Phenotypic Mutation 'mousebird'

• Allele: mousebird
• Mutation Type: critical splice donor site (2 bp from exon)
• Chromosome: 18
• Coordinate: 65,608,331 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Malt1
• Gene Name: MALT1 paracaspase
• Synonym(s): D430033E09Rik, paracaspase, Pcasp1
• Chromosomal Location: 65,564,010-65,611,959 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been found to be recurrently rearranged in chromosomal translocation with two other genes - baculoviral IAP repeat-containing protein 3 (also known as apoptosis inhibitor 2) and immunoglobulin heavy chain locus - in mucosa-associated lymphoid tissue lymphomas. The protein encoded by this gene may play a role in NF-kappaB activation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous inactivation of this gene disrupts normal B cell development and leads to impaired cytokine production and T cell and B cell proliferative responses after antigen receptor engagement due to failure of NF-kappaB activation. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000048376 ^†] [ENSMUSP00000153585 ^†] † probably from a misspliced transcript
• AlphaFold: Q2TBA3
• SMART Domains: Protein: ENSMUSP00000048376; Gene: ENSMUSG00000032688

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
low complexity region	38	51	N/A	INTRINSIC
PDB:2G7R|B	52	132	3e-29	PDB
IGc2	145	203	8.19e-9	SMART
IGc2	248	306	2.88e-4	SMART
Pfam:Peptidase_C14	340	557	1.4e-19	PFAM

• Predicted Effect: probably null
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9499
• Is this an essential gene?: Possibly nonessential (E-score: 0.428)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• MMRRC Submission: 038188-MU
• Last Updated: 2018-04-18 3:09 PM by Diantha La Vine
• Record Created: 2014-08-28 7:36 PM by Kuan-Wen Wang
• Record Posted: 2015-04-07
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Kuan-Wen Wang, Jin Huk Choi, Apiruck Watthanasurorot, Bruce Beutler

Accession Number

NCBI RefSeq: NM_172833; MGI:2445027

Alleles Listed at MGI

All mutations/alleles(8) : Gene trapped(3) Targeted(5)

Phenotypic Description

Figure 1. Homozygous mousebird mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Mousebird mice exhibit diminished T-dependent IgG responses to Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Mousebird mice exhibit diminished T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The mousebird phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R0748, some of which showed a diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 1), a diminished T-dependent antibody response to Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 2), and a diminished T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) (Figure 3).  

Nature of Mutation

Figure 4. Linkage mapping of the reduced T-dependent IgG response to rSFV-β-gal. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 30 mutations (X-axis) identified in the G1 male of pedigree R0748. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 30 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Malt1:  a T to A transversion at base pair 65,475,260 (v38) on chromosome 18, or base pair 44,325 in the GenBank genomic region NC_000084.  The strongest association was found with an additive model of linkage (P = 2.683 x 10^-6) to the normalized T-independent antibody response to rSFV-β-gal, wherein 3 variant homozygotes departed phenotypically from 17 homozygous reference mice and 25 heterozygous mice (Figure 4).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed.  The mutation corresponds to nucleotide two within the donor splice site of intron 15 of Malt1. The effect of the mutation at the cDNA and protein level has not been tested, but the mutation is predicted to result in skipping of the 126-base pair exon 15 (out of 16 total exons). Skipping of exon 15 would cause an in-frame deletion of amino acids 635-676.

<--exon 14       <--exon 15 intron 15-->     exon 16--> 42208 ……ACTGATTTCCCTCTT……CTACAAAAATTAAAG gtcactgcttttcc…… GAACATCTGATC……TCTGAAAACTGA 630   ……-T--D--F--P--L-……-L--Q--K--L--K-                  -E--H--L--I-……-S--E--N--*-             correct         deleted                                 correct

Genomic numbering corresponds to NC_000084. The donor splice site of intron 15, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction

Figure 5. Domain structure of MALT1. The location of the mousebird mutation within intron 15 is indicated. Abbreviations: DD, death domain, Ig, immunoglobulin-like.

Malt1 encodes mucosa-associated lymphoid tissue translocation gene 1 (MALT1; alternatively paracaspase; Figure 5). MALT1 has several domains including a death domain (DD; amino acids 45-132), a paracaspase domain (amino acids 340-535), and three immunoglobulin (Ig)-like domains [amino acids 145-203 (Ig1), 248-306 (Ig2), and 581-715 (Ig3)] (1).

Figure 6. Crystal structure of human MALT1 (amino acids 334-719). Figure was generated by Chimera and is based on PDB:3V55 and Weismann et al. 2012.

The paracaspase domain of MALT1 is essential for its catalytic function (2). Cys464 is a predicted active site of MALT1 and mutation of Cys464 to alanine (Cys465Ala) resulted in reduced activation of NF-κB (1;2). The paracaspase domain of MALT1 may directly associate with CARMA1 (alternatively, CARD11; see the record for king) within the CARMA1/BCL10/MALT (CBM) complex (see the Background section for more details on the CBM complex) (3). The enzyme/protease activity of MALT1 is dependent on the formation of MALT1 dimers, which are stabilized by monoubiquitination of MALT1 on Lys644 (2;4;5). Upon substrate binding, the MALT1 dimer undergoes conformation changes that affect the conformation of both the caspase and Ig3 domains (2). The catalytic domain of MALT1 adopts a general caspase fold [Figure 6; PDB:3V55; (2)]. The paracaspase domain has a six-stranded (β2, β1, β3, β4, β7, and β8) β-sheet that is flanked by three helices (αA, αD, αE) on one side and by two helices (αB and αC) on the other side (2). The MALT1 dimer is formed by interactions between β8 and αF from their respective monomers (2). The MALT1 dimer forms a contiguous 12-stranded β-sheet with the active sties positioned on opposite faces of the central β-sheet.

