Phenotypic Mutation 'Park3'

• Allele: Park3
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 59,565,850 bp (GRCm38)
• Base Change: A ⇒ G (forward strand)
• Gene: Nlrp3
• Gene Name: NLR family, pyrin domain containing 3
• Synonym(s): Cias1, cryopyrin, Pypaf1, NALP3, Mmig1
• Chromosomal Location: 59,541,568-59,566,956 bp (+)
• MGI Phenotype: Strain: 3686871; FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008] ; PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000078440] [ENSMUSP00000098707]
• AlphaFold: Q8R4B8
• SMART Domains: Protein: ENSMUSP00000078440; Gene: ENSMUSG00000032691; AA Change: D946G

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
  (Using ENSMUST00000079476)
• SMART Domains: Protein: ENSMUSP00000098707; Gene: ENSMUSG00000032691; AA Change: D946G

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
  (Using ENSMUST00000101148)
• Meta Mutation Damage Score: 0.3192
• Is this an essential gene?: Probably nonessential (E-score: 0.081)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Sperm
• MMRRC Submission: 038251-MU
• Last Updated: 2019-09-04 9:48 PM by Diantha La Vine
• Record Created: 2014-09-18 10:25 PM by Hexin Shi
• Record Posted: 2015-01-23
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Bruce Beutler, Hexin Shi, Ying Wang, Zhao Zhang, Doan Dao

Accession Number

NCBI RefSeq: NM_145827.3; MGI: 2653833

Alleles Listed at MGI

All mutations/alleles(16) : Chemically induced (ENU)(5) Targeted(11)

Phenotypic Description

Figure 1. Park3 mice secreted decreased amounts of IL-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Image is from gene-based superpedigree analysis of pedigrees R0008 (green), R0052 (light blue), R0416 (red), R0362 (yellow), R1622 (glue/gray), R0863 (purple), and R1414 (gold), each harboring different Nlrp3 alleles (Chr11: 59549531, 59565850, 59548476, 59565128, 59558448, 59555924, and 59548797). Normalized log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Park3 phenotype was identified among G3 mice of the pedigree R0863 some of which showed attenuated inflammatory responses related to decrease secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced IL-1β secretion after nigericin treatment using an dominant model of inheritance and gene-based superpedigree analysis. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 493 mutations (X-axis) identified in the G1 males of pedigrees R0008, R0052, R0362, R0416, R0863, R1414, and R1622. Normalized phenotype data are shown without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. The Nlrp3 inflammasome phenotype was linked to a mutation in Nlrp3 by continuous variable mapping and gene-based superpedigree analysis: normalized data from pedigrees R0008, R0052, R0362, R0416, R0863, R1414, and R1622 were analyzed using a dominant model of inheritance (P = 5.797 x 10^-8), wherein 28 variant homozygotes and 65 heterozygotes departed phenotypically from 48 homozygous reference mice (Figure 2). The Nlrp3 mutation in Park3 is an A to G transition at base pair 59,565,850 (v38) on chromosome 11, or base pair 24,282 in the GenBank genomic region NC_000077. The mutation corresponds to residue 3,063 in the mRNA sequence NM_145827 within exon 4 of 10 total exons.

 

3047 CAGATGCTGGAATTAGACAACTGCAGCCTCACC 941  -Q--M--L--E--L--D--N--C--S--L--T-

 

The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid (D) to glycine (G) substitution at position 946 (D946G) in the NLRP3 protein, and is strongly predicted by Polyphen-2 to be benign (score = 0.017).

Protein Prediction

Figure 3. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT-associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The Park3 mutation results in an aspartic acid to glycine substitution at position 946. This image is interactive. Other mutations found in NLRP3 are noted in red. Click on each mutation for more specific information.

The Nlrp3 gene encodes a 1,033 amino acid protein that is a member of the nucleotide-binding and oligomerization domain (NOD)-like receptor (NLR) or CATERPILLER [for CARD, transcription enhancer, R(purine)-binding, pyrin, lots of leucine repeats] family [Figure 3; (1)]. NLRP3 has a C-terminal leucine-rich repeat (LRR) domain, a central oligomerization NACHT usually with a C-terminal extension known as the NACHT associated domain (NAD), and an N-terminal effector domain. The N-terminus of NLRP3 contains a pyrin domain (PYD). The Park3 mutation (D945G) is within the LRR domain.

 

For more information about Nlrp3, please see the record for ND1.

Putative Mechanism

NLRP3 is able to oligomerize through its NBD domain and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. A large variety of agents have been shown to activate the NLRP3 inflammasome, and NLRP3 plays an important role in the innate immune response. The phenotype of the Park3 mice suggests that the mutated protein, if expressed, is inactive or has reduced activity.

Primers

PCR Primer
Park3_pcr_F: CCCTGATGCAAATCTGTGTCTGAGG
Park3_pcr_R: CAAACCACACTCACTGTAGGCTCTG

Sequencing Primer
Park3_seq_F: cctggcttgcctggaac
Park3_seq_R: TTGTTGCCCAGGTTCAGCTT

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 758 nucleotides is amplified (chromosome 11, + strand):

1   ccctgatgca aatctgtgtc tgaggagtga ggcgttcttg gtgtccatta gtgagaaatg
61  ggaagtttct agatggtata cagcttaaag gctaagcccc tgccaccaca gtcctgccaa
121 ctgcaaacat tcatttggtc cattgatact ttgtggaaat ctgaggggaa cataatgttt
181 agaaaaagtc aattgacaaa tttctgttac tattttggtc tgttcaaccc agtaccttgg
241 gaaaagaaac ttccatctaa agaggggaga aaagaaacca tatcatatga agcagcttca
301 cgctggtcag tctgtggttt gttgttgttg ttgttttcaa gacagggttt atctgtgtag
361 ccctggcttg cctggaactc actctgtaga ccaggttggc ttcgaactca gaaatccgcc
421 tgcttctgcc tcccaagtgc tgggattaaa ggtgtgcacc accactgccc agcccaatct
481 gcgcttttta tgcaaatgaa actgcaggtt tggagacccg gaagtatgga tggtcaaggc
541 tattttcttt atatcaccct tctcttctca aagattagac aactgcagcc tcacctcaca
601 cagctgctgg aatctctcca caattctgac ccacaaccac agccttcgga agctgaacct
661 gggcaacaat gatcttggcg atctgtgcgt ggtgaccctc tgtgaggtgc tgaaacagca
721 gggctgcctc ctgcagagcc tacagtgagt gtggtttg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. Ting, J. P., Lovering, R. C., Alnemri, E. S., Bertin, J., Boss, J. M., Davis, B. K., Flavell, R. A., Girardin, S. E., Godzik, A., Harton, J. A., Hoffman, H. M., Hugot, J. P., Inohara, N., Mackenzie, A., Maltais, L. J., Nunez, G., Ogura, Y., Otten, L. A., Philpott, D., Reed, J. C., Reith, W., Schreiber, S., Steimle, V., and Ward, P. A. (2008) The NLR Gene Family: A Standard Nomenclature. Immunity. 28, 285-287.