Phenotypic Mutation 'dee-no' (pdf version)
Alleledee-no
Mutation Type missense
Chromosome19
Coordinate18,955,053 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Rorb
Gene Name RAR-related orphan receptor beta
Synonym(s) Nr1f2, Rorbeta, RZR-beta
Chromosomal Location 18,930,605-19,111,196 bp (-)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, and to help regulate the expression of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have impaired vision and a variety of behavioral abnormalities. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001043354, NM_146095, NM_001289921; MGI:1343464

Mapped Yes 
Amino Acid Change Leucine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000047597] [ENSMUSP00000108447] [ENSMUSP00000108451]
SMART Domains Protein: ENSMUSP00000047597
Gene: ENSMUSG00000036192
AA Change: L378P

DomainStartEndE-ValueType
ZnF_C4 18 89 1.51e-39 SMART
coiled coil region 95 133 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HOLI 275 431 1.83e-29 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000040153)
SMART Domains Protein: ENSMUSP00000108447
Gene: ENSMUSG00000036192
AA Change: L293P

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
HOLI 190 346 1.83e-29 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000112828)
SMART Domains Protein: ENSMUSP00000108451
Gene: ENSMUSG00000036192
AA Change: L367P

DomainStartEndE-ValueType
ZnF_C4 7 78 1.51e-39 SMART
coiled coil region 84 122 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HOLI 264 420 1.83e-29 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000112832)
Meta Mutation Damage Score 0.9699 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status CE: failed initial filter
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(8) : Chemically induced (ENU)(1) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rorb APN 19 18957328 nonsense probably null
IGL01576:Rorb APN 19 18957334 missense probably damaging 1.00
IGL02863:Rorb APN 19 18952253 missense probably benign 0.05
IGL02886:Rorb APN 19 18977579 critical splice donor site probably null
4-limb_clasper UTSW 19 18983351 missense probably damaging 1.00
grasshopper UTSW 19 19110557 start codon destroyed probably null 0.45
IGL02988:Rorb UTSW 19 18937972 missense probably damaging 1.00
R0748:Rorb UTSW 19 18977800 missense probably damaging 0.97
R1087:Rorb UTSW 19 18960414 missense probably damaging 1.00
R1438:Rorb UTSW 19 18955053 missense probably damaging 1.00
R1710:Rorb UTSW 19 18960501 missense probably damaging 1.00
R1846:Rorb UTSW 19 18955081 missense probably damaging 1.00
R1852:Rorb UTSW 19 18962083 missense probably damaging 1.00
R1972:Rorb UTSW 19 18952203 missense probably damaging 0.96
R3903:Rorb UTSW 19 18962099 missense probably damaging 0.99
R3978:Rorb UTSW 19 18937890 missense probably benign 0.00
R4497:Rorb UTSW 19 18977628 missense possibly damaging 0.95
R4982:Rorb UTSW 19 18977688 missense probably benign 0.05
R5602:Rorb UTSW 19 18977937 missense probably damaging 0.97
R5733:Rorb UTSW 19 18988107 missense probably damaging 1.00
R6267:Rorb UTSW 19 18977857 missense possibly damaging 0.88
R6455:Rorb UTSW 19 18960492 missense probably damaging 1.00
R6544:Rorb UTSW 19 18952250 missense possibly damaging 0.66
R6753:Rorb UTSW 19 18957247 missense probably benign 0.02
R7817:Rorb UTSW 19 18988096 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 038200-MU
Last Updated 2019-09-04 9:48 PM by Anne Murray
Record Created 2014-09-19 9:09 AM by Chad Daniel
Record Posted 2015-06-02
Phenotypic Description
Figure 1. The dee-no phenotype.

The dee-no phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1438, some of which exhibited a high-stepping gait in the hind legs (Figure 1). The mice did not exhibit tremor, head tossing, circling, or balance issues.

Nature of Mutation

Figure 2. Linkage mapping of the gait phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 79 mutations (X-axis) identified in the G1 male of pedigree R1438.  Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 79 mutations. The gait phenotype was linked to a mutation in Rorb: a T to C transition at base pair 18,955,053 (v38) on chromosome 19, or base pair 156,144 in the GenBank genomic region NC_000085. Linkage was found with a recessive model of inheritance (P = 1.15 x 10-4), wherein 3 affected mice were homozygous for the variant allele and 28 unaffected mice were either heterozygous (N = 18) or homozygous (N = 10) for the reference allele (Figure 2). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive.

 

The mutation corresponds to residue 1,738 in the mRNA sequence NM_001043354 (variant 1) within exon 8 of 10 total exons, residue 1,204 in the mRNA sequence NM_146095 (variant 2) within exon 8 of 10 total exons, and residue 1,257 in the mRNA sequence NM_001289921 (variant 3) within exon 8 of 10 total exons.

 

156128 TTCTCCTCTGCTGTTCTGATATCCCCAGACCGA

362    -F--S--S--A--V--L--I--S--P--D--R- Isoform 1 (NP_001036819)

373    -F--S--S--A--V--L--I--S--P--D--R- Isoform 2 (NP_666207)

362    -F--S--S--A--V--L--I--S--P--D--R- Isoform 3 (NP_001276850)

 

Genomic numbering corresponds to NC_000085. The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to proline (P) substitution at position 367 (L367P) in isoform 1 and isoform 3 of the RAR-related orphan receptor beta (RORβ) protein as well as L378P in isoform 2 of the RORβ protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 1.00) (1).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain of RORβ. The N-terminal domain varies between the two isoforms of RORβ; only the shorter isoform 1 is shown. The position of the dee-no mutation is indicated in red, and results in a leucine to proline substitution at amino acid 367 in RORβ-1 and amino acid 378 in RORβ-2 (not shown). This image is interactive. Click on the image to view other mutations found in the Rorb gene. Click on the mutations for more specific information. 

