Phenotypic Mutation 'prime'

• Allele: prime
• Mutation Type: nonsense
• Chromosome: 10
• Coordinate: 61,139,501 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Prf1
• Gene Name: perforin 1 (pore forming protein)
• Synonym(s): Pfp, Pfn, perforin, Prf-1
• Chromosomal Location: 61,133,612-61,140,459 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has structural and functional similarities to complement component 9 (C9). Like C9, this protein creates transmembrane tubules and is capable of lysing non-specifically a variety of target cells. This protein is one of the main cytolytic proteins of cytolytic granules, and it is known to be a key effector molecule for T-cell- and natural killer-cell-mediated cytolysis. Defects in this gene cause familial hemophagocytic lymphohistiocytosis type 2 (HPLH2), a rare and lethal autosomal recessive disorder of early childhood. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous null mice exhibit increased susceptibility to viral infection and defective cytotoxic T cell cytolysis and NK cell cytolysis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000041483] [ENSMUSP00000151354]
• AlphaFold: P10820
• PDB Structure: The X-ray crystal structure of lymphocyte perforin [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000041483; Gene: ENSMUSG00000037202; AA Change: Y486*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MACPF	165	368	1.84e-80	SMART
C2	415	516	1.59e-9	SMART

• Predicted Effect: probably null
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2016-05-13 3:09 PM by Anne Murray
• Record Created: 2014-09-08 6:45 PM by Duanwu Zhang
• Record Posted: 2015-01-13
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Duanwu Zhang, Tao Yue, Bruce Beutler

Accession Number

Ncbi RefSeq: NM_011073; MGI: 97551

Alleles Listed at MGI

All mutations/alleles(7) : Targeted(7)

Repository

MMRRC:37599

Phenotypic Description

Figure 1. Prime mice exhibited susceptibility to MCMV infection. MCMV viral titers were measured in the spleen. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The prime phenotype was identified among G3 mice of the pedigree R0594, some of which showed increased viral titer in the spleen five days after infection with a sublethal dose (1.5 x 10^e5 PFU/20 g of body weight) of mouse cytomegalovirus (MCMV; Figure 1). In addition, one mouse died at four days post-infection, while three others were sick at five days post-infection.

Nature of Mutation

Figure 2. Linkage mapping of the MCMV viral titer in the spleen using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted versus the chromosomal positions of 117 mutations (X-axis) identified in the G1 male of pedigree R0594. Normalized phenotype data were used for single locus linkage analysis without consideration for G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and P = 7.143 x 10 -4 for Bonferroni significance, respectively

Whole exome HiSeq sequencing of the G1 grandsire identified 117 mutations.  The increased MCMV titer in the spleen was linked by continuous variable mapping to a mutation in Prf1:  a C to A transversion at base pair 61,303,722  (v38) on chromosome 10, or base pair 6,045 in the GenBank genomic region NC_000076.  Linkage was found with a recessive model of inheritance (P =  8.681 x 10^-6), wherein one variant homozygote departed phenotypically from 11 homozygous reference mice and eight heterozygous mice (Figure 2).  A slight semidominant effect was observed in the assay, but the mutation is preponderantly recessive.  The mutation corresponds to residue 1,513 in the mRNA sequence NM_011073 within exon 3 of 3 total exons.

1496 GTCTGGGATGCCGACTACGGCTGGGATGATGAC

481  -V--W--D--A--D--Y--G--W--D--D--D-

The mutated nucleotide is indicated in red.  The mutation results in substitution of a premature stop codon for a tyrosine at residue 486 (Y486*).

Protein Prediction

Figure 3. Protein domains of perforin. The prime mutation (Y486*) is shown. Abbreviations: SP, signal peptide; MACPF, perforin membrane attack complex/perforin; EGF; epidermal growth factor-like; CTR; C-terminal domain. See the text for more details.

Figure 4. Crystal structure of mouse perforin. Amino acids 21-554 shown. Domains in the figure are colored similar to those in Figure 3. See the text for more details. Figure generated by Chimera and is based on PDB:3NSJ and (5).

Prf1 encodes perforin, a highly conserved component of cytotoxic T lymphocyte (CTL) and natural killer (NK) cell secretory granules. A cleavable N-terminal signal peptide (amino acids 1-20) recruits perforin to the secretory pathway [Figure 3; reviewed in (1)]. The perforin membrane attack complex/perforin (MACPF) domain (amino acids 165-368) has significant sequence similarity with that in C9, a component of the complement complex. The regions N- and C-terminal to the MACPF domain are unique to perforin and are highly conserved [reviewed in (1)]. The MACPF domain inserts into the lipid bilayer after membrane attachment (2). Once bound to the membrane of a target cell, perforin oligomerizes and two membrane-spanning regions (TMH1 and TMH2) within the MACPF domain penetrate the membrane, facilitating the delivery of pro-apoptotic granzymes through the perforin pore from granules into the target cell (see the “Background” section for more details) (2;3;4). The perforin pore contains 20-22 perforin proteins that each contributes two β-hairpins to form a membrane-spanning β-barrel (5). Arg213 is essential for the interaction of the perforin monomers and mutation of Arg213 to aspartic acid (R213E) disrupted perforin oligomerization and cytotoxicity, but did not effect perforin folding or membrane binding (6).

