream of TLR activation that ultimately lead to the induction of thousands of genes including TNF and type I IFN, which are critical in activating innate and adaptive immune responses. TLR1,2,4,5 and 6 are located at the cell surface, while TLR3,7, and 9 are localized in the endosome. Once TLR complexes recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions.

In the MyD88-dependent pathway utilized by all TLRs except TLR3, MyD88 (lime green) recruits IRAK kinases through their death domains (DD). TRAF6 and IRF5 are also recruited to this complex. Phosphorylation of IRAK1 by IRAK4 allows dissociation of IRAK1 and TRAF6. K63 ubiquitination (small light blue circles) of TRAF6 recruits TAK1 and the TAK1 binding proteins, TAB1 and TAB2. Activation of TAK1 leads to activation of MAP kinase cascades and the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, p105, and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles), releasing NF-κB into the nucleus and permitting TPL2 to become activated, respectively. Activation of the p38, JNK and ERK1/2 kinases leads to the activation of both CREB and AP1, which in turn induce many target genes. In pDCs, activation of TLR7 and 9 in endosomes recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7. IRAK-1 and IKKα phosphorylate and activate IRF7, leading to transcription of interferon-inducible genes and production of large amounts of type I IFN.
 
In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM (bright yellow) recruits polyubiquitinated RIP1, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKe; RIP1 is not required for TICAM-dependent activation of IRF3.

Note that TLR4 signals through the MyD88-dependent pathway from the cell membrane and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway. When bound to vesicular stomatitis virus glycoprotein G (VSV-G) (far left), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM. Upon viral stimulation, TLR2 may also be internalized into endosomes to activate both IRF3 and IRF7 by an unknown mechanism. LTA = lipoteichoic acid; LP2 = lipopeptide 2. PAM3CSK4 is a triacyl lipopeptide. Phosphorylation events are represented by small yellow circles labeled with a “P”. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Figure 5. Toll-like receptor 6 (TLR6) signaling pathways. TLR6 associates with TLR2 and membrane proteins CD14 and CD36 to initiate a MyD88-dependent response that produces proinflammatory cytokines. Upon viral stimulation, TLR6 may associate with TLR2 in endosomes to activate both IRF3 and IRF7 by an unknown mechanism.

TLRs are transmembrane receptors that sense molecules of microbial origin and trigger host cell responses.  There are 12 TLRs in mice, and 10 in humans; each receptor recognizes one or more distinct microbial ligands.  Together with TLR1 or TLR6, TLR2 recognizes a wider range of ligands than other TLRs, including lipopeptides, lipoteichoic acids (LTA), lipoarabinomannan and zymosan (13).  Studies of TLR-deficient mice revealed that TLR1 specifies recognition of triacyl lipopeptides (14), while TLR6 predominantly recognizes diacyl lipopeptides (15).  However, some diacyl lipopeptides, such as Pam₂CSK₄, are recognized by TLR6-deficient cells (in a TLR2-dependent manner), suggesting that a TLR2 homodimer or a new heterodimer may recognize some lipopeptide species, and/or that other characteristics than the absence of a long chain amide-bound fatty acid can specify TLR2/6 ligands (16;17).  Evidence suggests that the amino acid sequence of the lipopeptide also contributes to its recognition by TLR2/6 or TLR2/1 (16-18).

 

Upon ligand binding, the activated TLR2 heterodimer transduces the signal through the adapter proteins MyD88 and TIRAP (TIR-domain-containing adaptor protein), which recruit and activate several IRAKs (IL-1-receptor-associated kinases) and TRAF6 (tumor necrosis factor receptor-associated factor 6) [reviewed in (13;19)] (Figure 3).  Their functions lead to the activation of the IKK (IκB kinase) complex, which phosphorylates IκB, leading to the liberation of NF-κB for translocation to the nucleus and transcriptional activation. MAP kinase may also be activated through TRAF6; it controls AP-1 regulated gene expression.  Transcriptional activation of cytokines, including TNF and IL-6, results in the initiation of a local inflammatory response.