RORβ belongs to the large nuclear hormone receptor superfamily, a group of structurally related, ligand-dependent transcription factors. Nuclear hormone receptors, including the RORs, share a similar structural architecture composed of four major functional domains: the N-terminal domain (A/B region), DNA-binding domain (DBD or C region), a hinge region (D region), and a ligand-binding domain (LBD or E region) (Figure 3) (2;3). Adjacent to the DBD is a highly conserved region designated the carboxy-terminal extension (CTE) that influences the binding specificity of RORs (4). A nonconserved linker region connects the DBD and LBD, and is required for several functions in repression and activation. The A/B domain differs between the isoforms of RORs due to alternative promoter usage or exon splicing. Two splice variants of Rorb exist, which diverge in sequence upstream from the DBD, and give rise to two protein isoforms (RORβ1 and RORβ2) that display differential tissue-specific expression patterns and response element specificity.

 

The dee-no mutation results in a leucine (L) to proline (P) substitution at position 367 (L367P) in isoform 1 of RORβ. L367 is within the ligand-binding domain (LBD or E region). The mutation is predicted to affect the LBDs of both RORβ isoforms.

 

Please see the record for 4-limb clasper for more information about RORβ.

Putative Mechanism

Disruption of Rorb in mice demonstrates a role for RORβ in the regulation of circadian timing. No gross anatomical abnormalities are observed in the brain, but the retinas of Rorb-/- mice are severely malformed, with significantly fewer cells and a disorganized structure lacking the layers of a normal retina. Rorb-/- mice display an altered free-running or autonomous rhythm: Upon release of animals from a light-dark schedule into constant darkness, Rorb-/- mice adopt a cycle length about 0.4 hours longer than their wild type littermates (an average of 23.84 hours for wild type versus 24.26 hours for Rorb-/-) (5). Rorb-/- mice exhibit developmental abnormalities in addition to alterations in circadian timing (5). Young Rorb-/- mice are smaller than their wild type littermates, and they sometimes fall sideways and roll over as they begin to walk. With increasing age, they gain normal muscular strength but develop a “duck-like” gait and a hind paw clasping reflex when suspended by the tail. Rorb-/- mice display normal grasping, limb flexion and righting reflexes, respond normally to auditory stimulation, show normal rearing, balancing and climbing responses, and display normal temperature-related pain reflexes. The molecular basis for the developmental abnormalities of Rorb-/- mice remains unknown. The duck-like gait has been suggested to arise from aberrant wiring of RORβ-expressing neurons in the spinal cord, resulting in overlap of sensory and other projections to the brain. An overlap of sensory and nociceptive projections could cause Rorb-/- mice to feel pain when walking, eliciting the high leg-lifting observed (5).

 

The phenotype of dee-no mice closely approximates that of Rorb-/- mice, suggesting that the dee-no mutation abrogates much of the function of mutant RORβ. The dee-no mutation affects Leu367 within the LBD. The LBD of RORβ contains the transactivation function 2 (AF-2) consensus motif ΦΦXE/DΦΦ (where Φ is a hydrophobic amino acid, and X is any amino acid) that binds coactivators, and functions critically in the control of transcriptional activity. Ligand binding acts as a switch, inducing a shift in the position of the LBD that disfavors corepressor binding and promotes recruitment of coactivator complexes that induce local chromatin remodeling to enhance transcription (6;7). The mutation in dee-no may alter the ligand binding activity of RORβ.

Primers PCR Primer
dee-no_pcr_F: GAAGCTACTTGCCTTTGCATTGTCC
dee-no_pcr_R: GTCACATGGAATCCACACTAGCCAG

Sequencing Primer
dee-no_seq_F: GCCTTTGCATTGTCCAAAAATATC
dee-no_seq_R: CCCCTGACTACGTACTTGATAATGAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 531 nucleotides is amplified (chromosome 19, - strand):


1   gtcacatgga atccacacta gccagtattg taccccattg ttgccaaggt tatcttcagc
61  tacctggcaa agacatggcc caatttcttc attctccact gaacatcaaa tcacttcatg
121 tgacaggggt ctgaaaatgt ccggtctagg tttctaatat gcaaacccct gactacgtac
181 ttgataatga ggtatttcta gctgtgcgcc attccaagtt caagtatttc tgtttaagat
241 ttcttcttcc ttttaggttc ggatgaccta gtgaatgaag catttgactt tgcgaagaat
301 ctgtgttcct tgcagctgac tgaggaagag attgctctgt tctcctctgc tgttctgata
361 tccccaggta ggaaggcgcc ggtcccttgc cttcttttca aacctgcttc actatcttta
421 acatcaattg caccttccca agccaatgcg ttcgagaaat aactttaaag ggactgcatt
481 ttctctagca attgtttgat atttttggac aatgcaaagg caagtagctt c


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsTiana Purrington,Chad Daniel,Jeff SoRelle