The Ig-like domains of MALT1 are protein-protein interaction domains that facilitate the interaction of MALT1 with the Ser/Thr-rich C-terminus of BCL10 (6). BCL10 binds MALT1 in a region that contains the DD and the Ig1 domain (7). Interaction between MALT1 and BCL10 induces MALT1 oligomerization (8;9). The Ig3 domain is required for the stabilization of the MALT1 protein structure (2). The structure of the DD, Ig1, and Ig2 domains have been solved (10). The DD is a five-helix bundle (10). Ig-like domains typically are comprised of two β-sheets, one formed by strands βA, βB, βE, and βD, and the other of strands βC, βF, and βG (2). The Ig1 and Ig2 domains have a classical sandwich-like Ig fold formed by two antiparallel β-sheets. Ig1 and Ig2 naturally form oligomers and are arranged in head-to-tail fashion (10). Helix α1 of the Ig3 domain packs closely against helix αC and strand β2 of the paracaspase domain. An additional strand, βA⁰, precedes strand βA in the Ig3 domain of MALT1. In contrast to other Ig-like domains that have one of two β-sheets that contain strands βA, βB, βE, and βD (i.e., a “ABED” topology, the Ig3 domain of MALT1 has an additional strand (βA⁰), lacks the βD strand, and has a very short βE strand subsequently having a “A⁰ABE” topology (2).

MALT1 has candidate self-cleavage site at Arg149. B- and T-cell stimulation induced MALT1 cleavage resulting in the generation of a p19 and a p76 fragment (11). Baens et al. propose that following self-cleavage of MALT1 at R149, the p76 MALT1 fragment activated NF-κB in a TRAF6-dependent, BCL10-independent manner (11). MALT1 cleavage did not affect the proteolytic activity of MALT1 and was not necessary for IKK activation or nuclear translocation of NF-κB in activated T cells; however, it was required for the expression of NF-κB targets including IL-2 and granulocyte-macrophage-colony stimulating factor (GM-CSF) (11).

The mousebird mutation within intron 15 is predicted to result in deletion of amino acids 635-676 which constitutes a portion of the Ig3 domain.

Expression/Localization

Malt1 is ubiquitously expressed (12). Malt1 is highly expressed in peripheral blood mononuclear cells; weaker expression was observed in the bone marrow, thymus, lymph node, colon, and lung (13). MALT1 protein expression has been noted in heart, liver, kidney, spleen, and thymus (12).

Background

Figure 7. Canonical and non-canonical NF-kB signaling pathways. In the canonical pathway, several membrane receptors, including TNFR (tumor-necrosis factor receptor), IL-1R (interleukin-1 receptor) and TLRs (toll-like receptors), signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKα and IKKβ). Ubiquitination can be inhibited by deubiquitinating enzymes (DUB). Stimulation of the T-cell receptor (TCR) and B-cell receptor (BCR) results in the recruitment of Src and Syk family kinases. These kinases activate a phosphorylation cascade which leads to the activation of protein kinase C (PKC). The phosphorylation of CARMA1 (CARD (caspase-recruitment domain)-MAGUK (membrane-associated guanylate kinase) protein 1) recruits BCL 10 (B-cell lymphoma 10) and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1), forming the CBM complex and activating the IKK complex. The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles) by 26S proteasome. Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A subset of TNFRs such as the lymphotoxin-β receptor (LT-bR),CD40, B-cell-activating factor receptor (BAFFR) and receptor activator of Nf-κB (RANK) can activate the canonical or non-canonical NF-κB signaling pathways. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKa which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

B-cell receptor (BCR) or T-cell receptor (TCR) engagement results in the formation of a lipid raft-associated multiprotein complex (called the “immunological synapse” in T cells) at the site of cell-cell contact that controls the events leading to activation of NF-κB [Figure 7; (14)]. Upon T cell activation by the TCR and costimulatory molecule engagement, CARMA1 associates with a complex containing Bcl10 and MALT1 and recruits these proteins to lipid rafts of the immunological synapse and to form a scaffold for the assembly of several signaling complexes including those that involve TNF receptor-associated factor 6 (TRAF6), TGF (transforming growth factor)-β-activated kinase 1 (TAK1), and NF-κB essential modulator (NEMO; see the record for panr2) to facilitate NF-κB activation and lymphocyte stimulation. The CBM complex at the immunological synapse activates the inhibitor of kappa B kinase (IKK) complex. MALT1 is proposed to mediate the activation of the IKK complex by binding to TRAF6-containing ubiquitin ligase complexes to facilitate the addition of K63-linked ubiquitin chains to several proteins and the subsequent proteasome-mediated degradation of BCL10, MALT1, TRAF6, and NEMO (15). Subsequently, the IKK complex is recruited and TRAF6-dependent activation of the Ser/Thr kinase TAK1 promotes the activation of IKKβ by its phosphorylation (16). IKKβ is required for the recruitment of Bcl10/MALT1 to CARMA1 after TCR engagement. IKKβ then catalyzes the phosphorylation of Bcl10 and disengagement of Bcl10 from MALT1, leading to reduced Bcl10-induced IKKγ ubiquitination (17). In effector T cells, the active IKK complex is a component of the TCR-dependent Bcl10-MALT1 signalosome containing the adaptor protein p62 (18). IKK activation occurs after signalosome assembly. Activation of the IKK complex leads to degradation of inhibitor of kappa-Bα (IκBα) and subsequent activation and translocation of NF-κB dimers comprised of p65 (alternatively, RelA) and p50 (see the record for Finlay) to the nucleus (3;19-21). The CBM complex functions similarly in B cells to activate NF-κB in response to BCR engagement (22). In addition to the CBM complex, protein kinase C (PKC) is a critical component of the immunological synapse required for the activation of NF-κB. The PKC isoform PKCβ (see the record for Untied) operates specifically in BCR-dependent NF-κB signaling (23), while PKCθ functions specifically in TCR-dependent NF-κB signaling (24;25). Upon lymphocyte activation, the linker domain of CARMA1 is phosphorylated at several sites by PKCβ or PKCθ. These phosphorylation events are required for release of the inhibitory intramolecular CARD domain-linker domain interactions within CARMA1, allowing CARMA1 to assemble the CBM complex required to activate NF-κB (22;26). CARMA1, BCL10, and MALT1 are all essential for adaptive immunity and for NF-κB activation after B- and T-cell receptor stimulation (27-30).  Deficiency in expression of any of the three proteins leads to defective NF-κB activation and subsequent defects in adaptive immunity (28;31).

