Phenotypic Mutation 'ernie' (pdf version)
List |< first << previous [record 14 of 74] next >> last >|
Alleleernie
Mutation Type critical splice donor site (2 bp from exon)
Chromosome7
Coordinate122,171,661 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Ern2
Gene Name endoplasmic reticulum (ER) to nucleus signalling 2
Synonym(s) Ire1b
Chromosomal Location 122,169,893-122,186,207 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_012016; MGI:1349436

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000033153] [ENSMUSP00000033154] [ENSMUSP00000145716]
SMART Domains Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
PQQ 33 64 5.5e-8 SMART
PQQ 115 147 4.7e-4 SMART
PQQ 148 180 6.1e-2 SMART
PQQ 192 223 6.2e-3 SMART
low complexity region 449 461 N/A INTRINSIC
S_TKc 508 768 2.5e-11 SMART
PUG 831 888 9e-24 SMART
Predicted Effect probably null
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10 11238559
DSS: sensitive day 7 11238559
Penetrance  
Alleles Listed at MGI

All mutations/alleles(1) : Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ern2 APN 7 122170092 missense probably damaging 0.99
IGL01324:Ern2 APN 7 122183190 missense possibly damaging 0.88
IGL02185:Ern2 APN 7 122173375 splice site probably benign
IGL02738:Ern2 APN 7 122182899 missense probably damaging 0.99
IGL02750:Ern2 APN 7 122181406 splice site probably benign
IGL03247:Ern2 APN 7 122171671 missense probably benign 0.02
Ernie2 UTSW 7 122180862 splice donor site probably benign
ernie3 UTSW 7 122173819 critical splice acceptor site probably null
R0165:Ern2 UTSW 7 122179779 missense probably benign 0.02
R0785:Ern2 UTSW 7 122171661 critical splice donor site probably null
R0801:Ern2 UTSW 7 122180862 splice site probably benign
R1345:Ern2 UTSW 7 122177770 missense probably damaging 1.00
R1649:Ern2 UTSW 7 122177400 missense probably damaging 1.00
R1747:Ern2 UTSW 7 122173819 critical splice acceptor site probably null
R1747:Ern2 UTSW 7 122173820 critical splice acceptor site probably null
R1846:Ern2 UTSW 7 122176536 missense probably benign 0.32
R1899:Ern2 UTSW 7 122183842 splice site probably benign
R1986:Ern2 UTSW 7 122171529 missense probably benign 0.06
R2055:Ern2 UTSW 7 122183945 missense possibly damaging 0.84
R2329:Ern2 UTSW 7 122173487 missense possibly damaging 0.82
R2351:Ern2 UTSW 7 122171508 missense probably damaging 0.97
R2894:Ern2 UTSW 7 122181587 missense possibly damaging 0.94
R3176:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3276:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3945:Ern2 UTSW 7 122176530 missense probably benign 0.10
R4303:Ern2 UTSW 7 122177846 critical splice acceptor site probably null
R4874:Ern2 UTSW 7 122176587 missense probably benign 0.28
R4943:Ern2 UTSW 7 122173258 missense possibly damaging 0.95
R5184:Ern2 UTSW 7 122179959 missense probably benign 0.03
R5629:Ern2 UTSW 7 122170166 missense probably damaging 1.00
R5770:Ern2 UTSW 7 122179907 missense possibly damaging 0.92
R6255:Ern2 UTSW 7 122173272 missense probably damaging 1.00
R6272:Ern2 UTSW 7 122176646 missense probably benign 0.05
R6277:Ern2 UTSW 7 122186107 missense probably benign
R6624:Ern2 UTSW 7 122177783 missense probably benign 0.00
R6940:Ern2 UTSW 7 122186146 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository

MMRRC:37600

Last Updated 2018-08-21 9:33 AM by Anne Murray
Record Created 2014-09-17 11:05 PM by Emre Turer
Record Posted 2015-01-13
Phenotypic Description
Figure 1. Ernie mice exhibit susceptibility to DSS-induced colitis at day 7. Susceptibility to colitis was measured by percent weight loss. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 1. Ernie mice exhibit susceptibility to DSS-induced colitis at day 10. Susceptibility to colitis was measured by percent weight loss. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The ernie phenotype was identified among G3 mice of the pedigree R0785, some of which showed weight loss at day 7 (Figure 1) and day 10 (Figure 2) after treatment with dextran sulfate sodium (DSS)-containing water, indicating susceptibility to DSS-induced colitis.

