Phenotypic Mutation 'Phelps' (pdf version)
Mutation Type splice site (9 bp from exon)
Coordinate34,223,795 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Dst
Gene Name dystonin
Synonym(s) BPAG1-n, ah, athetoid, bullous pemphigoid antigen 1, A830042E19Rik, Macf2, nmf339, Bpag1, nmf203, bullous pemphigoid antigen 1, BPAG1, Bpag, 2310001O04Rik
Chromosomal Location 33,908,225-34,308,661 bp (+)
MGI Phenotype PHENOTYPE: Mutations in this gene produce peripheral nervous system demyelination resulting in impaired muscle function and shorter lifespan. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001276764, NM_134448, NM_133833, NM_010081; MGI:104627

Mapped No 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000095392 ] [ENSMUSP00000095393 ] [ENSMUSP00000110756 ] [ENSMUSP00000138308 ] [ENSMUSP00000141127 ]   † probably from a misspliced transcript
PDB Structure
Crystal Structure of a protease resistant fragment of the plakin domain of Bullous Pemphigoid Antigen1 (BPAG1) [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000095392
Gene: ENSMUSG00000026131

CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.09e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.08e-51 SMART
low complexity region 7224 7242 N/A INTRINSIC
low complexity region 7252 7264 N/A INTRINSIC
low complexity region 7313 7336 N/A INTRINSIC
PDB:3GJO|H 7364 7393 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000095393
Gene: ENSMUSG00000026131

CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 6e-43 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 2e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 2e-62 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
SPEC 1555 1664 2.19e-1 SMART
internal_repeat_6 1757 1797 1.18e-5 PROSPERO
SPEC 1838 1957 1.75e-9 SMART
SPEC 1964 2070 3.7e-8 SMART
SPEC 2077 2176 4.56e-8 SMART
SPEC 2186 2285 3.78e0 SMART
low complexity region 2358 2374 N/A INTRINSIC
SPEC 2433 2538 1.98e-8 SMART
SPEC 2545 2649 3.62e-11 SMART
SPEC 2659 2759 1.65e-5 SMART
SPEC 2766 2868 7.75e-11 SMART
SPEC 2875 2975 2.3e-4 SMART
SPEC 2985 3084 3.01e0 SMART
SPEC 3091 3194 2.74e-2 SMART
SPEC 3201 3305 2.46e-4 SMART
SPEC 3312 3414 1.27e-15 SMART
SPEC 3421 3523 1.54e-14 SMART
SPEC 3530 3632 8.07e-2 SMART
SPEC 3639 3741 3.67e-12 SMART
SPEC 3748 3849 1.97e-12 SMART
SPEC 3856 3962 4.19e-7 SMART
SPEC 3969 4071 2.06e-15 SMART
SPEC 4078 4181 2.89e-10 SMART
SPEC 4188 4290 2.61e-26 SMART
SPEC 4297 4399 5.31e-18 SMART
SPEC 4406 4508 1.25e-14 SMART
SPEC 4515 4618 9.1e-17 SMART
SPEC 4625 4726 9.3e-23 SMART
SPEC 4733 4835 5.43e-15 SMART
SPEC 4845 4975 1.5e-8 SMART
EFh 5009 5037 4.12e-3 SMART
EFh 5045 5073 1.25e-2 SMART
GAS2 5084 5162 3.08e-51 SMART
low complexity region 5210 5228 N/A INTRINSIC
low complexity region 5238 5250 N/A INTRINSIC
low complexity region 5299 5322 N/A INTRINSIC
PDB:3GJO|H 5350 5379 1e-9 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000110756
Gene: ENSMUSG00000026131

CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.08e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.85e-52 SMART
low complexity region 7200 7218 N/A INTRINSIC
low complexity region 7228 7240 N/A INTRINSIC
low complexity region 7326 7349 N/A INTRINSIC
PDB:3GJO|H 7377 7406 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000110756
Gene: ENSMUSG00000026131

CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.08e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.85e-52 SMART
low complexity region 7200 7218 N/A INTRINSIC
low complexity region 7228 7240 N/A INTRINSIC
low complexity region 7326 7349 N/A INTRINSIC
PDB:3GJO|H 7377 7406 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138308
Gene: ENSMUSG00000026131

transmembrane domain 13 35 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
CH 215 314 1.62e-28 SMART
CH 331 428 3.72e-19 SMART
PDB:2ODU|A 439 657 1e-42 PDB
low complexity region 698 723 N/A INTRINSIC
SPEC 780 877 8.64e-9 SMART
SPEC 880 980 2.94e-11 SMART
Blast:SPEC 987 1151 5e-73 BLAST
coiled coil region 1273 1310 N/A INTRINSIC
Blast:SPEC 1354 1463 8e-63 BLAST
SPEC 1470 1599 4.11e0 SMART
SPEC 1617 1716 4.66e0 SMART
PLEC 1715 1759 9.05e-3 SMART
PLEC 1760 1797 2.7e0 SMART
PLEC 1835 1872 2.23e0 SMART
PLEC 1873 1910 4.25e1 SMART
PLEC 1913 1948 1.39e2 SMART
PLEC 1949 1986 7.4e-8 SMART
PLEC 1989 2024 5.8e-1 SMART
PLEC 2025 2062 2.71e1 SMART
PLEC 2064 2100 4.66e0 SMART
low complexity region 2472 2485 N/A INTRINSIC
low complexity region 2544 2559 N/A INTRINSIC
low complexity region 2655 2669 N/A INTRINSIC
low complexity region 2744 2771 N/A INTRINSIC
low complexity region 2839 2853 N/A INTRINSIC
low complexity region 2971 2977 N/A INTRINSIC
low complexity region 3017 3025 N/A INTRINSIC
low complexity region 3224 3235 N/A INTRINSIC
low complexity region 3472 3492 N/A INTRINSIC
SPEC 3499 3605 5.36e-1 SMART
low complexity region 3693 3705 N/A INTRINSIC
low complexity region 3726 3736 N/A INTRINSIC
SPEC 3747 3856 2.19e-1 SMART
internal_repeat_12 3949 3989 5.99e-5 PROSPERO
SPEC 4030 4149 1.75e-9 SMART
SPEC 4156 4262 3.7e-8 SMART
SPEC 4269 4368 4.56e-8 SMART
SPEC 4378 4477 3.78e0 SMART
low complexity region 4550 4566 N/A INTRINSIC
SPEC 4625 4730 1.98e-8 SMART
SPEC 4737 4841 3.62e-11 SMART
SPEC 4851 4951 1.65e-5 SMART
SPEC 4958 5060 7.75e-11 SMART
SPEC 5067 5167 2.3e-4 SMART
SPEC 5177 5276 3.01e0 SMART
SPEC 5283 5386 2.74e-2 SMART
SPEC 5393 5497 2.46e-4 SMART
SPEC 5504 5606 1.27e-15 SMART
SPEC 5613 5715 1.69e-11 SMART
SPEC 5722 5824 9.33e-5 SMART
SPEC 5831 5933 8.07e-2 SMART
SPEC 5940 6042 3.67e-12 SMART
SPEC 6049 6150 1.97e-12 SMART
SPEC 6157 6263 4.19e-7 SMART
SPEC 6270 6372 2.06e-15 SMART
SPEC 6379 6482 2.89e-10 SMART
SPEC 6489 6591 2.61e-26 SMART
SPEC 6598 6700 5.31e-18 SMART
SPEC 6707 6809 1.25e-14 SMART
SPEC 6816 6919 9.1e-17 SMART
SPEC 6926 7027 9.3e-23 SMART
SPEC 7034 7136 5.43e-15 SMART
SPEC 7146 7276 1.5e-8 SMART
EFh 7310 7338 4.12e-3 SMART
EFh 7346 7374 1.25e-2 SMART
GAS2 7385 7463 3.08e-51 SMART
low complexity region 7511 7529 N/A INTRINSIC
low complexity region 7539 7551 N/A INTRINSIC
low complexity region 7637 7660 N/A INTRINSIC
PDB:3GJO|H 7688 7717 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141127
Gene: ENSMUSG00000026131