In addition to T and B cells, MALT1 functions in mast cells, dendritic cells, macrophages and natural killer (NK) cells (32-34). In marginal zone B cells, MALT1 mediates BAFF (see the record for Frozen)-dependent anti-apoptotic gene induction through the noncanonical NF-κB signaling pathway (see the record for xander) (35). In mast cells, MALT1 mediates IgE FcεRI receptor-mediated secretion of TNFα (see the record for Panr1) and IL-6 (33). Malt1^-/- mice have normal skin mast cells and exhibit regular IgE-mediated immediate phase anaphylactic reactions; however, late phase anaphylactic reactions are reduced (33). Bone marrow-derived mast cells from Malt1^-/- mice did not produce TNF-α or IL-6 in response to FcεRI stimulation due to loss of NF-κB activation, but the production of leukotrienes and degranulation was normal (33). In dendritic cells, MALT1 is necessary for the differentiation of T_H17 subset of helper T cells. In macrophages, MALT1 mediates NF-κB activation downstream of toll-like receptor 4 (TLR4; see the record for lps3) and the C-type lectin receptors Dectin-1 and -2 (36-38). In dendritic cells and macrophages, CARD9 can stimulate NF-κB activation during innate immune responses as well as through the C-type lectin receptor pathway. In NK cells, MALT1 functions downstream of several immune receptor tyrosine-based activation motif (ITAM)-coupled lectin-like receptors including NK1.1 (see the record for Unnatural), Ly49D, Ly49H, and NKG2D to activate the canonical NF-κB pathway as well as JNK and p38 MAP kinases that induce NK-cell cytotoxicity and cytokine release (34). NK cells from Malt1-deficient (Malt1^-/-) mice exhibit impaired TNF-α, IFN-γ, GM-CSF, and MIP-1β production upon NK cell activation using phorbol myristate acetate (PMA) and the calcium ionophore ionomycin (Iono) (34).

BCL10 and MALT1 can interact with other CARD family members including CARMA3 (alternatively, CARD10) and CARD9 to induce NF-κB activation. CARMA3 stimulates NF-κB activation through G protein-coupled receptors (GPCRs) and receptor tyrosine kinases that recognize lysophosphatidic acid (LPA), the proinflammatory growth factor angiotensin II (Ang II), CXCL8/IL-8, CXCL12/SDF-1α, and thrombin (12;39-43). For example, in vascular smooth muscle cells and endothelial cells, MALT1 regulates CXCL8-dependent upregulation of VEGF as well as thrombin-dependent adhesion of monocytes indicating a MALT1 function in neovascularization, endothelial dysfunction, and atherosclerosis (39;41;42). MALT1 has a role in the pathophysiology of some carcinomas and inflammatory diseases through the CARMA3/Bcl10/MALT1 pathway. For example, in ovarian cancer pathogenesis, MALT1 promotes LPA-mediated urokinase plasminogen activator (uPA) upregulation (44). In oral squamous cell carcinoma, MALT1 mediates CXCL12/SDF-1α-induced cellular invasion (43).

In addition to its function within the CBM complex, MALT1 is a paracaspase that cleaves substrates after arginine residues in the P1 position (i.e., N-terminal to the cleavage site) [reviewed in (45)]. The known substrates of MALT1 include BCL10, A20, cylindromatosis (CYLD), NF-κB-inducing kinase (NIK), RelB, and Regnase-1 [Table 1; (46-51)].  Cleavage of the MALT1 substrates serves to inactivate negative regulators of both canonical and non-canonical NF-κB signaling as well as JNK signaling.

Table 1. Known substrates of MALT1 [reviewed in (45)].

Substrate	Summary of function	Effect of MALT1-induced cleavage	References
BCL10	Adaptor for the CBM signaling complex	Regulates MALT lymphoma cell adhesion to fibronectin; regulates integrin-mediated T cell adhesion	(46)
A20	A deubiquitinating enzyme that removes K63-linked chains from NF-κB activators (e.g., TRAF6, NEMO, and MALT1); see the record for lasvegas	Inactivates A20 and results in amplification and persistent NF-κB signaling	((47)
CYLD	A deubiquitinating enzyme; persistent NF-κB signaling	Positively regulates JNK signaling; results in persistent NF-κB signaling	(48)
NIK	Phosphorylates IKKα (inhibitory κB kinase) to regulate non-canonical NF-κB signaling (see the record for xander for information on the non-canonical NF-κB signaling pathway)	Persistent noncanonical NF-κB signaling; contributes to MALT lymphomagenesis	(52)
RelB	NF-κB subunit in the non-canonical NF-κB signaling pathway	Enforces canonical NF-κB signaling	(49)
Regnase-1 (alternatively, MCPIP-1)	RNA-binding protein that destabilizes mRNAs of T cell effector genes	Alleviates Regnase-1-mediated suppression that regulates mRNA stability of effector genes in T cells	(50)
Roquin-1	Post-transcriptional gene regulation	Alleviates roquin-1-mediated suppression that regulates mRNA stability of genes (e.g., IL-6, ICOS, c-Rel, IRF4, IκBNS and IκBζ) that regulate TH17 cell differentiation	(53)
MALT1	See text for description of function	Necessary for antigen receptor-induced TRAF6-dependent NF-κB-dependent gene (e.g., IL6, c-Rel, Ox40, and Il2) transcription	(11)

