Phenotypic Mutation 'Dome' (pdf version)
List |< first << previous [record 7 of 18] next >> last >|
AlleleDome
Mutation Type missense
Chromosome17
Coordinate35,201,674 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Tnf
Gene Name tumor necrosis factor
Synonym(s) tumor necrosis factor-alpha, Tnfa, TNF-alpha, TNFalpha, Tnfsf1a, TNF alpha, DIF
Chromosomal Location 35,199,381-35,202,007 bp (-)
MGI Phenotype FUNCTION: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. Members of this family are classified based on primary sequence, function, and structure. This protein is synthesized as a type-II transmembrane protein and is reported to be cleaved into products that exert distinct biological functions. It plays an important role in the innate immune response as well as regulating homeostasis but is also implicated in diseases of chronic inflammation. In mouse deficiency of this gene is associated with defects in response to bacterial infection, with defects in forming organized follicular dendritic cell networks and germinal centers, and with a lack of primary B cell follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mutations at this locus primarily affect the immune system, causing increased susceptibility to infection, failure to form splenic B-cell follicles, increased inflammation and impaired contact hypersensitivity. Homozygotes also may show metabolic defects. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013693, NM_001278601; MGI:104798

Mapped Yes 
Amino Acid Change Isoleucine changed to Threonine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025263] [ENSMUSP00000126122]
PDB Structure
1.4 A RESOLUTION STRUCTURE OF MOUSE TUMOR NECROSIS FACTOR, TOWARDS MODULATION OF ITS SELCTIVITY AND TRIMERISATION [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000025263
Gene: ENSMUSG00000024401
AA Change: I56T

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 91 235 1.59e-53 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
(Using ENSMUST00000025263)
SMART Domains Protein: ENSMUSP00000126122
Gene: ENSMUSG00000024401
AA Change: I56T

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 74 219 2.8e-49 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
(Using ENSMUST00000167924)
Meta Mutation Damage Score 0.8966 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category Autosomal Dominant
Candidate Explorer Status CE: failed initial filter
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(23) : Chemically induced (ENU)(1) Spontaneous(2) Targeted(20)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
Panr1 UTSW 17 35200204 missense probably damaging 1.00
R0783:Tnf UTSW 17 35201674 missense probably damaging 0.99
R0815:Tnf UTSW 17 35201144 unclassified probably benign
R0863:Tnf UTSW 17 35201144 unclassified probably benign
R2195:Tnf UTSW 17 35201113 unclassified probably null
R2570:Tnf UTSW 17 35200500 missense probably damaging 0.99
R4660:Tnf UTSW 17 35200180 missense probably benign 0.00
R6670:Tnf UTSW 17 35201824 missense possibly damaging 0.73
R7319:Tnf UTSW 17 35200371 missense possibly damaging 0.58
R7708:Tnf UTSW 17 35200158 missense possibly damaging 0.63
Mode of Inheritance Autosomal Dominant
Local Stock
MMRRC Submission 037529-MU
Last Updated 2017-03-28 3:22 PM by Katherine Timer
Record Created 2014-08-03 12:17 PM by Zhao Zhang
Record Posted 2014-09-15
Phenotypic Description

Figure 1. Dome mice exhibited decreased TNFα secretion in response to TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Dome mice exhibited decreased TNFα secretion in response to TLR 7/8 agonist, R848. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Dome phenotype was identified among ENU-mutagenized G3 mice of the pedigree R0783, some of which exhibited decreased TNFα secretion in response to Toll-like receptor (TLR) ligands, LPS (TLR4; Figure 1) and R848 (TLR7/8; Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of reduced decreased TNFα secretion in response to LPS using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R0783.  Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations.  Both of the above anomalies were linked by continuous variable mapping to a mutation in Tnf:  a T to C transition at base pair 35,201,674 (v38) on chromosome 17, or base pair 334 in the GenBank genomic region NC_000083. The strongest association was found with a dominant model of linkage to the LPS signaling response, wherein 15 heterozygotes departed phenotypically from 12 homozygous reference mice with a P value of 3.237 x 10-7 (Figure 3).  The mutation corresponds to residue 334 in the mRNA sequence NM_013693 within exon 4 of 6 total exons.

 

318 CTGAACTTCGGGGTGATCGGTCCCCAAAGGGAT

51  -L--N--F--G--V--I--G--P--Q--R--D-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to threonine (T) substitution at position 56 (I56T) in the TNF protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.986).

Protein Prediction

Figure 4. Domain structure of TNF. The Dome mutation (I56T) is shown. Abbreviations: ICD, intracellular domain; TM, transmembrane domain; ECD, extracellular domain; TNF, TNF family domain. TNF is cleaved by ADAM17 to produce soluble TNF. See text for more details. Image is interactive; click to see other Tnf mutations.