The MACPF, epidermal growth factor (EGF)-like domain (amino acids 375-407), and the extreme C-terminal sequence of perforin form a central shelf-like structure [Figure 4; PDB:3NSJ; (5)]. The MACPF domain is a four-stranded β-sheet flanked by two clusters of α-helices (CH1 and CH2) (5). CH1 is loosely held between the central sheet, the C-terminal α-helix of the MACPF domain, and the EGF-like fold (5). A disulfide bond is formed between C407 in the EGF-like domain and C241 within the first helix of CH2 to stabilize the structure (5). A type II C2 domain (amino acids 415-516) hangs beneath the shelf-like structure formed by the MACPF and EGF-like domains (5). The perforin C2 domain binds lipids in a calcium-dependent manner and is required for the calcium-dependent membrane interaction of perforin with target cells, the first step in the lysis activity of perforin at the membrane (7;8). The C2 domain is comprised of eight β-strands assembled into a β-sandwich [reviewed in (9)]. Both the N- and C-termini of the perforin C2 domain are located near the membrane binding face [(7;10); reviewed in (9)]. The low pH of perforin-containing granules is proposed to interfere with calcium binding activity to prevent aberrant perforin activity prior to degranulation and perforin release [reviewed in (9)]. Coordination of calcium with the C2 domain induces conformational changes that stabilizes perforin and facilitates perforin interaction with the plasma membrane as well as the positioning of perforin so that it favors pore formation (4).

The membrane-binding face of perforin is formed by three calcium-binding regions (CBRs) along with up to four calcium atoms [(5;7); reviewed in (9)]. Aspartates 429, 435, 483, and 485 (numbering in human perforin) are essential for calcium-dependent plasma membrane binding to the target cell; Asp491 is predicted to also contribute in a limited fashion [(5;7); reviewed in (9)]. Mutation of D483 to alanine (D483A) resulted in loss of perforin cytolytic activity, but not a change in protein stability or granule localization (7). Trp427 and Tyr430 (within CBR1) as well as Tyr486 and Trp488 (with CBR3) are conserved and predicted to also function in plasma membrane contact and binding (5). In response to calcium binding at Asp429, Trp427/Tyr430 are repositioned to face the membrane [PDB:3W57; (4)]. Mutation of all four of the residues to alanines or serines (W427A/Y430A/Y486A/W488A or W427S/Y430S/Y486S/W488S, respectively) led to complete loss of function, confirming that perforin activity is dependent on the presence of exposed aromatic side chains at the tip of the C2 domain; protein folding, stability, localization were not affected (4). Mutation of a single aromatic residue within the four (either Y430A/Y486A/W488A mutant, a W427A/Y486A/W488A mutant, or a W427A/Y430A/Y486A mutant) determined that the presence of Trp427, Tyr430, or Trp488 alone (respectively) permitted ~10% of wild-type perforin activity; expression of a W427A/Y430A/W488A mutant determined that Tyr486 only rescued ~1% of the activity, indicating that this residue is not as essential for perforin function as the other three aromatic residues (4). Furthermore, intact hydrophobic residues in either the CBR1 or CBR3 are equally important: W427A/Y430A and Y486/W488A had a ~50% reduction in activity compared to wild-type perforin (4). Mutation of individual residues (i.e., W427A, Y430A, Y486A or W488A) did not alter wild-type perforin activity indicating that maintenance of a pair of residues with CBR1 or CBR3 was essential for function (4). The W427A/Y430A/Y486A/W488A, W427A/Y430A, and Y486A/W488A mutants did not exhibit changes in calcium binding, but exhibited less activity than wild-type perforin and bound inefficiently to membranes (4). The CBR1 mutant (W427A/Y430A) had ~4-fold less activity and bound less efficiently to the plasma membrane than the CBR3 mutant (Y486A/W488A).