Malt1^-/- mice exhibit defective antigen receptor-induced lymphocyte activation (27;28). In addition, Malt1^-/- mice exhibit defects in B1 and marginal zone B cell development as well as TCR-mediated cellular proliferation, activation, and cytokine production (27;28). The role of MALT1 in B2 cell development is unclear (27;28). The numbers and differentiation of B cell precursors in the bone marrow of the Malt1^-/- mice was normal (27). In addition, the expression of surface IgM and IgD on mature splenic B cells, maturation of CD3⁻IL-2Rβ⁺ NK cells and CD3⁺IL-2Rβ⁺ NKT cells, the number of thymocytes and maturation of CD4⁺CD8⁺ double-positive thymocytes into CD4⁺ and CD8⁺ single-positive T cells, and the number and distribution of single positive T cells in the spleen and lymph nodes were normal in the Malt1^-/- mice (27). However, there was a reduction in the proportion of DN3 cells (CD25⁺CD44^lo) and an increase in the DN4 cells (CD25^–CD44^lo) in the Malt1^-/- mice due to premature maturation of the double negative thymocytes (28). The frequency of peripheral activated T cells was reduced in the Malt1^-/- mice. All of the Ig isotypes were reduced in the Malt1^-/- mice compared to those in wild-type mice (27;28). Stimulation of T cells from Malt1^-/- mice with anti-CD3ϵ antibodies (with or without anti-CD28 costimulation) or with PMA did not result in T cell expansion or IL-2 synthesis (27;28;54). Stimulation of T cells from Malt1^-/- mice with PMA led to impaired JNK activation compared to wild-type mice (27). The role of MALT1 in LPS-stimulated B cell proliferation is unclear; studies have reported that MALT1 was or was not necessary for LPS-induced NF-κB signaling (27;28). However, LPS-induced NF-κB activation in macrophages requires MALT1 expression (36). In B cells, MALT1 selectively regulates activation of the NF-κB subunit c-REL to control B-cell survival and Malt1^-/- B cells die more rapidly than wild-type cells (55). While wild-type B cells induce the expression of antiapoptotic factor Bcl-x_L in response to BCR ligation, Malt1^-/- B cells do not (55).

Several human pathologies are linked to MALT1. B-cell lymphomas affecting mucosa-associated lymphoid tissue (i.e., MALT lymphomas) are often caused by the t(11;18)(q21;q21) chromosomal translocation, which results in a gain-of-function fusion protein, inhibitor of apoptosis 2 (cIAP2)—MALT1 (13;56-59). The fusion protein consists of the C-terminus of MALT1 linked to the N-terminus of cIAP2 and causes constitutive activation of the canonical NF-κB pathway, promoting cell growth and survival (8;9;57). The cIAP2—MALT1 fusion protein also induces the proteasome-dependent processing of p100 to p52 in the the noncanonical NF-κB pathway (52). The t(14;18)(q32;q21) chromosomal translocation also affects the MALT1 gene, putting it under the control of the immunoglobulin heavy locus (IgH) enhancer and subsequently causing dysregulation of MALT1 expression (58). Mutations in MALT1 are linked to immunodeficiency-12 [IMD12; alternatively, combined immunodeficiency (CID); OMIM: #615468; (60;61)). IMD12 is characterized by early-onset recurring bacterial and candida infections leading to bronchiectasis and growth delay as well as inflammatory gastrointestinal disease, periodontal disease, and dermatitis (60;61). Patients with IMD12 have normal levels of circulating T and B cells as well as serum immunoglobulins, antibody titers were low after immunization, T cells showed impaired proliferative responses to antigens , increased numbers of naïve B cells, loss of marginal zone B cells, and reduced switched memory B cells (60;61). Patients with IMD12 die between ages 7 and 13.5 years (61). Dysregulation of MALT1 expression has also been observed in B-cell non-Hodgkin lymphoma (62).

Putative Mechanism

Malt1^-/- mice exhibited reduced T-dependent antibody responses to keyhole limpet haemocyanin (KLH) in complete Freund's adjuvant (CFA) and 2,4-dinitrophenol–conjugated ovalbumin (DNP-OVA) as well as reduced T-independent antibody responses to tri-nitrophenol-(TNP)-Ficoll (27;28;35). The mousebird mice also exhibit defects in both T-independent and T-dependent antibody responses indicating that the MALT1^mousebird protein exhibits loss-of-function.

Primers

PCR Primer
mousebird_pcr_F: TGAATCTTCCTGCAACTTCCCCAAATG
mousebird_pcr_R: GGCCTAACTTCTCAACAGCAGAGC

Sequencing Primer
mousebird_seq_F: GGGATTACCTATTCAAGCCAGTACTC
mousebird_seq_R: TTCTCAACAGCAGAGCAGACAG

Genotyping

Mousebird genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

Mousebird(F): 5’- TGAATCTTCCTGCAACTTCCCCAAATG-3’

Mousebird(R): 5’- GGCCTAACTTCTCAACAGCAGAGC-3’

Sequencing Primer

Mousebird_seq(F): 5’- GGGATTACCTATTCAAGCCAGTACTC-3’
 

Mousebird_seq(R): 5’- TTCTCAACAGCAGAGCAGACAG-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 689 nucleotides is amplified (Chr.18: 65474770-65475458, GRCm38; NC_000083):

43835                                      tgaatc ttcctgcaac ttccccaaat    

43861 gataataaag acagagactc caaaactgaa aactggaaca ggttacaagt gattcaaaga    

43921 atagctgtaa aggcaactat ccttttagaa ataacttgaa gtgtttttaa tgtcgctact    

43981 ttaaaaatgt gtagaatcta gaatacctat ggcaatttat ggccctagaa aatgattttc    

44041 ctgtttcttt agtcctctct aagggattac ctattcaagc cagtactcat gagagaacag    

44101 tatctgtgaa gatattttat gttatacaca atgatataac ttccattgat tgcatcatag    

44161 acatttactg tcttgggttt tgttttgttt tttataggac ctagatattg atccaaaaca    

44221 tgcaaacaag gggactcctg aagaaactgg cagctactta gtatcaaaag accttcccaa    

44281 gcactgcctc tacactagac tcagctcact acaaaaatta aaggtcactg cttttcctgt    

44341 ttccagcagc taacaaaaaa gctgtggggc taagaaggtt gattgtggca tcgtccaggg    

44401 atgagttgct tcttttggga actaacctgg agcagcagta actacagtgg tctttgacat    

44461 taaattctgc ctctgttact ggcctaggga cgtctgtctg ctctgctgtt gagaagttag

44521 gcc

FASTA sequence

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated T is shown in red text.

