Phenotypic Mutation 'Arnold2' (pdf version)
AlleleArnold2
Mutation Type missense
Chromosome7
Coordinate84,347,530 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Arnt2
Gene Name aryl hydrocarbon receptor nuclear translocator 2
Synonym(s) bHLHe1
Chromosomal Location 84,246,278-84,410,176 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007488; MGI:107188

Mapped Yes 
Amino Acid Change Arginine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000082154] [ENSMUSP00000146414] [ENSMUSP00000146781] [ENSMUSP00000146413] [ENSMUSP00000146776] [ENSMUSP00000146868] [ENSMUSP00000146599] [ENSMUSP00000147129]
SMART Domains Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: R74C

DomainStartEndE-ValueType
HLH 69 122 1.42e-14 SMART
PAS 137 204 1.28e-8 SMART
low complexity region 225 236 N/A INTRINSIC
PAS 325 391 4.15e-8 SMART
PAC 398 441 7.93e-5 SMART
low complexity region 502 526 N/A INTRINSIC
low complexity region 597 626 N/A INTRINSIC
low complexity region 653 675 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
(Using ENSMUST00000085077)
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000207769)
Predicted Effect probably benign
Predicted Effect probably damaging

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
(Using ENSMUST00000208232)
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000208392)
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000208863)
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000208995)
Predicted Effect probably damaging

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
(Using ENSMUST00000209133)
Meta Mutation Damage Score 0.9209 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - increased
Body Weight (Female) - increased
Body Weight (Male) - increased
Body Weight (Z-score) - increased
DSS: sensitive day 10
FACS NK T cells - decreased
growth/size
NK cell response - decreased
NK killing - decreased
Candidate Explorer Status CE: excellent candidate; human score: 2; ML prob: 0.9048
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(7) : Chemically induced (other)(1) Gene trapped(1) Radiation induced(2) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Arnt2 APN 7 84285829 missense probably benign 0.01
IGL01525:Arnt2 APN 7 84275408 missense possibly damaging 0.70
IGL02331:Arnt2 APN 7 84265624 missense probably damaging 1.00
IGL02483:Arnt2 APN 7 84251397 missense probably damaging 1.00
IGL02863:Arnt2 APN 7 84267937 missense probably damaging 1.00
IGL03207:Arnt2 APN 7 84343834 missense possibly damaging 0.93
porker UTSW 7 84343942 missense probably damaging 1.00
R0024:Arnt2 UTSW 7 84284126 missense probably benign 0.03
R0058:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0058:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0060:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0113:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0114:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0201:Arnt2 UTSW 7 84361659 nonsense probably null
R0514:Arnt2 UTSW 7 84304859 missense probably benign 0.00
R0863:Arnt2 UTSW 7 84265584 missense probably damaging 1.00
R1800:Arnt2 UTSW 7 84275375 missense probably damaging 1.00
R1944:Arnt2 UTSW 7 84343751 missense probably benign 0.01
R1964:Arnt2 UTSW 7 84343789 missense possibly damaging 0.55
R2061:Arnt2 UTSW 7 84343870 missense probably damaging 1.00
R2216:Arnt2 UTSW 7 84275351 missense probably damaging 0.99
R3107:Arnt2 UTSW 7 84262444 missense possibly damaging 0.95
R3410:Arnt2 UTSW 7 84275447 missense probably damaging 1.00
R3739:Arnt2 UTSW 7 84343801 missense probably null 1.00
R4258:Arnt2 UTSW 7 84310955 missense probably damaging 0.98
R4486:Arnt2 UTSW 7 84275345 missense probably benign 0.03
R4489:Arnt2 UTSW 7 84275345 missense probably benign 0.03
R4668:Arnt2 UTSW 7 84275386 missense probably damaging 1.00
R5685:Arnt2 UTSW 7 84263265 missense probably benign 0.00
R5876:Arnt2 UTSW 7 84347512 missense probably damaging 1.00
R5923:Arnt2 UTSW 7 84262533 missense probably benign 0.32
R5926:Arnt2 UTSW 7 84343946 missense probably damaging 0.99
R6122:Arnt2 UTSW 7 84361565 missense probably damaging 1.00
R7021:Arnt2 UTSW 7 84343942 missense probably damaging 1.00
R7895:Arnt2 UTSW 7 84305198 missense probably benign
R7978:Arnt2 UTSW 7 84305198 missense probably benign
R7981:Arnt2 UTSW 7 84268947 intron probably null
X0066:Arnt2 UTSW 7 84285784 missense possibly damaging 0.93
Z1176:Arnt2 UTSW 7 84263196 missense probably benign 0.41
Z1177:Arnt2 UTSW 7 84263207 missense possibly damaging 0.81
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2019-09-04 9:48 PM by External Program
Record Created 2014-08-21 5:59 PM by Zhe Chen
Record Posted 2019-02-27
Phenotypic Description