The C-terminus of perforin (amino acids 517-554) is conserved in mammals (11). The C-terminus is not required for perforin lytic activity, but targeting motifs within the perforin C-terminus are essential for the trafficking of perforin from the endoplasmic reticulum (ER) to the Golgi and subsequently into acidic secretory vesicles (11). Once perforin reaches the secretory granule, the C-terminus is cleaved (12); the protease(s) responsible for perforin cleavage as well as the exact site of cleavage have not been determined. The cleavage of the C-terminus (and the removal of the glycan at Asn548) is proposed to facilitate the activation of perforin by unblocking the C2 domain [reviewed in (1)]. Trp554 (Trp555 in humans) regulates the export of perforin from the ER (11). Delay of perforin export from the ER results in death of the host cell (11).

The prime mutation is within the C2 domain and would result in the loss of a significant portion of the C2 domain as well as the C-terminus. Expression and localization of perforin^prime has not been examined.

Expression/Localization

Perforin is stored in secretory vesicles of CTLs and NK cells [(2;13-15); reviewed in (16)].

Background

Figure 5. The perforin-granzyme pathway. Perforin is stored in cytotoxic granules with granzymes within cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells. Upon recognition of a target cell, the granules are released and perforin inserts into the target cell membrane, polymerizes and forms a channel. The perforin pore allows granzymes to enter the target cell and induce apoptosis through Bid and the mitochondrial cell-death pathway (cytochrome-c, APAF1, and caspase-9) as well as through the activation of effector caspases (e.g., pro-caspase-3). Truncated BID (tBID) disrupts the outer mitochondrial membrane (OMM) to cause release of the pro-apoptotic factor cytochrome c, which binds to APAF1. APAF1 recruits pro-caspase-9 to form the apoptosome where caspase-9 is autocatalytically activated and in turn can proteolytically activate caspase-3. Granzyme B also directly cleaves ICAD (inhibitor of CAD) to free CAD (caspase-activated DNase) to cause DNA fragmentation.

CTLs and NK cells recognize virus-infected cells and transformed cells and subsequently promote apoptosis through either a perforin-dependent (Figure 5) or a death receptor [e.g., Fas/CD95 (see the record for cherry), tumor necrosis factor (TNF; see the record for PanR1), and TNF-related apoptosis inducing ligand (TRAIL; alternatively, TNFSF10)]-dependent pathway [reviewed in (9)]. The death-receptor pathways are triggered by ligation of their cognate ligands. During perforin-dependent cytotoxicity, CTLs and NK cells regulate exocytosis of toxic effector molecules and their subsequent delivery to a target cell [reviewed in (17)]. Both the Fas and cytolytic granule pathways mediate activation-induced cell death (AICD) (18;19).

CTLs express cell surface T cell receptors that, upon activation, recognize antigen-presenting class I major histocompatibility complexes (MHC I), while activating and inhibitory receptors on the NK cell initiate signaling in response to target cell-bound ligands [reviewed in (9;17)]. CTL and NK cell signaling recruits secretory granules to the presynaptic membrane (20). The secretory granules store proteases and membrane proteins that are also common to lysosomes (21). Secretory granules are distinguished from lysosomes in that granules contain perforin monomers, other membrane-disrupting agents, chemokines, lysosomal proteins (e.g., lysosomal-associated membrane proteins (LAMP)-1, LAMP-2, CD63, and cathepsins C, D and L), structural elements (e.g., chondroitin sulfate proteoglycans) that form a lattice to which toxins can attach, and granule serine proteases (i.e., granzymes) that recognize cytosolic substrates that, upon cleavage, can trigger apoptosis, regulate the inflammatory response, or impair viral replication [(15;22); reviewed in (1)].

After stable conjugation of the CTL or NK cell with target cells (i.e., formation of an immune synapsis), the granules are recruited, tether, dock, and fuse with the presynaptic plasma membrane and release their cargo into the synaptic cleft between the CTL/NK cell and the target cell [Figure 5; (11;23)]. The neutral pH and high extracellular calcium present in the immune synapse induces perforin binding to phospholipid membrane of the target cell, its oligomerization, and conformational rearrangement into transmembrane pores, subsequently allowing the entry of granzymes into the target cell (1;7;23;24). The formation of perforin pores has been proposed to act as the entryway for granzyme cytosolic entry, either at the plasma membrane or after endocytosis (5;25;26). Perforin can form both a cylindrical pore that is lined exclusively by protein, and a toroidal pore (alternatively, a proteolipid, lipid, or ‘leaky slit’ pore) that consists of inserted peptides and lipid together forming a water channel (27). The formation of the toroidal pore promotes transbilayer curvature leading to a merger of the inner and outer leaflets (27). The fusion and the toroidal pore subsequently promote rapid phosphatidylserine translocation in target cells without perturbation to the plasma membrane (27). Metkar et al. propose that the arcs allow protected delivery of granzymes while the cylinders modulate plasma membrane homeostasis by membrane repair (27). Cylindrical pores may drive endocytosis and encourage uptake of arcs and translocation of granzyme B (27). Target cell permeabilization by perforin mediates rapid diffusion of granzymes into the target cells, limiting granzyme diffusion and providing evidence that the diffusion model is the likely mechanism by which granzymes are delivered via perforin pores (24). Granzyme B cleaves target cell proteins at sites following certain aspartate residues, subsequently inducing caspase-dependent apoptosis; granzyme A cleaves at sites following basic residues and does not require caspases to induce target cell death [reviewed in (1)]. Inhibitory serpins (e.g., SPI-6, PI-9, or SPI-CI) within the killer cell as well as expressed by bystander cells (e.g., antigen presenting cells) regulate aberrant granzyme function (28;29).  Plasma lipids rapidly inhibit perforin that diffuses away from the synaptic cleft, preventing granzymes from aberrant activity at non-target cells [reviewed in (17)].