References

  1. Uren, A. G., O'Rourke, K., Aravind, L. A., Pisabarro, M. T., Seshagiri, S., Koonin, E. V., and Dixit, V. M. (2000) Identification of Paracaspases and Metacaspases: Two Ancient Families of Caspase-Like Proteins, One of which Plays a Key Role in MALT Lymphoma. Mol Cell. 6, 961-967.

  2. Wiesmann, C., Leder, L., Blank, J., Bernardi, A., Melkko, S., Decock, A., D'Arcy, A., Villard, F., Erbel, P., Hughes, N., Freuler, F., Nikolay, R., Alves, J., Bornancin, F., and Renatus, M. (2012) Structural Determinants of MALT1 Protease Activity. J Mol Biol. 419, 4-21.

  3. Che, T., You, Y., Wang, D., Tanner, M. J., Dixit, V. M., and Lin, X. (2004) MALT1/paracaspase is a Signaling Component Downstream of CARMA1 and Mediates T Cell Receptor-Induced NF-kappaB Activation. J Biol Chem. 279, 15870-15876.

  4. Pelzer, C., Cabalzar, K., Wolf, A., Gonzalez, M., Lenz, G., and Thome, M. (2013) The Protease Activity of the Paracaspase MALT1 is Controlled by Monoubiquitination. Nat Immunol. 14, 337-345.

  5. Cabalzar, K., Pelzer, C., Wolf, A., Lenz, G., Iwaszkiewicz, J., Zoete, V., Hailfinger, S., and Thome, M. (2013) Monoubiquitination and Activity of the Paracaspase MALT1 Requires Glutamate 549 in the Dimerization Interface. PLoS One. 8, e72051.

  6. Qiao, Q., Yang, C., Zheng, C., Fontan, L., David, L., Yu, X., Bracken, C., Rosen, M., Melnick, A., Egelman, E. H., and Wu, H. (2013) Structural Architecture of the CARMA1/Bcl10/MALT1 Signalosome: Nucleation-Induced Filamentous Assembly. Mol Cell. 51, 766-779.

  7. Langel, F. D., Jain, N. A., Rossman, J. S., Kingeter, L. M., Kashyap, A. K., and Schaefer, B. C. (2008) Multiple Protein Domains Mediate Interaction between Bcl10 and MALT1. J Biol Chem. 283, 32419-32431.

  8. Lucas, P. C., Yonezumi, M., Inohara, N., McAllister-Lucas, L. M., Abazeed, M. E., Chen, F. F., Yamaoka, S., Seto, M., and Nunez, G. (2001) Bcl10 and MALT1, Independent Targets of Chromosomal Translocation in Malt Lymphoma, Cooperate in a Novel NF-Kappa B Signaling Pathway. J Biol Chem. 276, 19012-19019.

  9. Noels, H., van Loo, G., Hagens, S., Broeckx, V., Beyaert, R., Marynen, P., and Baens, M. (2007) A Novel TRAF6 Binding Site in MALT1 Defines Distinct Mechanisms of NF-kappaB Activation by API2middle dotMALT1 Fusions. J Biol Chem. 282, 10180-10189.

  10. Qiu, L., and Dhe-Paganon, S. (2011) Oligomeric Structure of the MALT1 Tandem Ig-Like Domains. PLoS One. 6, e23220.

  11. Baens, M., Bonsignore, L., Somers, R., Vanderheydt, C., Weeks, S. D., Gunnarsson, J., Nilsson, E., Roth, R. G., Thome, M., and Marynen, P. (2014) MALT1 Auto-Proteolysis is Essential for NF-kappaB-Dependent Gene Transcription in Activated Lymphocytes. PLoS One. 9, e103774.

  12. McAllister-Lucas, L. M., Ruland, J., Siu, K., Jin, X., Gu, S., Kim, D. S., Kuffa, P., Kohrt, D., Mak, T. W., Nunez, G., and Lucas, P. C. (2007) CARMA3/Bcl10/MALT1-Dependent NF-kappaB Activation Mediates Angiotensin II-Responsive Inflammatory Signaling in Nonimmune Cells. Proc Natl Acad Sci U S A. 104, 139-144.

  13. Akagi, T., Motegi, M., Tamura, A., Suzuki, R., Hosokawa, Y., Suzuki, H., Ota, H., Nakamura, S., Morishima, Y., Taniwaki, M., and Seto, M. (1999) A Novel Gene, MALT1 at 18q21, is Involved in t(11;18) (q21;q21) found in Low-Grade B-Cell Lymphoma of Mucosa-Associated Lymphoid Tissue. Oncogene. 18, 5785-5794.

  14. van der Merwe, P. A. (2002) Formation and Function of the Immunological Synapse. Curr Opin Immunol. 14, 293-298.

  15. Oeckinghaus, A., Wegener, E., Welteke, V., Ferch, U., Arslan, S. C., Ruland, J., Scheidereit, C., and Krappmann, D. (2007) Malt1 Ubiquitination Triggers NF-kappaB Signaling upon T-Cell Activation. EMBO J. 26, 4634-4645.

  16. Thome, M. (2008) Multifunctional Roles for MALT1 in T-Cell Activation. Nat Rev Immunol. 8, 495-500.

  17. Wegener, E., Oeckinghaus, A., Papadopoulou, N., Lavitas, L., Schmidt-Supprian, M., Ferch, U., Mak, T. W., Ruland, J., Heissmeyer, V., and Krappmann, D. (2006) Essential Role for IkappaB Kinase Beta in Remodeling Carma1-Bcl10-Malt1 Complexes upon T Cell Activation. Mol Cell. 23, 13-23.