Nature of Mutation

Figure 3. Linkage mapping of increased susceptibility to DSS-induced colitis (day 7) using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 34 mutations (X-axis) identified in the G1 male of pedigree R0785.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 34 mutations. The DSS-induced colitis susceptibility at both time-points was linked by continuous variable mapping to a mutation in Ern2:  a T to A transversion at base pair 122,171,661 (v38) on chromosome 7, or base pair 13,056 in the GenBank genomic region NC_000073.  The strongest association was found with a recessive model of linkage to the day 7 phenotype, wherein 10 variant homozygotes departed phenotypically from 12 homozygous reference mice and 20 heterozygous mice with a P value of 3.644 x 10-13 (Figure 3).  A substantial semidominant effect was observed at both day 7 and day 10, but the mutation is preponderantly recessive.  The mutation corresponds to nucleotide two within the donor splice site of intron 18 of Ern2. The effect of the mutation at the cDNA and protein level has not been tested, but the mutation is predicted to result in skipping of the 148-base pair exon 18 (out of 22 total exons). Skipping of exon 18 would cause a frame-shift, coding of 7 aberrant amino acids, and a premature stop codon that would truncate the protein after amino acid 694.

 

       exon 17-->             exon 18-->            intron 18--> exon 19-->
12858  TACACCGTGAC……GACAGCCCG ACCAGCGCT……GAGACCCATG gtgagaacca…… ACAAGGTTGTGGCATTGGACTTAG 14667
622    V--H--R--D-……-D--S--P- -T--S--A-……-E--T--H--              -T--R--L--W--H--W--T--*  695
               correct               deleted                             aberrant

 

Genomic numbering corresponds to NC_000073. The donor splice site of intron 18, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction
Figure 4. Domains of IRE1β. IRE1β is a type I transmembrane receptor in the endoplasmic reticulum. See the text for more details. Abbreviations: SP, signal peptide; PQQ, pyrrolo-quinoline quinone beta-propeller repeat; TM, transmembrane domain; KEN, kinase-extension-nuclease domain. The ernie mutation within intron 17 is indicated in red.

Ern2 encodes inositol-requiring enzyme 1β (IRE1β), a type I transmembrane receptor paralog of IRE1α. IRE1β and IRE1α have an N-terminal sensory domain that faces the endoplasmic reticulum (ER) lumen (amino acids 35-426), a transmembrane domain (amino acid 427-447), and a cytoplasmic effector domain at the C-terminus (amino acid 448-911) (1;2). Amino acids 1-33 comprise a signal peptide. IRE1α and IRE1β are structurally similar to TGF-β serine/threonine protein kinase receptors (3).

 

Figure 5. Crystal structure of the human IRE1α luminal domain. Amino acids 24-390 were crystallized. The three β-structural motifs: the N, C, and M motifs are indicated. See the text for more details. Figure generated by UCSF Chimera and is based on PDB:2HZ6 and (1).

The luminal domain (LD) of IRE1β has four pyrrolo-quinoline quinone (PQQ) beta-propeller repeats (amino acids 33-64, 115-147, 148-180, and 192-223; SMART) (4). The LD functions as an ER stress sensor during the unfolded protein response (UPR) (3); see the “Background” section for more information on the UPR. The crystal structure of a fragment of the human IRE1α LD (amino acids 24-390) has been solved [Figure 5; PDB:2HZ6; (1)]. The LD dimerizes through an interface consisting largely of β-sheets and forms a triangular β-sheet cluster comprised of three β-structural motifs: the N, C, and M motifs (1). Conserved α-helices are inserted between the β-structural motifs. The N motif comprises the N-terminal portion of the LD and consists of a β-barrel fold with a five-stranded antiparallel β-sheet stacked against a four-stranded mixed β-sheet (3). The C motif contains the C-terminal portion of the LD and is a β-barrel fold that has two three-stranded antiparallel β-sheets stacked against each other (3). The M motif comprises the region between the N and C motifs, and is a four-stranded antiparallel β-sheet. A pair of α-helices connects the N and C motifs and a short two-turn α-helix connects the M and C motifs (3). An outside β-strand (β8) within the M motif and the preceding α-helix (αA) comprise the dimerization interface of the LD.