Mutations in PRF1 are linked to familial hemophagocytic lymphohistiocytosis 2 (FHL2; OMIM: #603553) (30-33) and non-Hodgkin lymphoma (OMIM: #605027) (30;31). FHL2 is an autosomal recessive condition in which CTL/NK cell function is decreased (or absent) [reviewed in (9)]. As a result, CD4⁺ and CD8⁺ T cell activation and proliferation are uncontrolled, leading to secretion of high levels of IFN-γ. Patients exhibit IFN-γ-induced macrophage activation and proliferation, and the overproduction of pro-inflammatory cytokines, leading to fever and listlessness [(34); reviewed in (9)]. Increased activation of macrophages in the spleen and bone marrow result in increased phagocytosis of erythrocytes, leukocytes, and platelets from the circulation leading to pancytopenia (i.e., reduction in the number of red and white blood cells as well as platelets) and anemia [reviewed in (9)]. Symptoms of FHL2 can develop immediately after birth and in the absence of any known infectious agents, indicating that common environmental commensal microorganism may trigger the pancytopenia and fever [reviewed in (9)]. Over 70% of 200 FHL2 patients with PRF1 mutations had two bi-allelic nonsense and/or frame-shift mutations that led to protein truncation [reviewed in (9)]. A Trp384* mutation is commonly observed and results in truncation of perforin and the loss of the C2 domain. As a result, the patients have early (by 6 months of age), aggressive onset of the disease and require a heterologous bone marrow reconstitution to survive (1). Patients with at least one mutant (missense) PRF1 allele present with variable FHL2 symptoms due to unfolding and/or faulty trafficking of perforin (1;35). Patients with bi-allelic missense PRF1 mutations often present with cancers of hematologic origins (e.g., leukemia or lymphoma); the alleles were almost all inactive (36). A common polymorphism, C272T, results in an alanine to valine substitution at amino acid 91 (A91V) (35;37). A link between A91V and late presentation of FHL2 has been observed (38;39). In addition, A91V predisposes individuals to T- and B-cell lymphoma (31) and childhood acute lymphoblastic leukemia (ALL) (40). Another study did not find a statistically significant link between A91V and ALL (41). A91V has been linked to Dianzani autoimmune lymphoproliferative disease, a syndrome that has similar clinical features to FHL2 (42).

Putative Mechanism

Perforin-deficient (Prf1^-/-) mice have normal numbers of CD8⁺ T cells and NK cells, exhibit normal activation and granzyme A secretion from cytolytic T cells, but lose their CTL killing function (3;43;44). As a result, they are unable to clear many viral infections [e.g., LCMV], they exhibit a decreased ability to clear bacterial infections, fail to reject transplanted tumors, are sensitive to chemically-induced carcinogenesis, are more sensitive to the initiation of epithelial cancer, and develop spontaneous B-cell lymphomas with age [(3;23;43;45;46); reviewed in (1;9)]. In chronic LCMV infection, Prf1^-/- mice exhibit high levels of infectious virus and viral antigen in several tissues as well as splenomegaly and lymphadenopathy (44;46;47). The accumulation of activated CD8⁺ T cells in the Prf1^-/- mice resulted in immune-mediated damage in the infected Prf1^-/- mice and death in ~50% of the mice within 2-4 weeks; mortality was reversed by depleting CD8⁺ T cells (47). Dendritic cells (DCs) in the Prf1^-/- mice were approximately 3-fold more potent at promoting cytokine production upon exposure to stimulated LCMV-specific T cells (48). Terrell et al. determined that there was a negative feedback loop between expanding CD8⁺ CTLs and antigen-presenting DCs, preventing pathological T cell activation in Prf1^-/- mice after LCMV infection (48). Antigen presentation by the DCs persisted in the Prf1^-/- mice and continued to drive T cell activation after initial priming (48). Transfer of Prf1-expressing T cells reduced endogenous DC antigen presentation, indicating a reciprocal relationship between perforin in CD8⁺ T cells and DC function (48). The prime mice exhibit susceptibility to MCMV infection indicating that they are unable to clear viral infections similar to the Prf1^-/- mice, indicating that perforin^prime exhibits loss of function.