  18. Paul, S., Traver, M. K., Kashyap, A. K., Washington, M. A., Latoche, J. R., and Schaefer, B. C. (2014) T Cell Receptor Signals to NF-kappaB are Transmitted by a Cytosolic p62-Bcl10-Malt1-IKK Signalosome. Sci Signal. 7, ra45.

  19. Gaide, O., Favier, B., Legler, D. F., Bonnet, D., Brissoni, B., Valitutti, S., Bron, C., Tschopp, J., and Thome, M. (2002) CARMA1 is a Critical Lipid Raft-Associated Regulator of TCR-Induced NF-Kappa B Activation. Nat Immunol. 3, 836-843.

  20. Egawa, T., Albrecht, B., Favier, B., Sunshine, M. J., Mirchandani, K., O'Brien, W., Thome, M., and Littman, D. R. (2003) Requirement for CARMA1 in Antigen Receptor-Induced NF-Kappa B Activation and Lymphocyte Proliferation. Curr Biol. 13, 1252-1258.

  21. Wang, D., You, Y., Case, S. M., McAllister-Lucas, L. M., Wang, L., DiStefano, P. S., Nunez, G., Bertin, J., and Lin, X. (2002) A Requirement for CARMA1 in TCR-Induced NF-Kappa B Activation. Nat Immunol. 3, 830-835.

  22. Sommer, K., Guo, B., Pomerantz, J. L., Bandaranayake, A. D., Moreno-Garcia, M. E., Ovechkina, Y. L., and Rawlings, D. J. (2005) Phosphorylation of the CARMA1 Linker Controls NF-kappaB Activation. Immunity. 23, 561-574.

  23. Su, T. T., Guo, B., Kawakami, Y., Sommer, K., Chae, K., Humphries, L. A., Kato, R. M., Kang, S., Patrone, L., Wall, R., Teitell, M., Leitges, M., Kawakami, T., and Rawlings, D. J. (2002) PKC-Beta Controls I Kappa B Kinase Lipid Raft Recruitment and Activation in Response to BCR Signaling. Nat Immunol. 3, 780-786.

  24. Lin, X., O'Mahony, A., Mu, Y., Geleziunas, R., and Greene, W. C. (2000) Protein Kinase C-Theta Participates in NF-kappaB Activation Induced by CD3-CD28 Costimulation through Selective Activation of IkappaB Kinase Beta. Mol Cell Biol. 20, 2933-2940.

  25. Wang, D., Matsumoto, R., You, Y., Che, T., Lin, X. Y., Gaffen, S. L., and Lin, X. (2004) CD3/CD28 Costimulation-Induced NF-kappaB Activation is Mediated by Recruitment of Protein Kinase C-Theta, Bcl10, and IkappaB Kinase Beta to the Immunological Synapse through CARMA1. Mol Cell Biol. 24, 164-171.

  26. Matsumoto, R., Wang, D., Blonska, M., Li, H., Kobayashi, M., Pappu, B., Chen, Y., Wang, D., and Lin, X. (2005) Phosphorylation of CARMA1 Plays a Critical Role in T Cell Receptor-Mediated NF-kappaB Activation. Immunity. 23, 575-585.

  27. Ruland, J., Duncan, G. S., Wakeham, A., and Mak, T. W. (2003) Differential Requirement for Malt1 in T and B Cell Antigen Receptor Signaling. Immunity. 19, 749-758.

  28. Ruefli-Brasse, A. A., French, D. M., and Dixit, V. M. (2003) Regulation of NF-kappaB-Dependent Lymphocyte Activation and Development by Paracaspase. Science. 302, 1581-1584.

  29. Ruland, J., Duncan, G. S., Elia, A., del Barco Barrantes, I., Nguyen, L., Plyte, S., Millar, D. G., Bouchard, D., Wakeham, A., Ohashi, P. S., and Mak, T. W. (2001) Bcl10 is a Positive Regulator of Antigen Receptor-Induced Activation of NF-kappaB and Neural Tube Closure. Cell. 104, 33-42.

  30. Hara, H., Wada, T., Bakal, C., Kozieradzki, I., Suzuki, S., Suzuki, N., Nghiem, M., Griffiths, E. K., Krawczyk, C., Bauer, B., D'Acquisto, F., Ghosh, S., Yeh, W. C., Baier, G., Rottapel, R., and Penninger, J. M. (2003) The MAGUK Family Protein CARD11 is Essential for Lymphocyte Activation. Immunity. 18, 763-775.

  31. Newton, K., and Dixit, V. M. (2003) Mice Lacking the CARD of CARMA1 Exhibit Defective B Lymphocyte Development and Impaired Proliferation of their B and T Lymphocytes. Curr Biol. 13, 1247-1251.

  32. Thome, M. (2004) CARMA1, BCL-10 and MALT1 in Lymphocyte Development and Activation. Nat Rev Immunol. 4, 348-359.

  33. Klemm, S., Gutermuth, J., Hultner, L., Sparwasser, T., Behrendt, H., Peschel, C., Mak, T. W., Jakob, T., and Ruland, J. (2006) The Bcl10-Malt1 Complex Segregates Fc Epsilon RI-Mediated Nuclear Factor Kappa B Activation and Cytokine Production from Mast Cell Degranulation. J Exp Med. 203, 337-347.

  34. Gross, O., Grupp, C., Steinberg, C., Zimmermann, S., Strasser, D., Hannesschlager, N., Reindl, W., Jonsson, H., Huo, H., Littman, D. R., Peschel, C., Yokoyama, W. M., Krug, A., and Ruland, J. (2008) Multiple ITAM-Coupled NK-Cell Receptors Engage the Bcl10/Malt1 Complex Via Carma1 for NF-kappaB and MAPK Activation to Selectively Control Cytokine Production. Blood. 112, 2421-2428.

