Allele | dee-no | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 19 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 18,955,053 bp (GRCm38) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ G (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Rorb | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | RAR-related orphan receptor beta | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Nr1f2, Rorbeta, RZR-beta | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 18,930,605-19,111,196 bp (-) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, and to help regulate the expression of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014] PHENOTYPE: Mice homozygous for disruptions in this gene have impaired vision and a variety of behavioral abnormalities. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_001043354, NM_146095, NM_001289921; MGI:1343464 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Leucine changed to Proline | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000047597] [ENSMUSP00000108447] [ENSMUSP00000108451] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000047597 Gene: ENSMUSG00000036192 AA Change: L378P
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000108447 Gene: ENSMUSG00000036192 AA Change: L293P
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000108451 Gene: ENSMUSG00000036192 AA Change: L367P
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9699 ![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) ![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | CE: failed initial filter | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All mutations/alleles(8) : Chemically induced (ENU)(1) Targeted(7) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm, gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 038200-MU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:48 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2014-09-19 9:09 AM by Chad Daniel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2015-06-02 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The dee-no phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1438, some of which exhibited a high-stepping gait in the hind legs (Figure 1). The mice did not exhibit tremor, head tossing, circling, or balance issues. |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 79 mutations. The gait phenotype was linked to a mutation in Rorb: a T to C transition at base pair 18,955,053 (v38) on chromosome 19, or base pair 156,144 in the GenBank genomic region NC_000085. Linkage was found with a recessive model of inheritance (P = 1.15 x 10-4), wherein 3 affected mice were homozygous for the variant allele and 28 unaffected mice were either heterozygous (N = 18) or homozygous (N = 10) for the reference allele (Figure 2). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive.
The mutation corresponds to residue 1,738 in the mRNA sequence NM_001043354 (variant 1) within exon 8 of 10 total exons, residue 1,204 in the mRNA sequence NM_146095 (variant 2) within exon 8 of 10 total exons, and residue 1,257 in the mRNA sequence NM_001289921 (variant 3) within exon 8 of 10 total exons.
Genomic numbering corresponds to NC_000085. The mutated nucleotide is indicated in red. The mutation results in a leucine (L) to proline (P) substitution at position 367 (L367P) in isoform 1 and isoform 3 of the RAR-related orphan receptor beta (RORβ) protein as well as L378P in isoform 2 of the RORβ protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 1.00) (1). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
RORβ belongs to the large nuclear hormone receptor superfamily, a group of structurally related, ligand-dependent transcription factors. Nuclear hormone receptors, including the RORs, share a similar structural architecture composed of four major functional domains: the N-terminal domain (A/B region), DNA-binding domain (DBD or C region), a hinge region (D region), and a ligand-binding domain (LBD or E region) (Figure 3) (2;3). Adjacent to the DBD is a highly conserved region designated the carboxy-terminal extension (CTE) that influences the binding specificity of RORs (4). A nonconserved linker region connects the DBD and LBD, and is required for several functions in repression and activation. The A/B domain differs between the isoforms of RORs due to alternative promoter usage or exon splicing. Two splice variants of Rorb exist, which diverge in sequence upstream from the DBD, and give rise to two protein isoforms (RORβ1 and RORβ2) that display differential tissue-specific expression patterns and response element specificity.
The dee-no mutation results in a leucine (L) to proline (P) substitution at position 367 (L367P) in isoform 1 of RORβ. L367 is within the ligand-binding domain (LBD or E region). The mutation is predicted to affect the LBDs of both RORβ isoforms.
Please see the record for 4-limb clasper for more information about RORβ. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Disruption of Rorb in mice demonstrates a role for RORβ in the regulation of circadian timing. No gross anatomical abnormalities are observed in the brain, but the retinas of Rorb-/- mice are severely malformed, with significantly fewer cells and a disorganized structure lacking the layers of a normal retina. Rorb-/- mice display an altered free-running or autonomous rhythm: Upon release of animals from a light-dark schedule into constant darkness, Rorb-/- mice adopt a cycle length about 0.4 hours longer than their wild type littermates (an average of 23.84 hours for wild type versus 24.26 hours for Rorb-/-) (5). Rorb-/- mice exhibit developmental abnormalities in addition to alterations in circadian timing (5). Young Rorb-/- mice are smaller than their wild type littermates, and they sometimes fall sideways and roll over as they begin to walk. With increasing age, they gain normal muscular strength but develop a “duck-like” gait and a hind paw clasping reflex when suspended by the tail. Rorb-/- mice display normal grasping, limb flexion and righting reflexes, respond normally to auditory stimulation, show normal rearing, balancing and climbing responses, and display normal temperature-related pain reflexes. The molecular basis for the developmental abnormalities of Rorb-/- mice remains unknown. The duck-like gait has been suggested to arise from aberrant wiring of RORβ-expressing neurons in the spinal cord, resulting in overlap of sensory and other projections to the brain. An overlap of sensory and nociceptive projections could cause Rorb-/- mice to feel pain when walking, eliciting the high leg-lifting observed (5).
The phenotype of dee-no mice closely approximates that of Rorb-/- mice, suggesting that the dee-no mutation abrogates much of the function of mutant RORβ. The dee-no mutation affects Leu367 within the LBD. The LBD of RORβ contains the transactivation function 2 (AF-2) consensus motif ΦΦXE/DΦΦ (where Φ is a hydrophobic amino acid, and X is any amino acid) that binds coactivators, and functions critically in the control of transcriptional activity. Ligand binding acts as a switch, inducing a shift in the position of the LBD that disfavors corepressor binding and promotes recruitment of coactivator complexes that induce local chromatin remodeling to enhance transcription (6;7). The mutation in dee-no may alter the ligand binding activity of RORβ. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer dee-no_pcr_F: GAAGCTACTTGCCTTTGCATTGTCC dee-no_pcr_R: GTCACATGGAATCCACACTAGCCAG Sequencing Primer dee-no_seq_F: GCCTTTGCATTGTCCAAAAATATC dee-no_seq_R: CCCCTGACTACGTACTTGATAATGAG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 531 nucleotides is amplified (chromosome 19, - strand): 1 gtcacatgga atccacacta gccagtattg taccccattg ttgccaaggt tatcttcagc Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Tiana Purrington,Chad Daniel,Jeff SoRelle |