Primers

PCR Primer
prime_pcr_F: GGCCCATTTGGTGGTAAGCAATTTC
prime_pcr_R: TGCATAGTAAGCCATTGCAGATCCC

Sequencing Primer
prime_seq_F: ATCTGTGGGGAGACTACACC
prime_seq_R: tccacctgtctctgcctc

Genotyping

Prime genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Prime (F): 5’- GGCCCATTTGGTGGTAAGCAATTTC-3’

Prime (R): 5’- TGCATAGTAAGCCATTGCAGATCCC-3’

Sequencing Primer

Prime (F): 5’- ATCTGTGGGGAGACTACACC-3’
 

Prime (R): 5’- tccacctgtctctgcctc-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 629 nucleotides is amplified (Chr.10: 61303503-61304131, GRCm38; NC_000076):

ggcccatttg gtggtaagca atttccgggc agaacatctg tggggagact acaccacagc

tactgatgcc tacctaaagg tcttctttgg tggccaggag ttcaggaccg gtgtcgtgtg

gaacaataac aatccccggt ggactgacaa gatggacttt gagaatgtgc tcctgtccac

agggggaccc ctcagggtgc aggtctggga tgccgactac ggctgggatg atgaccttct

tggttcttgt gacaggtctc cccactctgg tttccatgag gtgacatgtg agctaaacca

cggcagggtg aaattctcct accatgccaa gtgtctgccc catctcactg gagggacctg

cctggagtat gccccccagg ggcttctggg agatcctcca ggaaaccgca gtggggctgt

gtggtaacat aataacaaca ataacatgcc tgagagctgg gtgtagtagc acacgccttt

aatcccagca tttgggaggc agagacaggt ggatatctat gagttcgagg ccagcctggg

tctacagggt ctcaaaaaaa aaaagcaaac aacaaaactg gaatgttcaa ctggcttctc

cctggggatc tgcaatggct tactatgca

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide (C) is shown in red text (C>A).

References

  1. Voskoboinik, I., Smyth, M. J., and Trapani, J. A. (2006) Perforin-Mediated Target-Cell Death and Immune Homeostasis. Nat Rev Immunol. 6, 940-952.

  2. Lichtenheld, M. G., Olsen, K. J., Lu, P., Lowrey, D. M., Hameed, A., Hengartner, H., and Podack, E. R. (1988) Structure and Function of Human Perforin. Nature. 335, 448-451.

  3. Kagi, D., Ledermann, B., Burki, K., Seiler, P., Odermatt, B., Olsen, K. J., Podack, E. R., Zinkernagel, R. M., and Hengartner, H. (1994) Cytotoxicity Mediated by T Cells and Natural Killer Cells is Greatly Impaired in Perforin-Deficient Mice. Nature. 369, 31-37.

  4. Traore, D. A., Brennan, A. J., Law, R. H., Dogovski, C., Perugini, M. A., Lukoyanova, N., Leung, E. W., Norton, R. S., Lopez, J. A., Browne, K. A., Yagita, H., Lloyd, G. J., Ciccone, A., Verschoor, S., Trapani, J. A., Whisstock, J. C., and Voskoboinik, I. (2013) Defining the Interaction of Perforin with Calcium and the Phospholipid Membrane. Biochem J. 456, 323-335.

  5. Law, R. H., Lukoyanova, N., Voskoboinik, I., Caradoc-Davies, T. T., Baran, K., Dunstone, M. A., D'Angelo, M. E., Orlova, E. V., Coulibaly, F., Verschoor, S., Browne, K. A., Ciccone, A., Kuiper, M. J., Bird, P. I., Trapani, J. A., Saibil, H. R., and Whisstock, J. C. (2010) The Structural Basis for Membrane Binding and Pore Formation by Lymphocyte Perforin. Nature. 468, 447-451.

  6. Baran, K., Dunstone, M., Chia, J., Ciccone, A., Browne, K. A., Clarke, C. J., Lukoyanova, N., Saibil, H., Whisstock, J. C., Voskoboinik, I., and Trapani, J. A. (2009) The Molecular Basis for Perforin Oligomerization and Transmembrane Pore Assembly. Immunity. 30, 684-695.

  7. Voskoboinik, I., Thia, M. C., Fletcher, J., Ciccone, A., Browne, K., Smyth, M. J., and Trapani, J. A. (2005) Calcium-Dependent Plasma Membrane Binding and Cell Lysis by Perforin are Mediated through its C2 Domain: A Critical Role for Aspartate Residues 429, 435, 483, and 485 but Not 491. J Biol Chem. 280, 8426-8434.