  35. Tusche, M. W., Ward, L. A., Vu, F., McCarthy, D., Quintela-Fandino, M., Ruland, J., Gommerman, J. L., and Mak, T. W. (2009) Differential Requirement of MALT1 for BAFF-Induced Outcomes in B Cell Subsets. J Exp Med. 206, 2671-2683.

  36. Dong, W., Liu, Y., Peng, J., Chen, L., Zou, T., Xiao, H., Liu, Z., Li, W., Bu, Y., and Qi, Y. (2006) The IRAK-1-BCL10-MALT1-TRAF6-TAK1 Cascade Mediates Signaling to NF-kappaB from Toll-Like Receptor 4. J Biol Chem. 281, 26029-26040.

  37. Gringhuis, S. I., Wevers, B. A., Kaptein, T. M., van Capel, T. M., Theelen, B., Boekhout, T., de Jong, E. C., and Geijtenbeek, T. B. (2011) Selective C-Rel Activation Via Malt1 Controls Anti-Fungal T(H)-17 Immunity by Dectin-1 and Dectin-2. PLoS Pathog. 7, e1001259.

  38. Gross, O., Gewies, A., Finger, K., Schafer, M., Sparwasser, T., Peschel, C., Forster, I., and Ruland, J. (2006) Card9 Controls a Non-TLR Signalling Pathway for Innate Anti-Fungal Immunity. Nature. 442, 651-656.

  39. McAllister-Lucas, L. M., Jin, X., Gu, S., Siu, K., McDonnell, S., Ruland, J., Delekta, P. C., Van Beek, M., and Lucas, P. C. (2010) The CARMA3-Bcl10-MALT1 Signalosome Promotes Angiotensin II-Dependent Vascular Inflammation and Atherogenesis. J Biol Chem. 285, 25880-25884.

  40. Klemm, S., Zimmermann, S., Peschel, C., Mak, T. W., and Ruland, J. (2007) Bcl10 and Malt1 Control Lysophosphatidic Acid-Induced NF-kappaB Activation and Cytokine Production. Proc Natl Acad Sci U S A. 104, 134-138.

  41. Delekta, P. C., Apel, I. J., Gu, S., Siu, K., Hattori, Y., McAllister-Lucas, L. M., and Lucas, P. C. (2010) Thrombin-Dependent NF-{Kappa}B Activation and monocyte/endothelial Adhesion are Mediated by the CARMA3.Bcl10.MALT1 Signalosome. J Biol Chem. 285, 41432-41442.

  42. Martin, D., Galisteo, R., and Gutkind, J. S. (2009) CXCL8/IL8 Stimulates Vascular Endothelial Growth Factor (VEGF) Expression and the Autocrine Activation of VEGFR2 in Endothelial Cells by Activating NFkappaB through the CBM (Carma3/Bcl10/Malt1) Complex. J Biol Chem. 284, 6038-6042.

  43. Rehman, A. O., and Wang, C. Y. (2009) CXCL12/SDF-1 Alpha Activates NF-kappaB and Promotes Oral Cancer Invasion through the Carma3/Bcl10/Malt1 Complex. Int J Oral Sci. 1, 105-118.

  44. Mahanivong, C., Chen, H. M., Yee, S. W., Pan, Z. K., Dong, Z., and Huang, S. (2008) Protein Kinase C Alpha-CARMA3 Signaling Axis Links Ras to NF-Kappa B for Lysophosphatidic Acid-Induced Urokinase Plasminogen Activator Expression in Ovarian Cancer Cells. Oncogene. 27, 1273-1280.

  45. Turvey, S. E., Durandy, A., Fischer, A., Fung, S. Y., Geha, R. S., Gewies, A., Giese, T., Greil, J., Keller, B., McKinnon, M. L., Neven, B., Rozmus, J., Ruland, J., Snow, A. L., Stepensky, P., and Warnatz, K. (2014) The CARD11-BCL10-MALT1 (CBM) Signalosome Complex: Stepping into the Limelight of Human Primary Immunodeficiency. J Allergy Clin Immunol. 134, 276-284.

  46. Rebeaud, F., Hailfinger, S., Posevitz-Fejfar, A., Tapernoux, M., Moser, R., Rueda, D., Gaide, O., Guzzardi, M., Iancu, E. M., Rufer, N., Fasel, N., and Thome, M. (2008) The Proteolytic Activity of the Paracaspase MALT1 is Key in T Cell Activation. Nat Immunol. 9, 272-281.

  47. Coornaert, B., Baens, M., Heyninck, K., Bekaert, T., Haegman, M., Staal, J., Sun, L., Chen, Z. J., Marynen, P., and Beyaert, R. (2008) T Cell Antigen Receptor Stimulation Induces MALT1 Paracaspase-Mediated Cleavage of the NF-kappaB Inhibitor A20. Nat Immunol. 9, 263-271.

  48. Staal, J., Driege, Y., Bekaert, T., Demeyer, A., Muyllaert, D., Van Damme, P., Gevaert, K., and Beyaert, R. (2011) T-Cell Receptor-Induced JNK Activation Requires Proteolytic Inactivation of CYLD by MALT1. EMBO J. 30, 1742-1752.

  49. Hailfinger, S., Nogai, H., Pelzer, C., Jaworski, M., Cabalzar, K., Charton, J. E., Guzzardi, M., Decaillet, C., Grau, M., Dorken, B., Lenz, P., Lenz, G., and Thome, M. (2011) Malt1-Dependent RelB Cleavage Promotes Canonical NF-kappaB Activation in Lymphocytes and Lymphoma Cell Lines. Proc Natl Acad Sci U S A. 108, 14596-14601.

  50. Uehata, T., Iwasaki, H., Vandenbon, A., Matsushita, K., Hernandez-Cuellar, E., Kuniyoshi, K., Satoh, T., Mino, T., Suzuki, Y., Standley, D. M., Tsujimura, T., Rakugi, H., Isaka, Y., Takeuchi, O., and Akira, S. (2013) Malt1-Induced Cleavage of Regnase-1 in CD4(+) Helper T Cells Regulates Immune Activation. Cell. 153, 1036-1049.