 

Figure 6. Crystal structure of the yeast Ire1p cytoplasmic domain. The cytoplasmic domain has a 24 amino acid (C869-F892) internal deletion (Ire1cytoΔ24). The N-lobe, C-lobe, and KEN domains are indicated as well as the location of ADP binding. See the text for more details. Figure generated by UCSF Chimera and is based on PDB:2RIO and (1).

The cytoplasmic domain of IRE1β has both a protein kinase domain (amino acids 508-768) and a kinase-extension-nuclease domain (KEN domain; alternatively, RNAse domain; amino acids 771-899) (4). The KEN domain of IRE1β is required for the cleavage of 28S ribosomal RNA (rRNA) (2) (see the Background section for more details). The structure of a variant of the yeast Ire1p cytoplasmic domain with a 24 amino acid (C869-F892) internal deletion within the kinase domain (Ire1cytoΔ24) has been solved [Figure 6; PDB:2RIO; (1)]. The kinase domain has a bilobal fold with a smaller N-terminal lobe (N-lobe; amino acids 673-748) and a larger C-terminal lobe (C-lobe; amino acids 749-982) (1). The N-lobe is an anti-parallel β sheet with five β strands (β1 to β5) and a laterally flanking helix (αC) (1). The C-lobe is two paired antiparallel β-strands (β7-β10 and β8-β9) and eleven α helices (αD to αL) (1). The activation segment (amino acids 828 to 859), possessing the phospho-regulatory function of IRE1, is positioned between β10 and αEF. A non-canonical helix, αE’, is inserted between β8 and β9 of the C-lobe and participates in dimer formation (1). An ADP molecule binds within the inter-lobe cleft of each Ire1cytoΔ24 monomer. Binding of ADP results in a closed conformation of the kinase domain and is compatible with the phosphor-transfer mechanism (1). Binding of the nucleotide to the kinase domain facilitates a back-to-back dimer configuration involving associations between the kinase and KEN domains (1). The KEN domain is comprised of eight α-helices (α1 to α8). The KEN domain and the C-lobe have a fixed orientation and are both required for proper folding and acts as a dimerization surface.

 

IRE1α and IRE1β are maintained in monomeric states through the interaction of the LD with the ER chaperone immunoglobulin heavy chain binding protein (BiP; alternatively, GRP78) (5;6). Upon exposure to unfolded protein in the ER lumen, BiP binds to the accumulated unfolded proteins, permitting the dimerization of IRE1 [Figure 7; (1;3)]. IRE1 dimerization promotes trans-phosphorylation on positive regulatory sites within the kinase domain (Ser840 and Ser841 in yeast Ire1) (7;8). Dimerization and auto-phosphorylation of IRE1β promotes the catalytic function of IRE1β as well as the activation of the ribonuclease activity (7;9;10). Auto-phosphorylation of autoregulatory sites within the activation segment regulates access of the active site to ADP (1). Binding of nucleotides (either ADP, ATP, or its non-hydrolysable analogs) to the kinase domain active site (Lys547) potentiates the ribonuclease function of IRE1β (10). IRE1β undergoes additional phosphorylation at Thr844 and Ser850 (7); however, the role of phosphorylation at those sites is unknown (1). Mutation of Thr844, but not Ser850, impaired IRE1 function in vivo (1). IRE1β is N-linked glycosylated at Asn179, but the role for glycosylation on IRE1β is unknown (11).

 

The ernie mutation is predicted to cause a frame-shift and coding of a premature stop codon after amino acid 694. The mutation would disrupt both the kinase and KEN domains.

Expression/Localization

The Ern2 gene is expressed in the stomach, duodenum, small intestine, cecum, and colon (12) as well as in the nasopharynx, trachea, and bronchus (13). The IRE1β protein is expressed in gastrointestinal (stomach, small intestine, and colon) epithelial cells (3;4;12;14) as well as in goblet/mucus cells in human bronchial epithelia and Clara and mucus cells in mice (13). IRE1β expression in the small intestine is weaker than in the stomach or colon (14). In the colon and small intestine, IRE1β is localized to the cytosolic surface of the ER and the outer nuclear membrane in goblet cells (12). Exogenously expressed HA-tagged IRE1β in HeLa cells localized to the ER lumen (11). Upon induction of ER stress, IRE1β clusters into discrete foci (15).