Figure 1. Arnold2 mice exhibited increased body weights. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Arnold2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0113, some of which showed increased body weights (Figure 1) (1).

Nature of Mutation
Figure 2. Linkage mapping of increased body weights using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 61 mutations (X-axis) identified in the G1 male of pedigree R0113.  WGT data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.
Figure 3. The causative mutation in Arnold2 was confirmed by CRISPR-mediated replacement of the Arnold2Arnt2 allele. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. The body weight phenotype was linked to a mutation in Arnt2: a C to T transition at base pair 84,347,530 (v38) on chromosome 7, or base pair 62,656 in the GenBank genomic region NC_000073 encoding Arnt2. Linkage was found with an additive model of inheritance (P = 2.822 x 10-6), wherein 2 variant homozygotes departed phenotypically from 8 homozygous reference mice and 7 heterozygous mice (Figure 2).

 

The mutation corresponds to residue 370 in the mRNA sequence NM_007488 within exon 4 of 19 total exons.

 

355 CACAGTGAGATTGAGCGGCGCAGGCGGAACAAG

68  -H--S--E--I--E--R--R--R--R--N--K-

 

The mutated nucleotide is indicated in red.  The mutation results in an arginine (R) to cysteine (C) substitution at position 74 (R74C) in the Arnt2 protein, and is strongly predicted by Polyphen-2 to be possibly damaging (score = 0.957).

 

The mutation in Arnt2 was confirmed by CRISPR-mediated replacement of the Arnold2Arnt2 allele (Figure 3; P = 3.007 x 10-10).

Protein Prediction
Figure 4. Domain organization of ARNT2. The location of the Arnold2 mutation is indicated. Domain information is from SMART and UniProt.

Arnt2 encodes aryl-hydrocarbon receptor nuclear translocator 2 (ARNT2), a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. ARNT2 is within the Arnt subfamily of the bHLH-PAS transcription factors, which also includes ARNT and BMAL1 (alternatively, ARNT3; see the record for diet) (2).

 

ARNT2 has bHLH and PAS motifs at its N-terminus (Figure 4(2). The PAS region contains two 50-amino acid degenerate repeat segments: PAS-1 and PAS-2. The bHLH and PAS motifs are required for heterodimerization. The bHLH region contacts DNA, and a portion of the PAS motif putatively participates in DNA binding. ARNT2 has a PAC domain C-terminal to the PAS domains. The PAC domain putatively contributes to the PAS domain fold (SMART). ARNT2 also has a transactivation domain at its C-terminus.

 

The Arnold2 mutation results in an arginine (R) to cysteine (C) substitution at position 74 (R74C); Arg74 is within the bHLH domain.

Expression/Localization

ARNT2 is expressed in multiple regions of the brain, including the telencephalic cortex, hypothalamus, anterior and posterior pituitary, thalamus, and neural retina (3-6). Expression was also detected in neural crest-derived dorsal root ganglia, epithelia of bronchiolar buds of the lung, inner layer of the stomach, and in the kidney, with particularly strong expression in renal tubules.

 

ARNT2 localizes to the nucleus.

Background
Figure 5. ARNT2 role in food intake. Agrp/Npy neurons and Pomc/Cart neurons are located in the arcuate nucleus of the hypothalamus and are regulated by leptin from adipose tissue. Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons in the hypothalamus. Agouti and Agrp are hypothalamus-specific antagonists of MC3R and MC4R while α-MSH, a proteolytic product of Pomc, is a known agonist of MC3R and MC4R. Agrp and Npy stimulate food intake and decrease energy expenditures, causing weight gain. Pomc and Cart inhibit food intake and increase energy expenditure. Agrp, Agouti-related protein; Agrp, producing Agrp; Npy, neuropeptide Y; Pomc, pro-opiomelanocortin; Cart, cocaine- and amphetamine-regulated transcript; α-MSH, α-melanocyte stimulating hormone; LEPR, leptin receptor. This image is interactive. Other mutations found in the pathway are noted in red. Click on each allele for more information.