  51. Kirchhofer, D., and Vucic, D. (2012) Protease Activity of MALT1: A Mystery Unravelled. Biochem J. 444, e3-5.

  52. Rosebeck, S., Madden, L., Jin, X., Gu, S., Apel, I. J., Appert, A., Hamoudi, R. A., Noels, H., Sagaert, X., Van Loo, P., Baens, M., Du, M. Q., Lucas, P. C., and McAllister-Lucas, L. M. (2011) Cleavage of NIK by the API2-MALT1 Fusion Oncoprotein Leads to Noncanonical NF-kappaB Activation. Science. 331, 468-472.

  53. Jeltsch, K. M., Hu, D., Brenner, S., Zoller, J., Heinz, G. A., Nagel, D., Vogel, K. U., Rehage, N., Warth, S. C., Edelmann, S. L., Gloury, R., Martin, N., Lohs, C., Lech, M., Stehklein, J. E., Geerlof, A., Kremmer, E., Weber, A., Anders, H. J., Schmitz, I., Schmidt-Supprian, M., Fu, M., Holtmann, H., Krappmann, D., Ruland, J., Kallies, A., Heikenwalder, M., and Heissmeyer, V. (2014) Cleavage of Roquin and Regnase-1 by the Paracaspase MALT1 Releases their Cooperatively Repressed Targets to Promote T(H)17 Differentiation. Nat Immunol. 15, 1079-1089.

  54. Jost, P. J., Weiss, S., Ferch, U., Gross, O., Mak, T. W., Peschel, C., and Ruland, J. (2007) Bcl10/Malt1 Signaling is Essential for TCR-Induced NF-kappaB Activation in Thymocytes but Dispensable for Positive Or Negative Selection. J Immunol. 178, 953-960.

  55. Ferch, U., zum Buschenfelde, C. M., Gewies, A., Wegener, E., Rauser, S., Peschel, C., Krappmann, D., and Ruland, J. (2007) MALT1 Directs B Cell Receptor-Induced Canonical Nuclear Factor-kappaB Signaling Selectively to the c-Rel Subunit. Nat Immunol. 8, 984-991.

  56. Ott, G., Katzenberger, T., Greiner, A., Kalla, J., Rosenwald, A., Heinrich, U., Ott, M. M., and Muller-Hermelink, H. K. (1997) The t(11;18)(q21;q21) Chromosome Translocation is a Frequent and Specific Aberration in Low-Grade but Not High-Grade Malignant Non-Hodgkin's Lymphomas of the Mucosa-Associated Lymphoid Tissue (MALT-) Type. Cancer Res. 57, 3944-3948.

  57. Dierlamm, J., Baens, M., Wlodarska, I., Stefanova-Ouzounova, M., Hernandez, J. M., Hossfeld, D. K., De Wolf-Peeters, C., Hagemeijer, A., Van den Berghe, H., and Marynen, P. (1999) The Apoptosis Inhibitor Gene API2 and a Novel 18q Gene, MLT, are Recurrently Rearranged in the t(11;18)(q21;q21) Associated with Mucosa-Associated Lymphoid Tissue Lymphomas. Blood. 93, 3601-3609.

  58. Rosebeck, S., Rehman, A. O., Lucas, P. C., and McAllister-Lucas, L. M. (2011) From MALT Lymphoma to the CBM Signalosome: Three Decades of Discovery. Cell Cycle. 10, 2485-2496.

  59. Morgan, J. A., Yin, Y., Borowsky, A. D., Kuo, F., Nourmand, N., Koontz, J. I., Reynolds, C., Soreng, L., Griffin, C. A., Graeme-Cook, F., Harris, N. L., Weisenburger, D., Pinkus, G. S., Fletcher, J. A., and Sklar, J. (1999) Breakpoints of the t(11;18)(q21;q21) in Mucosa-Associated Lymphoid Tissue (MALT) Lymphoma Lie within Or Near the Previously Undescribed Gene MALT1 in Chromosome 18. Cancer Res. 59, 6205-6213.

  60. McKinnon, M. L., Rozmus, J., Fung, S. Y., Hirschfeld, A. F., Del Bel, K. L., Thomas, L., Marr, N., Martin, S. D., Marwaha, A. K., Priatel, J. J., Tan, R., Senger, C., Tsang, A., Prendiville, J., Junker, A. K., Seear, M., Schultz, K. R., Sly, L. M., Holt, R. A., Patel, M. S., Friedman, J. M., and Turvey, S. E. (2014) Combined Immunodeficiency Associated with Homozygous MALT1 Mutations. J Allergy Clin Immunol. 133, 1458-62, 1462.e1-7.

  61. Jabara, H. H., Ohsumi, T., Chou, J., Massaad, M. J., Benson, H., Megarbane, A., Chouery, E., Mikhael, R., Gorka, O., Gewies, A., Portales, P., Nakayama, T., Hosokawa, H., Revy, P., Herrod, H., Le Deist, F., Lefranc, G., Ruland, J., and Geha, R. S. (2013) A Homozygous Mucosa-Associated Lymphoid Tissue 1 (MALT1) Mutation in a Family with Combined Immunodeficiency. J Allergy Clin Immunol. 132, 151-158.

  62. Sanchez-Izquierdo, D., Buchonnet, G., Siebert, R., Gascoyne, R. D., Climent, J., Karran, L., Marin, M., Blesa, D., Horsman, D., Rosenwald, A., Staudt, L. M., Albertson, D. G., Du, M. Q., Ye, H., Marynen, P., Garcia-Conde, J., Pinkel, D., Dyer, M. J., and Martinez-Climent, J. A. (2003) MALT1 is Deregulated by both Chromosomal Translocation and Amplification in B-Cell Non-Hodgkin Lymphoma. Blood. 101, 4539-4546.