 

Study of the Cd36^obl/obl (oblivious) mouse mutant demonstrated that the Cd36 receptor is required for TLR2/6-dependent detection of certain lipopeptides (20).  Oblivious macrophages exhibit reduced TNF-α production in response to the diacyl lipopeptides MALP-2 and LTA (both TLR2/6 ligands), but normal TNF-α production stimulated by peptidoglycan, zymosan and Pam₃CSK₄ (20).  Cd36^obl/obl mice, like TLR2-deficient mice, are also highly susceptible to infection by Staphylococcus aureus (20;21).  Cd36 has been implicated in phagocytosis of Staphylococcus aureus and LTA, and the subsequent activation of TLR2/6 (22).  Thus, while the nature of their interaction is unknown, Cd36 is a co-receptor for TLR2/6 heterodimer recognition of certain diacyl lipopeptide ligands.

Putative Mechanism

As described above (Protein Prediction), the insouciant mutation is predicted to disrupt the dimerization interface between TLR6 and TLR2, preventing signaling stimulated by diacyl lipopeptides but leaving intact triacyl lipopeptide signaling mediated by TLR2/1.  The mutation replaces a conserved valine at the core of the dimerization interface (9).

Primers

Primers cannot be located by automatic search.

Genotyping

Insouciant genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Ins(F): 5’-CTTCAGATTCCCAATACCACCGTTCTC -3’

Ins(R): 5’-GCATCTTGATGTTCATCTCAGCAAACAC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:20

4) 68°C             1:00

5) repeat steps (2-4) 35X

6) 68°C             5:00

7) 4°C              ∞

 

Primers for sequencing

Ins_seq(F): 5’- CCAATACCACCGTTCTCCATTTG -3’

Ins_seq(R): 5’- ATGTTCATCTCAGCAAACACCGAG -3’>

 

The following sequence of 436 nucleotides (from Genbank genomic region NC_000071 for linear genomic DNA sequence of Tlr6) is amplified:

 

5076                                       cttca gattcccaat accaccgttc

5101 tccatttggt ctttcatcca aatagcttgt tctctgttca agtgaacatg tctgtaaacg

5161 ctttaggaca tttacaactg agtaatatta aattgaatga tgaaaactgt caaaggttaa

5221 tgacattttt atcagaactc accagaggtc caaccttatt gaatgtgacc ctccagcaca

5281 tagaaacaac ctggaagtgc tcggttaaac ttttccaatt cttttggccc cgaccggtgg

5341 agtacctcaa tatttacaac ttaacgataa ctgagagaat cgacagggaa gaatttactt

5401 actcggagac agcactgaag tcactgatga tagagcacgt caaaaaccaa gtgttcctct

5461 tttcaaagga ggcgctatac tcggtgtttg ctgagatgaa catcaagatg c

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1.  Jiang, Z., Georgel, P., Li, C., Choe, J., Crozat, K., Rutschmann, S., Du, X., Bigby, T., Mudd, S., Sovath, S., Wilson, I. A., Olson, A., and Beutler, B. (2006) Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis, Proc Natl Acad Sci U S A 103, 10961-10966.

   2.  Takeuchi, O., Kawai, T., Sanjo, H., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Takeda, K., Akira, S., Jnk, Nf, k., and Toll-like, r. f. (1999) TLR6: A novel member of an expanding Toll-like receptor family, Gene 231, 59-65.

   3.  Slack, J. L., Schooley, K., Bonnert, T. P., Mitcham, J. L., Qwarnstrom, E. E., Sims, J. E., and Dower, S. K. (2000) Identification of two major sites in the type I interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways, J. Biol. Chem. 275, 4670-4678.

   4.  Rock, F. L., Hardiman, G., Timans, J. C., Kastelein, R. A., and Bazan, J. F. (1998) A family of human receptors structurally related to Drosophila Toll., Proc. Natl. Acad. Sci. U. S. A. 95, 588-593.

   5.  Xu, Y., Tao, X., Shen, B., Horng, T., Medzhitov, R., Manley, J. L., and Tong, L. (2000) Structural basis for signal transduction by the Toll/interleukin-1 receptor domains, Nature 408, 111-115.

   6.  Rhee, S. H. and Hwang, D. (2000) Murine TOLL-like Receptor 4 Confers Lipopolysaccharide Responsiveness as Determined by Activation of NFkappa B and Expression of the Inducible Cyclooxygenase, J. Biol. Chem. 275, 34035-34040.