ARNT2 forms heterodimers with sensor proteins of the bHLH-PAS family (e.g., HIF-1α, AHR, NPAS4, SIM1, and SIM2); the heterodimers bind the core sequence TACGTC (termed the central nervous system midline enhancer [CME]) (7). Members of the bHLH-PAS family bind regulatory DNA sequences that code for proteins that are responsive to developmental and environmental stimuli. Transcriptional coactivators associate with the bHLH-PAS/ARNT2 dimer, which direct the recruitment of RNA polymerase II and the other general transcription factors to the promoter regions of genes.

 

ARNT2 functions in several physiological processes, including the development of the hypothalamo-pituitary axis, postnatal brain growth, visual function, maintenance of circadian rhythms, renal function, and appetite control (Figure 5). Microarray analysis identified 268 potential target genes of SIM1/ARNT2 (8). Several of the identified targets function in energy homeostasis (e.g., MC3R, JAK2, Tbr1, Mtpn, Naca, and TRβ2) and neurotransmitter reception (e.g., Chrne1 and Grin1). The SIM1/ARNT2 heterodimer regulates the feeding behavior in humans and mice (9-11). Mutations in human SIM1 are associated with severe obesity (12). Sim1-deficient mice are obese putatively due to aberrant development of the neuroendocrine hypothalamus (13).

 

ARNT2 functions in limiting body weight (1). Arnt2-mutant mice showed increased body weights compared to wild-type littermates. Arnt2-mutant mice had normal energy expenditures (1), but showed increased consumption of food and water compared to wild-type littermates. Arnt2-mutant fasted mice showed elevated circulating insulin and glucose levels compared to wild-type littermate mice (1). The Arnt2 mice also showed aberrant glucose tolerance, hepatomegaly, and non-alcoholic fatty liver disease (1).

 

ARNT2 expression is linked to protecting the health of neurons and axons (14). The ARNT2-associated function in neuronal health is putatively driven by ARNT2 association with NPAS4, which promotes expression of brain-derived neurotrophic factor.

 

ARNT2 also functions as an anti-apoptotic factor and a regulator of cell cycle progression in PC12 cells; RNA-interference-mediated knockdown of ARNT2 caused apoptosis in the PC12 cells (4).

 

The NPAS4/ARNT2 heterodimer putatively regulates genes involved in inhibitory synapse formation (15). NPAS4 has known functions in the maintenance excitatory/inhibitory balance in neurons (16). Aberrant NPAS4/ARNT2 function putatively leads to neuropsychiatric and neurodegenerative diseases, such as autism, schizophrenia, and dementia. The rs17225178 ARNT2 variant is associated with Asperger Syndrome in a Caucasian population (17).

 

ARNT2 has putative functions in cancer development, treatment, and outcome. ARNT2 mRNA expression levels are positively correlated with the prognosis of breast cancer, and ARNT2 expression is associated with smaller tumor sizes, relapse-free survival, and overall survival after breast cancer diagnosis (18). ARNT2 putatively functions in regulating HIF-1-associated signaling and metabolism in MCF7 human breast cancer cells (19). ARNT2 inhibits hepatocellular carcinoma progression (20). ARNT2 overexpression in HCCLM6 cells inhibited cell proliferation, invasion, and migration (20). ARNT2 is a putative tumor suppressor in non-small cell lung cancer progression (21). ARNT2 is expressed at higher levels in normal lung tissues compared with non-small cell lung cancer tissues (21). Patients with higher ARNT2 levels showed longer overall survival compared to patients with lower ARNT2 expression levels. ARNT2 overexpression inhibited cell viability, while reduced ARNT2 expression promoted cell growth in non-small cell lung cancer tissues. ARNT2 expression is downregulated in oral squamous cell carcinoma (OSCC)-derived cells and primary OSCC compared with normal tissue (22). Exogenous overexpression of ARNT2 in OSCC cells resulted in reduced cell proliferation. ARNT2 expression is lower in gastric cancer tissues compared with adjacent non-tumor tissues (23). ARNT2 expression negatively correlated with depth of tumor invasion, the degree of differentiation, and poor survival of gastric cancer patients. ARNT2 overexpression inhibits cell proliferation.

