Allele | Dome | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 17 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 35,420,650 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ G (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Tnf | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | tumor necrosis factor | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | DIF, TNF alpha, TNFalpha, Tnfsf1a, Tnfa, tumor necrosis factor-alpha, TNF-alpha | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 35,418,357-35,420,983 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. Members of this family are classified based on primary sequence, function, and structure. This protein is synthesized as a type-II transmembrane protein and is reported to be cleaved into products that exert distinct biological functions. It plays an important role in the innate immune response as well as regulating homeostasis but is also implicated in diseases of chronic inflammation. In mouse deficiency of this gene is associated with defects in response to bacterial infection, with defects in forming organized follicular dendritic cell networks and germinal centers, and with a lack of primary B cell follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013] PHENOTYPE: Mutations at this locus primarily affect the immune system, causing increased susceptibility to infection, failure to form splenic B-cell follicles, increased inflammation and impaired contact hypersensitivity. Homozygotes also may show metabolic defects. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Isoleucine changed to Threonine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000025263] [ENSMUSP00000126122] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P06804 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PDB Structure | 1.4 A RESOLUTION STRUCTURE OF MOUSE TUMOR NECROSIS FACTOR, TOWARDS MODULATION OF ITS SELCTIVITY AND TRIMERISATION [X-RAY DIFFRACTION] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000025263 Gene: ENSMUSG00000024401 AA Change: I56T
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000126122 Gene: ENSMUSG00000024401 AA Change: I56T
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.8966 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Dominant | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All mutations/alleles(23) : Chemically induced (ENU)(1) Spontaneous(2) Targeted(20) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Dominant | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 037529-MU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2017-03-28 3:22 PM by Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2014-08-03 12:17 PM by Zhao Zhang | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2014-09-15 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The Dome phenotype was identified among ENU-mutagenized G3 mice of the pedigree R0783, some of which exhibited decreased TNFα secretion in response to Toll-like receptor (TLR) ligands, LPS (TLR4; Figure 1) and R848 (TLR7/8; Figure 2). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Tnf: a T to C transition at base pair 35,201,674 (v38) on chromosome 17, or base pair 334 in the GenBank genomic region NC_000083. The strongest association was found with a dominant model of linkage to the LPS signaling response, wherein 15 heterozygotes departed phenotypically from 12 homozygous reference mice with a P value of 3.237 x 10-7 (Figure 3). The mutation corresponds to residue 334 in the mRNA sequence NM_013693 within exon 4 of 6 total exons. 318 CTGAACTTCGGGGTGATCGGTCCCCAAAGGGAT 51 -L--N--F--G--V--I--G--P--Q--R--D- The mutated nucleotide is indicated in red. The mutation results in an isoleucine (I) to threonine (T) substitution at position 56 (I56T) in the TNF protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.986). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
TNF (also called TNF-α) is a protein ligand for TNF receptor (TNFR)1 and TNFR2. TNF has a 34 intracellular domain (amino acids 1-34), a transmembrane domain (amino acids 35-57), and an extracellular domain (amino acids 58-235). TNF exists as both membrane-bound (mTNF) and soluble (sTNF) forms; both are biologically active and have distinct physiological roles (1). The 79-amino acid leader sequence of TNF is cleaved by a metalloprotease of the ADAM (a disintegrin and metalloprotease domain family [see the record for wavedX; (2;3)] to produce the soluble, mature active form of TNF. The Dome mutation (I56T) is within the transmembrane domain of TNF (Figure 4). Please see the Panr1 entry for more information on TNF. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism |
TNF-α is a proinflammatory cytokine that is necessary for the development of secondary lymphoid organs (SLOs), plays a critical role in the innate response to many infections, and is implicated in the development of autoimmune diseases (4-7). Membrane-bound TNF is a strong activator of juxtacrine intercellular signaling during cytotoxicity (8) and B cell activation (9). TNFR1 and TNFR2 are expressed in a wide variety of cell types, and they signal through adapter proteins to activate MAPK, JNK, NF-κB and AP-1 [reviewed in (7;10); (Figure 5)]. TNF signaling also activates caspases, leading to apoptosis. Upon ligand binding, TNFR1 binds to TNFR-associated death domain (TRADD), which recruits TNF receptor-associated factor 2 (TRAF2) and/or TRAF5, and the Ser/Thr kinase receptor-interacting protein (RIP). These interactions may occur in the context of lipid rafts, after which TNFR1 and RIP are ubiquitinated, resulting in their degradation by the proteasome pathway (11). Subsequently, activation of the TAB2/TAK1 complex activates the IKK complex to phosphorylate IκB, resulting in release of NF-κB for translocation to the nucleus and activation of gene expression. TNFR1 activates JNK through sequential recruitment of TRAF2, MEKK1 and MKK7. MAPK activation involves signaling through TRADD, RIP and MKK3. TRADD recruitment to TNFR1 also leads to the induction of apoptosis through FAS-associated death domain (FADD) protein, caspase-8 and caspase-3. TNRF2 signals through the same pathways as TNFR1, but does not signal through FADD and caspases to mediate apoptosis. TNFR2 signals through intracellular adaptors called TNFR-associated factors (TRAFs; see the record for hulk). During cell survival, MAP3K family members associate with TRAF2, which activates JNK (Jun N-terminal kinases). NIK (NF-κB-inducing kinase; see the record for lucky) is also downstream of TRAF2 and mediates TNF-induced NF-κB activation (see the records for finlay and xander). Similar to PanR1 mice, Dome mice exhibit reduced TNF-α secretion in response to TLR agonists indicating that the Dome mutation results in a loss of TNF function. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer Dome_pcr_F: CATCTCTCTGTGCATCCGACGAAG Dome_pcr_R: AACCAGGCAGGTTCTGTCCCTTTC Sequencing Primer Dome_seq_F: CATCCGACGAAGGATGTTTAGTC Dome_seq_R: TTCACTCACTGGCCCAAGG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Dome genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. PCR Primers Dome(F): 5’- CATCTCTCTGTGCATCCGACGAAG-3’ Dome(R): 5’- AACCAGGCAGGTTCTGTCCCTTTC-3’ Sequencing Primer Dome_seq(F): 5’- CATCCGACGAAGGATGTTTAGTC-3’ Dome_seq(R): 5’- TTCACTCACTGGCCCAAGG -3’ PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40X 6) 72°C 10:00 7) 4°C ∞ The following sequence of 446 nucleotides is amplified (Chr.17: 35201463-35201908, GRCm38; NC_000083): 1 catctctctg tgcatccgac gaaggatgtt tagtcagctg gacgcatggg tccgaggtcc 61 tgactctgtc ccctccacac tctcctccac cttgccctgc ccattagccc acttctttcc 121 ctcacactgt ccttcttgcc ctcctaaccc gttttgcttg tgagcgagaa taagggttgc 181 ccagacactc acctcatccc tttggggacc gatcaccccg aagttcagta gacagaagag 241 cgtggtggcc cctgccacaa gcaggaatga gaagaggctg agacataggc accgcctgga 301 gttctggaag ccccccatct tttgggggag tgcctcttct gccagttcca cgtcgcggat 361 catgctttct gtgctcatgg tgtcttttct ggagggagat gtggcgcctt gggccagtga 421 gtgaaaggga cagaacctgc ctggtt FASTA sequence Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. + strand, A > G; sense strand, T > C). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Zhao Zhang, Ying Wang, Hexin Shi and Bruce Beutler |