 

IRE1β expression can be induced or repressed upon several conditions. High-cholesterol and high-fat diets decrease intestinal IRE1β mRNA in wild-type mice (16). IRE1β expression is upregulated in cystic fibrosis and asthmatic bronchial epithelia (13).

Background
Figure 7. IRE1 and the unfolded protein response (UPR). The UPR promotes protein folding through the synthesis of ER resident chaperones as well as enhanced ER-associated protein degradation (ERAD) and global repression of protein synthesis. Three ER resident transmembrane proteins, IRE1, protein kinase RNA (PKR)-like ER kinase/pancreatic eIF2α kinase (PERK), and activating transcription factor 6 (ATF6) mediate UPR signaling. IRE1 senses ER stress and transmits a signal to the nucleus by initiating spliceosome-independent splicing of Xbp1, a basic leucine zipper transcriptional regulator of the UPR. The mature from of XBP1 facilitates the upregulation of several gene products  including ER-resident proteins that will assist in protein folding and maturation as well as ER-associated proteins that will assist in protein degradation. Upon recognition of misfolded proteins in the ER, PERK phosphorylates the translation initiation factor eIF2α that inhibits global protein synthesis by blocking the formation of an active 43S translation-initiation complex. S1P cleaves ATF6, a transcription factor activated by ER stress. Under normal conditions, ATF6 is held in the ER by interactions with the chaperone, GRP78. Accumulation of misfolded proteins in the ER leads to ER stress and the subsequent release of ATF6 from GRP78. The dissociation of GRP78 exposes a Golgi localization sequence on ATF6 that targets ATF6 to the Golgi via COPII vesicles. Within the Golgi, ATF6 is cleaved by S1P and S2P to free the basic leucine zipper and transactivation domain (TA) of ATF6 to translocate to the nucleus where it binds to ER stress responsive elements (ERSE) to activate unfolded protein response (UPR) genes.

Accumulation of misfolded proteins in the ER lumen, glucose starvation, inhibition of protein glycosylation, and disturbance of intracellular calcium stores results in ER stress. To alleviate ER stress and to restore the ER to its normal state, a series of signaling pathways, termed the UPR promotes protein folding through the synthesis of ER resident chaperones (e.g., BiP/GRP78 and GRP94) and folding catalysts as well as enhanced ER-associated protein degradation (ERAD) and global repression of protein synthesis [Figure 7; (17)]. Three ER resident transmembrane proteins, IRE1, protein kinase RNA (PKR)-like ER kinase/pancreatic eIF2α kinase (PERK), and activating transcription factor 6 (ATF6) mediate UPR signaling. The LDs of IRE1 and PERK are responsive to ER stress signals and the cytoplasmic effector domains transmit the signal to downstream components. Upon recognition of misfolded proteins in the ER, PERK phosphorylates the translation initiation factor eIF2α that inhibits global protein synthesis by blocking the formation of an active 43S translation-initiation complex (i.e., 40S subunit, eIF1, eIF1A, eIF3, eIF2-GTP-Met-tRNAMet, and eIF5) (18-20). IRE1 senses ER stress and transmits a signal to the nucleus by initiating spliceosome-independent splicing of Xbp1, a basic leucine zipper transcriptional regulator of the UPR (10;21-23). IRE1 cleaves a phosphodiester bond in each of two RNA hairpins in Xbp1, removing an intervening intron, and subsequently introducing a frame-shift that yields an activator of the UPR (1;10;21-23). The mature from of XBP1 facilitates the upregulation of several gene products that contain X-box or UPR elements in their promoter regions including ER-resident proteins that will assist in protein folding and maturation as well as ER-associated proteins that will assist in protein degradation (24).