 

Ninety-eight percent of Arnt2-deficient (Arnt2-/-) mice (MGI:2180386 and MGI:2178831) exhibited perinatal lethality (24;25). Arnt2-/- mice that survived birth were runted and died after 7 to 10 days (24). The Arnt2-/- mice died due to a lack of hypothalamic neuroendocrine lineage formation, impaired regulation of HIF-1 target genes and thymic defects (24-27)

 

Mutations in human ARNT2 are linked to Webb-Dattani syndrome (OMIM: #615926) (3). Webb-Dattani syndrome is an autosomal recessive disorder characterized by frontotemporal hypoplasia, globally delayed development, and pituitary and hypothalamic insufficiency due to hypoplastic development of these brain regions. Patients present soon after birth with multiple pituitary hormonal deficiencies and subsequently develop microcephaly, seizures, and spasticity. Other features include postretinal blindness and renal abnormalities.

Putative Mechanism

A central neural circuit controls energy balance (Figure 5(28). Two sets of neurons in the arcuate nucleus (a region surrounding the third ventricle in the most ventral portion of the hypothalamus) act as sensors of whole-body energy status and initiate signals to maintain energy stores at a constant level. The Agrp/Npy neurons (producing Agrp and neuropeptide Y) are inhibited by the leptin peptide by signaling through the leptin receptor (mutated in Business classCherub and Well-upholstered), while Pomc/Cart neurons (producing Pomc, its proteolytic products and cocaine- and amphetamine-regulated transcript) are stimulated by leptin (29-31). Leptin is a circulating protein produced by adipose tissue, and plasma leptin levels reflect body fat stores (32-34). Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons (29;35). Thus, when leptin levels are low, Agrp/Npy neurons are activated and Pomc/Cart neurons are inhibited, producing Agrp but not Pomc, and resulting in inhibition of MC4R and increased food intake.

 

The Arnold2 mice showed increased body weights presumably due to hyperphagia. The body weight phenotype observed in the Arnold2 mice indicates loss of ARNT2-associated transcription factor function putatively due to a failure to translocate to the nucleus. The mutation in Arnold2 may disrupt ARNT2 and SIM1 heterodimerization, resulting in reduced function.

Primers PCR Primer
Arnold2_pcr_F: GGAAGCCAAATTTCTTGCCTTCACC
Arnold2_pcr_R: TTCCATGCTCCCTGGTCAAAAGTC

Sequencing Primer
Arnold2_seq_F: GTACCTGCTCAGTGAGGAAG
Arnold2_seq_R: CCCGAGTTACAGATGTGTCAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 639 nucleotides is amplified (chromosome 7, - strand):


1   ttccatgctc cctggtcaaa agtccatagg tatgtgtgta attccggaag agcctataca
61  tatttagaga aggaggcaca gagagaggtc catgcttccc acacaaagac ccgagttaca
121 gatgtgtcag ggattcagtc cacaactact caaaacactg agccattatg agttaggtcc
181 aggactttgg ctatctgatg ttaacagtgt attcttttat cccaatgtct gctgaccgac
241 ccctggtctg atccttctct ttttccctcc ccctgacctc ttgctttctg ggaagagaga
301 accacagtga gattgagcgg cgcaggcgga acaagatgac tcaatatatt acggaactct
361 ccgacatggt tcccacctgc agtgcactgg ctaggaagcc agacaagctg accatcctgc
421 gcatggcggt ctcgcacatg aagtccatga ggggcaccgg caacaaatcg actgacggcg
481 cctacaagcc ttccttcctc actgagcagg taccccagcg ttggtgttgt ggtgttgtgg
541 ccagtggaaa ttggagggat ccttaaggtc acaagcctga gataaattat ataggaacat
601 gcagttgggg aagaggtgaa ggcaagaaat ttggcttcc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Katherine Timer
AuthorsEmre Turer, Jin Huk Choi, Xue Zhong, Zhe Chen, William McAlpine, Jeff SoRelle, Noelle Hutchins