  8. Ponting, C. P., and Parker, P. J. (1996) Extending the C2 Domain Family: C2s in PKCs Delta, Epsilon, Eta, Theta, Phospholipases, GAPs, and Perforin. Protein Sci. 5, 162-166.

  9. Voskoboinik, I., Dunstone, M. A., Baran, K., Whisstock, J. C., and Trapani, J. A. (2010) Perforin: Structure, Function, and Role in Human Immunopathology. Immunol Rev. 235, 35-54.

  10. Urrea Moreno, R., Gil, J., Rodriguez-Sainz, C., Cela, E., LaFay, V., Oloizia, B., Herr, A. B., Sumegi, J., Jordan, M. B., and Risma, K. A. (2009) Functional Assessment of Perforin C2 Domain Mutations Illustrates the Critical Role for Calcium-Dependent Lipid Binding in Perforin Cytotoxic Function. Blood. 113, 338-346.

  11. Brennan, A. J., Chia, J., Browne, K. A., Ciccone, A., Ellis, S., Lopez, J. A., Susanto, O., Verschoor, S., Yagita, H., Whisstock, J. C., Trapani, J. A., and Voskoboinik, I. (2011) Protection from Endogenous Perforin: Glycans and the C Terminus Regulate Exocytic Trafficking in Cytotoxic Lymphocytes. Immunity. 34, 879-892.

  12. Uellner, R., Zvelebil, M. J., Hopkins, J., Jones, J., MacDougall, L. K., Morgan, B. P., Podack, E., Waterfield, M. D., and Griffiths, G. M. (1997) Perforin is Activated by a Proteolytic Cleavage during Biosynthesis which Reveals a Phospholipid-Binding C2 Domain. EMBO J. 16, 7287-7296.

  13. Ojcius, D. M., Zheng, L. M., Sphicas, E. C., Zychlinsky, A., and Young, J. D. (1991) Subcellular Localization of Perforin and Serine Esterase in Lymphokine-Activated Killer Cells and Cytotoxic T Cells by Immunogold Labeling. J Immunol. 146, 4427-4432.

  14. Lowrey, D. M., Aebischer, T., Olsen, K., Lichtenheld, M., Rupp, F., Hengartner, H., and Podack, E. R. (1989) Cloning, Analysis, and Expression of Murine Perforin 1 cDNA, a Component of Cytolytic T-Cell Granules with Homology to Complement Component C9. Proc Natl Acad Sci U S A. 86, 247-251.

  15. Peters, P. J., Borst, J., Oorschot, V., Fukuda, M., Krahenbuhl, O., Tschopp, J., Slot, J. W., and Geuze, H. J. (1991) Cytotoxic T Lymphocyte Granules are Secretory Lysosomes, Containing both Perforin and Granzymes. J Exp Med. 173, 1099-1109.

  16. Voskoboinik, I., and Trapani, J. A. (2013) Perforinopathy: A Spectrum of Human Immune Disease Caused by Defective Perforin Delivery Or Function. Front Immunol. 4, 441.

  17. Lopez, J. A., Brennan, A. J., Whisstock, J. C., Voskoboinik, I., and Trapani, J. A. (2012) Protecting a Serial Killer: Pathways for Perforin Trafficking and Self-Defence Ensure Sequential Target Cell Death. Trends Immunol. 33, 406-412.

  18. Mateo, V., Menager, M., de Saint-Basile, G., Stolzenberg, M. C., Roquelaure, B., Andre, N., Florkin, B., le Deist, F., Picard, C., Fischer, A., and Rieux-Laucat, F. (2007) Perforin-Dependent Apoptosis Functionally Compensates Fas Deficiency in Activation-Induced Cell Death of Human T Lymphocytes. Blood. 110, 4285-4292.

  19. Spaner, D., Raju, K., Radvanyi, L., Lin, Y., and Miller, R. G. (1998) A Role for Perforin in Activation-Induced Cell Death. J Immunol. 160, 2655-2664.

  20. Stinchcombe, J. C., and Griffiths, G. M. (2007) Secretory Mechanisms in Cell-Mediated Cytotoxicity. Annu Rev Cell Dev Biol. 23, 495-517.

  21. Bird, P. I., Trapani, J. A., and Villadangos, J. A. (2009) Endolysosomal Proteases and their Inhibitors in Immunity. Nat Rev Immunol. 9, 871-882.

  22. Bagshaw, R. D., Mahuran, D. J., and Callahan, J. W. (2005) A Proteomic Analysis of Lysosomal Integral Membrane Proteins Reveals the Diverse Composition of the Organelle. Mol Cell Proteomics. 4, 133-143.