 

IRE1α and IRE1β have distinct functions and expression patterns (4;11;25). IRE1α is ubiquitously expressed, while IRE1β is specific to gastrointestinal epithelial cells and mucus cells in bronchial epithelia. During the UPR, both IRE1α and IRE1β can catalyze the processing of Xbp1 (21-23), although IRE1β is less efficient than IRE1α (2). IRE1α and IRE1β both activate c-Jun NH2-terminal kinase (JNK) in response to ER stress (26). IRE1β is unique from IRE1α in that IRE1β directly interacts with unfolded proteins rather than with GRP78 during conditions of ER stress (15). IRE1β is more efficient than IRE1α in facilitating site-specific cleavage of 28S rRNA and translational attenuation of protein synthesis (2;11). Cleavage of the 28S rRNA required the proper ribosomal subunit tertiary structure (2). Examination of translation efficiency of cytosolic and secretory protein synthetic pathways determined that IRE1β selectively suppresses secretory protein translation by membrane-bound ribosomes through its RNase activity (27). The IRE1β-mediated degradation of secretory pathway protein mRNAs occurs to prevent excess influx of newly synthesized proteins into the ER. IRE1β-specific functions are detailed, below.

 

Bronchia

IRE1β expression correlates with several genes involved in mucin production in the bronchia. IRE1β activates XBP-1, which promotes transcription of anterior gradient homolog 2 (Agr2), a gene that encodes a disulfide isomerase that functions in airway and intestinal epithelial mucin production (13;28;29). Ern2 expression also correlates with SAM pointed domain-containing ETS transcription factor (SPDEF), which regulates genes associated with mucus production (30;31), and with CLCA1/3 (GOB-5) expression, a calcium-activated chloride channel family member that is associated with mucin gene regulation and mucus cell transdifferentiation (32;33). Genes that encode several enzymes that are involved in mucin glycosylation (e.g., the sulfo- and glucosaminyl-transferase enzymes) are also correlated with Ern2 expression (13). In a model of OVA-induced allergic airway inflammation, Muc4b, Clca3, Muc5ac, and Agr2 levels were upregulated in wild-type mice. However, in Ern2-/- mice, expression was not increased upon inflammation indicating that IRE1β is required for OVA-induced upregulation of mucin production in the inflamed airway (13). The reduced OVA-induced mucin production in the Ern2-/- mice was not due to a decreased OVA-elicited inflammatory response and did not result in upregulation of ER stress genes Xbp1, Bip, Atf, and Chop.

 

Intestinal lipid transport/absorption

Free fatty acids are taken up by enterocytes and hepatocytes where they are converted to triglycerides that are either incorporated into newly synthesized lipoproteins and secreted or stored in the cytoplasm (34). Increased lipid absorption can lead to metabolic disorders including obesity, atherosclerosis, and diabetes (16). During enterocyte differentiation, microsomal triglyceride transfer protein (Mtp) expression is induced after expression of the suppressor nuclear receptor family 2 group F member 1 (NR2F1) is reduced. Mtp encodes an ER chaperone required for lipid mobilization via apolipoprotein B (apoB) lipoproteins (35). MTP and apoB are also required for chylomicron assembly in the ER of enterocytes (16;36;37). Chylomicrons are vesicles synthesized by the intestine and function to transport large quantities of dietary fat and fat-soluble vitamins (16;38;39). IRE1β posttranscriptionally degrades Mtp (35). Ern2−/− mice that were fed high-cholesterol and high-fat diets developed more hyperlipidemia than wild-type mice due to increased secretion of chylomicrons and enhanced expression of Mtp (16). Iqbal et al. did not observe a correlation between ER stress and Mtp expression (16). Dai et al. propose that there is a negative relationship between MTP and NR2F1/IRE1β expression in crypt-villus and jejunum-colon axes of the mouse intestine, which leads to reduced apoB biosynthesis (35).

 

Mutations in apolipoprotein E (Apoe) are linked to diet-induced atherosclerosis. Ern2−/−/Apoe−/− mice were examined to determine if changes in intestinal lipid absorption associated with the loss of IRE1β would affect the development of hyperlipidemia and atherosclerosis (34). The Ern2−/−/Apoe−/− mice exhibited higher levels of intestinal MTP, absorbed more lipids, developed hyperlipidemia, and had higher levels of atherosclerotic plaques than Apoe−/− mice (34). Taken together, IRE1β regulates intestinal lipid absorption and that increased intestinal lipoprotein production contributes to atherosclerosis (34).