   7.  Poltorak, A., He, X., Smirnova, I., Liu, M.-Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene, Science 282, 2085-2088.

   8.  Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-rich repeats and pathogen recognition in Toll-like receptors, Trends Immunol. 24, 528-533.

   9.  Jin, M. S., Kim, S. E., Heo, J. Y., Lee, M. E., Kim, H. M., Paik, S. G., Lee, H., and Lee, J. O. (2007) Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide, Cell 130, 1071-1082.

 10.  Omueti, K. O., Beyer, J. M., Johnson, C. M., Lyle, E. A., and Tapping, R. I. (2005) Domain exchange between human toll-like receptors 1 and 6 reveals a region required for lipopeptide discrimination, J Biol. Chem. 280, 36616-36625.

 11.  Nakao, Y., Funami, K., Kikkawa, S., Taniguchi, M., Nishiguchi, M., Fukumori, Y., Seya, T., and Matsumoto, M. (2005) Surface-expressed TLR6 participates in the recognition of diacylated lipopeptide and peptidoglycan in human cells, J Immunol. 174, 1566-1573.

 12.  Underhill, D. M., Ozinsky, A., Hajjar, A. M., Stevens, A., Wilson, C. B., Bassetti, M., and Aderem, A. (1999) The Toll-like receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens [see comments], Nature 401, 811-815.

 13.  Akira, S. and Takeda, K. (2004) Toll-like receptor signalling, Nat. Rev. Immunol. 4, 499-511.

 14.  Takeuchi, O., Sato, S., Horiuchi, T., Hoshino, K., Takeda, K., Dong, Z., Modlin, R. L., and Akira, S. (2002) Cutting edge: role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins, J. Immunol. 169, 10-14.

 15.  Takeuchi, O., Kawai, T., Muhlradt, P. F., Morr, M., Radolf, J. D., Zychlinsky, A., Takeda, K., and Akira, S. (2001) Discrimination of bacterial lipoproteins by Toll-like receptor 6, Int. Immunol. 13, 933-940.

 16.  Buwitt-Beckmann, U., Heine, H., Wiesmuller, K. H., Jung, G., Brock, R., Akira, S., and Ulmer, A. J. (2005) Toll-like receptor 6-independent signaling by diacylated lipopeptides, Eur. J. Immunol. 35, 282-289.

 17.  Buwitt-Beckmann, U., Heine, H., Wiesmuller, K. H., Jung, G., Brock, R., Akira, S., and Ulmer, A. J. (2006) TLR1- and TLR6-independent Recognition of Bacterial Lipopeptides, J Biol. Chem. 281, 9049-9057.

 18.  Okusawa, T., Fujita, M., Nakamura, J., Into, T., Yasuda, M., Yoshimura, A., Hara, Y., Hasebe, A., Golenbock, D. T., Morita, M., Kuroki, Y., Ogawa, T., and Shibata, K. (2004) Relationship between structures and biological activities of mycoplasmal diacylated lipopeptides and their recognition by toll-like receptors 2 and 6, Infect. Immun. 72, 1657-1665.

 19.  Hoebe, K., Jiang, Z., Tabeta, K., Du, X., Georgel, P., Crozat, K., and Beutler, B. (2006) Genetic analysis of innate immunity, Adv. Immunol 91, 175-226.

 20.  Hoebe, K., Georgel, P., Rutschmann, S., Du, X., Mudd, S., Crozat, K., Sovath, S., Shamel, L., Hartung, T., Zahringer, U., and Beutler, B. (2005) CD36 is a sensor of diacylglycerides, Nature 433, 523-527.

 21.  Takeuchi, O., Hoshino, K., and Akira, S. (2000) Cutting Edge: TLR2-Deficient and MyD88-Deficient Mice Are Highly Susceptible to Staphylococcus aureus Infection, J. Immunol. 165, 5392-5396.

 22.  Stuart, L. M., Deng, J., Silver, J. M., Takahashi, K., Tseng, A. A., Hennessy, E. J., Ezekowitz, R. A., and Moore, K. J. (2005) Response to Staphylococcus aureus requires CD36-mediated phagocytosis triggered by the COOH-terminal cytoplasmic domain, J Cell Biol. 170, 477-485.