  23. Trapani, J. A., and Smyth, M. J. (2002) Functional Significance of the perforin/granzyme Cell Death Pathway. Nat Rev Immunol. 2, 735-747.

  24. Lopez, J. A., Susanto, O., Jenkins, M. R., Lukoyanova, N., Sutton, V. R., Law, R. H., Johnston, A., Bird, C. H., Bird, P. I., Whisstock, J. C., Trapani, J. A., Saibil, H. R., and Voskoboinik, I. (2013) Perforin Forms Transient Pores on the Target Cell Plasma Membrane to Facilitate Rapid Access of Granzymes during Killer Cell Attack. Blood. 121, 2659-2668.

  25. Keefe, D., Shi, L., Feske, S., Massol, R., Navarro, F., Kirchhausen, T., and Lieberman, J. (2005) Perforin Triggers a Plasma Membrane-Repair Response that Facilitates CTL Induction of Apoptosis. Immunity. 23, 249-262.

  26. Praper, T., Sonnen, A. F., Kladnik, A., Andrighetti, A. O., Viero, G., Morris, K. J., Volpi, E., Lunelli, L., Dalla Serra, M., Froelich, C. J., Gilbert, R. J., and Anderluh, G. (2011) Perforin Activity at Membranes Leads to Invaginations and Vesicle Formation. Proc Natl Acad Sci U S A. 108, 21016-21021.

  27. Metkar, S. S., Marchioretto, M., Antonini, V., Lunelli, L., Wang, B., Gilbert, R. J., Anderluh, G., Roth, R., Pooga, M., Pardo, J., Heuser, J. E., Serra, M. D., and Froelich, C. J. (2014) Perforin Oligomers Form Arcs in Cellular Membranes: A Locus for Intracellular Delivery of Granzymes. Cell Death Differ. .

  28. Sun, J., Ooms, L., Bird, C. H., Sutton, V. R., Trapani, J. A., and Bird, P. I. (1997) A New Family of 10 Murine Ovalbumin Serpins Includes Two Homologs of Proteinase Inhibitor 8 and Two Homologs of the Granzyme B Inhibitor (Proteinase Inhibitor 9). J Biol Chem. 272, 15434-15441.

  29. Bird, C. H., Sutton, V. R., Sun, J., Hirst, C. E., Novak, A., Kumar, S., Trapani, J. A., and Bird, P. I. (1998) Selective Regulation of Apoptosis: The Cytotoxic Lymphocyte Serpin Proteinase Inhibitor 9 Protects Against Granzyme B-Mediated Apoptosis without Perturbing the Fas Cell Death Pathway. Mol Cell Biol. 18, 6387-6398.

  30. Clementi, R., Dagna, L., Dianzani, U., Dupre, L., Dianzani, I., Ponzoni, M., Cometa, A., Chiocchetti, A., Sabbadini, M. G., Rugarli, C., Ciceri, F., Maccario, R., Locatelli, F., Danesino, C., Ferrarini, M., and Bregni, M. (2004) Inherited Perforin and Fas Mutations in a Patient with Autoimmune Lymphoproliferative Syndrome and Lymphoma. N Engl J Med. 351, 1419-1424.

  31. Clementi, R., Locatelli, F., Dupre, L., Garaventa, A., Emmi, L., Bregni, M., Cefalo, G., Moretta, A., Danesino, C., Comis, M., Pession, A., Ramenghi, U., Maccario, R., Arico, M., and Roncarolo, M. G. (2005) A Proportion of Patients with Lymphoma may Harbor Mutations of the Perforin Gene. Blood. 105, 4424-4428.

  32. Goransdotter Ericson, K., Fadeel, B., Nilsson-Ardnor, S., Soderhall, C., Samuelsson, A., Janka, G., Schneider, M., Gurgey, A., Yalman, N., Revesz, T., Egeler, R., Jahnukainen, K., Storm-Mathiesen, I., Haraldsson, A., Poole, J., de Saint Basile, G., Nordenskjold, M., and Henter, J. (2001) Spectrum of Perforin Gene Mutations in Familial Hemophagocytic Lymphohistiocytosis. Am J Hum Genet. 68, 590-597.

  33. Stepp, S. E., Dufourcq-Lagelouse, R., Le Deist, F., Bhawan, S., Certain, S., Mathew, P. A., Henter, J. I., Bennett, M., Fischer, A., de Saint Basile, G., and Kumar, V. (1999) Perforin Gene Defects in Familial Hemophagocytic Lymphohistiocytosis. Science. 286, 1957-1959.