Putative Mechanism

Ern2 knockout (Ern2-/-) mice are viable and healthy. However, when challenged with DSS, the Ern2-/- mice (in both the 129svev and C57BL/6 genetic backgrounds) developed colitis 3-5 days earlier than wild-type and heterozygous mice. In addition, the Ern2-/- mice exhibited mortality approximately 5 days earlier than wild-type or heterozygous mice. The Ern2-/- mice did not develop spontaneous intestinal inflammation (14). Post-mortem examination of the Ern2-/- mice determined that the distal large bowel exhibited shortening of the long axis (14;40). The distal colonic mucosa remained intact for the first 7 days of DSS treatment, but there was a mild flattening of the crypts followed by the appearance of inflammatory cells and surface ulceration. Staining of ICAM-1, a cell-surface protein that is expressed before surface ulceration, occurred 3-5 days earlier in the Ern2-/- mouse compared to the wild-type mice, indicating that increased inflammatory signals by the stressed epithelium. BiP expression was approximately three-fold higher in the stomach and colon of Ern2-/- mice, indicating higher levels of ER stress in the gastrointestinal tract of the Ern2-/- mice. Although BiP levels were not significantly increased in the mucosa of DSS-treated Ern2-/- mice, higher levels of p38 MAPK activation were observed in the colonic mucosa during DSS exposure. Further studies determined that loss of IRE1β expression promotes ER stress specifically in immature goblet cells (12). Examination of goblet cells from Ern2-/- mice determined that the ER was distended in the cells. Within the distended ER of the immature goblet cells, aberrant mucin accumulation was observed. The stability of Muc2 mRNA was increased in the Ern2-/- mice, indicating that IRE1β functions to normally degrade Muc2 to control the levels of translatable, cytosolic mRNA and to prevent accumulation of aberrant mucin in the ER (12). Tsuru et al. proposed that the susceptibility to colitis may indicate a qualitative defect in mucins secreted by the goblet cells in the Ern2-/- mice (12). Changes in Muc2 expression alters mucin content in mucus cells and the mucus barrier (13;14;41). Similar to the Ern2-/- mice, the ernie mice exhibit susceptibility to DSS-induced colitis indicating loss of function in IRE1β.

Primers PCR Primer
ernie(F):5'- GGGCTTCCCAAGATCATCTAACCTGG -3'
ernie(R):5'- CAGAGGGACTTTAGCAAGGCTCAC -3'

Sequencing Primer
ernie_seq(F):5'- TTAGCTCTGCTCCAAAAGAGG -3'
ernie_seq(R):5'- AGCAAGGCTCACTTCCTCC -3'
Genotyping

Ernie genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Ernie (F): 5’- GGGCTTCCCAAGATCATCTAACCTGG-3’

Ernie (R): 5’- CAGAGGGACTTTAGCAAGGCTCAC-3’

 

Sequencing Primer

Ernie (F): 5’- TTAGCTCTGCTCCAAAAGAGG-3’
 

Ernie (R): 5’- AGCAAGGCTCACTTCCTCC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 426 nucleotides is amplified (Chr.7: 122171434-122171859, GRCm38; NC_000073):

 

gggcttccca agatcatcta acctggaaga actggagctc cttagctctg ctccaaaaga

gggggtgagc cagtacccat cctgccgagg ggcgatcctg gggcagcaag ctcagcatgg

ctctcactaa gtccaatgcc acaaccttgt ctggagggca gaagagagca tgggttatac

gtcctcctcc gtctcatgcc tgcttcctcc catctttgct ggttctcacc atgggtctct

tcctgcagct gagccagaca gggatcccct gagaggatgt tggcctgtcg gtagagactc

tctccaaagg ggtggctgcc accggaaagc acgtaataaa atacgcagcc tgcggagaag

atatccacag cgctggtctg ggggccagaa agaaaggagg aagtgagcct tgctaaagtc

cctctg

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide (C) is shown in red text (T>A, sense strand; A>T, Chr. + strand).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsEmre Turer Jeff Sorelle William McAlpine
List |< first << previous [record 14 of 74] next >> last >|