TNF (also called TNF-α) is a protein ligand for TNF receptor (TNFR)1 and TNFR2. TNF has a 34 intracellular domain (amino acids 1-34), a transmembrane domain (amino acids 35-57), and an extracellular domain (amino acids 58-235). TNF exists as both membrane-bound (mTNF) and soluble (sTNF) forms; both are biologically active and have distinct physiological roles (1). The 79-amino acid leader sequence of TNF is cleaved by a metalloprotease of the ADAM (a disintegrin and metalloprotease domain family [see the record for wavedX; (2;3)] to produce the soluble, mature active form of TNF. The Dome mutation (I56T) is within the transmembrane domain of TNF (Figure 4).

 

Please see the Panr1 entry for more information on TNF.

Putative Mechanism
Figure 5. TNF signaling. See text for more details. Briefly, within the endoplasmic reticulum (ER), the rhomboid protein, RHBDF2, associates with ADAM17 to facilitate the folding and/or trafficking of ADAM17 to the Golgi. Within the Golgi, ADAM17 is further processed by furin to its mature form. At the plasma membrane, ADAM17 cleaves the membrane-bound form of TNF to generate soluble TNF that will subsequently bind the TNFR. This image is interactive, click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

TNF-α is a proinflammatory cytokine that is necessary for the development of secondary lymphoid organs (SLOs), plays a critical role in the innate response to many infections, and is implicated in the development of autoimmune diseases (4-7). Membrane-bound TNF is a strong activator of juxtacrine intercellular signaling during cytotoxicity (8) and B cell activation (9). TNFR1 and TNFR2 are expressed in a wide variety of cell types, and they signal through adapter proteins to activate MAPK, JNK, NF-κB and AP-1 [reviewed in (7;10); (Figure 5)]. TNF signaling also activates caspases, leading to apoptosis. Upon ligand binding, TNFR1 binds to TNFR-associated death domain (TRADD), which recruits TNF receptor-associated factor 2 (TRAF2) and/or TRAF5, and the Ser/Thr kinase receptor-interacting protein (RIP). These interactions may occur in the context of lipid rafts, after which TNFR1 and RIP are ubiquitinated, resulting in their degradation by the proteasome pathway (11). Subsequently, activation of the TAB2/TAK1 complex activates the IKK complex to phosphorylate IκB, resulting in release of NF-κB for translocation to the nucleus and activation of gene expression. TNFR1 activates JNK through sequential recruitment of TRAF2, MEKK1 and MKK7. MAPK activation involves signaling through TRADD, RIP and MKK3. TRADD recruitment to TNFR1 also leads to the induction of apoptosis through FAS-associated death domain (FADD) protein, caspase-8 and caspase-3. TNRF2 signals through the same pathways as TNFR1, but does not signal through FADD and caspases to mediate apoptosis. TNFR2 signals through intracellular adaptors called TNFR-associated factors (TRAFs; see the record for hulk). During cell survival, MAP3K family members associate with TRAF2, which activates JNK (Jun N-terminal kinases). NIK (NF-κB-inducing kinase; see the record for lucky) is also downstream of TRAF2 and mediates TNF-induced NF-κB activation (see the records for finlay and xander). Similar to PanR1 mice, Dome mice exhibit reduced TNF-α secretion in response to TLR agonists indicating that the Dome mutation results in a loss of TNF function.

Primers PCR Primer
Dome_pcr_F: CATCTCTCTGTGCATCCGACGAAG
Dome_pcr_R: AACCAGGCAGGTTCTGTCCCTTTC

Sequencing Primer
Dome_seq_F: CATCCGACGAAGGATGTTTAGTC
Dome_seq_R: TTCACTCACTGGCCCAAGG
Genotyping

Dome genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Dome(F): 5’- CATCTCTCTGTGCATCCGACGAAG-3’

Dome(R): 5’- AACCAGGCAGGTTCTGTCCCTTTC-3’

 

Sequencing Primer

Dome_seq(F): 5’- CATCCGACGAAGGATGTTTAGTC-3’
 

Dome_seq(R): 5’- TTCACTCACTGGCCCAAGG -3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 446 nucleotides is amplified (Chr.17: 35201463-35201908, GRCm38; NC_000083):

 

    1 catctctctg tgcatccgac gaaggatgtt tagtcagctg gacgcatggg tccgaggtcc       

 61 tgactctgtc ccctccacac tctcctccac cttgccctgc ccattagccc acttctttcc      

121 ctcacactgt ccttcttgcc ctcctaaccc gttttgcttg tgagcgagaa taagggttgc      

181 ccagacactc acctcatccc tttggggacc gatcaccccg aagttcagta gacagaagag      

241 cgtggtggcc cctgccacaa gcaggaatga gaagaggctg agacataggc accgcctgga      

301 gttctggaag ccccccatct tttgggggag tgcctcttct gccagttcca cgtcgcggat      

361 catgctttct gtgctcatgg tgtcttttct ggagggagat gtggcgcctt gggccagtga      

421 gtgaaaggga cagaacctgc ctggtt

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. + strand, A > G; sense strand, T > C).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsZhao Zhang, Ying Wang, Hexin Shi and Bruce Beutler
List |< first << previous [record 7 of 18] next >> last >|