  34. Janka, G. E. (2007) Familial and Acquired Hemophagocytic Lymphohistiocytosis. Eur J Pediatr. 166, 95-109.

  35. Molleran Lee, S., Villanueva, J., Sumegi, J., Zhang, K., Kogawa, K., Davis, J., and Filipovich, A. H. (2004) Characterisation of Diverse PRF1 Mutations Leading to Decreased Natural Killer Cell Activity in North American Families with Haemophagocytic Lymphohistiocytosis. J Med Genet. 41, 137-144.

  36. Chia, J., Yeo, K. P., Whisstock, J. C., Dunstone, M. A., Trapani, J. A., and Voskoboinik, I. (2009) Temperature Sensitivity of Human Perforin Mutants Unmasks Subtotal Loss of Cytotoxicity, Delayed FHL, and a Predisposition to Cancer. Proc Natl Acad Sci U S A. 106, 9809-9814.

  37. Voskoboinik, I., Sutton, V. R., Ciccone, A., House, C. M., Chia, J., Darcy, P. K., Yagita, H., and Trapani, J. A. (2007) Perforin Activity and Immune Homeostasis: The Common A91V Polymorphism in Perforin Results in both Presynaptic and Postsynaptic Defects in Function. Blood. 110, 1184-1190.

  38. Clementi, R., Emmi, L., Maccario, R., Liotta, F., Moretta, L., Danesino, C., and Arico, M. (2002) Adult Onset and Atypical Presentation of Hemophagocytic Lymphohistiocytosis in Siblings Carrying PRF1 Mutations. Blood. 100, 2266-2267.

  39. Busiello, R., Adriani, M., Locatelli, F., Galgani, M., Fimiani, G., Clementi, R., Ursini, M. V., Racioppi, L., and Pignata, C. (2004) Atypical Features of Familial Hemophagocytic Lymphohistiocytosis. Blood. 103, 4610-4612.

  40. Santoro, A., Cannella, S., Trizzino, A., Lo Nigro, L., Corsello, G., and Arico, M. (2005) A Single Amino Acid Change A91V in Perforin: A Novel, Frequent Predisposing Factor to Childhood Acute Lymphoblastic Leukemia? Haematologica. 90, 697-698.

  41. Mehta, P. A., Davies, S. M., Kumar, A., Devidas, M., Lee, S., Zamzow, T., Elliott, J., Villanueva, J., Pullen, J., Zewge, Y., Filipovich, A., and Children's Oncology Group. (2006) Perforin Polymorphism A91V and Susceptibility to B-Precursor Childhood Acute Lymphoblastic Leukemia: A Report from the Children's Oncology Group. Leukemia. 20, 1539-1541.

  42. Clementi, R., Chiocchetti, A., Cappellano, G., Cerutti, E., Ferretti, M., Orilieri, E., Dianzani, I., Ferrarini, M., Bregni, M., Danesino, C., Bozzi, V., Putti, M. C., Cerutti, F., Cometa, A., Locatelli, F., Maccario, R., Ramenghi, U., and Dianzani, U. (2006) Variations of the Perforin Gene in Patients with autoimmunity/lymphoproliferation and Defective Fas Function. Blood. 108, 3079-3084.

  43. Lowin, B., Beermann, F., Schmidt, A., and Tschopp, J. (1994) A Null Mutation in the Perforin Gene Impairs Cytolytic T Lymphocyte- and Natural Killer Cell-Mediated Cytotoxicity. Proc Natl Acad Sci U S A. 91, 11571-11575.

  44. Lykens, J. E., Terrell, C. E., Zoller, E. E., Risma, K., and Jordan, M. B. (2011) Perforin is a Critical Physiologic Regulator of T-Cell Activation. Blood. 118, 618-626.

  45. Smyth, M. J., Thia, K. Y., Street, S. E., MacGregor, D., Godfrey, D. I., and Trapani, J. A. (2000) Perforin-Mediated Cytotoxicity is Critical for Surveillance of Spontaneous Lymphoma. J Exp Med. 192, 755-760.

  46. Walsh, C. M., Matloubian, M., Liu, C. C., Ueda, R., Kurahara, C. G., Christensen, J. L., Huang, M. T., Young, J. D., Ahmed, R., and Clark, W. R. (1994) Immune Function in Mice Lacking the Perforin Gene. Proc Natl Acad Sci U S A. 91, 10854-10858.

  47. Matloubian, M., Suresh, M., Glass, A., Galvan, M., Chow, K., Whitmire, J. K., Walsh, C. M., Clark, W. R., and Ahmed, R. (1999) A Role for Perforin in Downregulating T-Cell Responses during Chronic Viral Infection. J Virol. 73, 2527-2536.

  48. Terrell, C. E., and Jordan, M. B. (2013) Perforin Deficiency Impairs a Critical Immunoregulatory Loop Involving Murine CD8(+) T Cells and Dendritic Cells. Blood. 121, 5184-5191.