low complexity region 3 16 N/A INTRINSIC
PDB:2ODU|A 56 153 6e-8 PDB
low complexity region 194 219 N/A INTRINSIC
SPEC 276 373 5.4e-11 SMART
SPEC 376 476 1.8e-13 SMART
Blast:SPEC 483 647 1e-73 BLAST
coiled coil region 769 806 N/A INTRINSIC
Blast:SPEC 850 959 1e-62 BLAST
SPEC 966 1095 2.6e-2 SMART
SPEC 1113 1212 2.9e-2 SMART
SPEC 1229 1338 1.4e-3 SMART
internal_repeat_10 1431 1471 9.93e-6 PROSPERO
SPEC 1512 1631 1.1e-11 SMART
SPEC 1638 1744 2.3e-10 SMART
SPEC 1751 1850 2.9e-10 SMART
SPEC 1860 1959 2.4e-2 SMART
low complexity region 2032 2048 N/A INTRINSIC
SPEC 2107 2212 1.2e-10 SMART
SPEC 2219 2323 2.3e-13 SMART
SPEC 2333 2433 1.1e-7 SMART
SPEC 2440 2542 5e-13 SMART
SPEC 2549 2649 1.4e-6 SMART
SPEC 2659 2758 1.9e-2 SMART
SPEC 2765 2868 1.8e-4 SMART
SPEC 2875 2979 1.5e-6 SMART
SPEC 2986 3088 8.2e-18 SMART
SPEC 3095 3197 1.1e-13 SMART
SPEC 3204 3306 6e-7 SMART
SPEC 3313 3415 5.1e-4 SMART
SPEC 3422 3524 2.3e-14 SMART
SPEC 3531 3632 1.3e-14 SMART
SPEC 3639 3745 2.6e-9 SMART
SPEC 3752 3854 1.3e-17 SMART
SPEC 3861 3964 1.8e-12 SMART
SPEC 3971 4073 1.6e-28 SMART
SPEC 4080 4182 3.3e-20 SMART
SPEC 4189 4291 7.6e-17 SMART
SPEC 4298 4401 5.6e-19 SMART
SPEC 4408 4509 5.9e-25 SMART
SPEC 4516 4618 3.4e-17 SMART
SPEC 4628 4758 9.7e-11 SMART
EFh 4792 4820 2e-5 SMART
EFh 4828 4856 6e-5 SMART
GAS2 4867 4945 9.8e-56 SMART
low complexity region 4969 4987 N/A INTRINSIC
low complexity region 4997 5009 N/A INTRINSIC
low complexity region 5095 5118 N/A INTRINSIC
PDB:3GJO|H 5146 5175 3e-9 PDB
Predicted Effect probably null
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Possibly nonessential (E-score: 0.382) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1a cells in B1 cells - increased
FACS CD11c+ DCs - increased
Candidate Explorer Status CE: failed initial filter
Single pedigree
Linkage Analysis Data
Alleles Listed at MGI

All mutations/alleles(297) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(274) Spontaneous(15) Targeted(3) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Dst APN 1 34251839 missense probably damaging 1.00
IGL00309:Dst APN 1 34160652 missense probably damaging 1.00
IGL00334:Dst APN 1 34166292 missense probably damaging 1.00
IGL00470:Dst APN 1 34188962 missense probably damaging 1.00
IGL00481:Dst APN 1 34169329 splice site probably benign
IGL00499:Dst APN 1 34290423 missense probably damaging 0.99
IGL00803:Dst APN 1 34164124 missense possibly damaging 0.89
IGL00850:Dst APN 1 34306624 missense probably damaging 1.00
IGL00957:Dst APN 1 34228407 missense probably benign 0.27
IGL00975:Dst APN 1 34188312 missense possibly damaging 0.86
IGL00984:Dst APN 1 34256320 missense probably damaging 1.00
IGL01284:Dst APN 1 34163928 missense probably damaging 1.00
IGL01393:Dst APN 1 34167625 missense possibly damaging 0.91
IGL01397:Dst APN 1 34257744 missense probably damaging 1.00
IGL01399:Dst APN 1 34117517 missense probably benign 0.41
IGL01412:Dst APN 1 34242620 missense probably benign 0.21
IGL01527:Dst APN 1 34247653 missense probably damaging 1.00
IGL01537:Dst APN 1 34275320 missense probably damaging 1.00
IGL01618:Dst APN 1 34188909 nonsense probably null
IGL01636:Dst APN 1 34215569 missense probably damaging 1.00
IGL01642:Dst APN 1 34189389 missense probably damaging 1.00
IGL01672:Dst APN 1 34225693 missense probably damaging 1.00
IGL01685:Dst APN 1 34170452 missense probably damaging 0.99
IGL01694:Dst APN 1 34188160 missense probably benign 0.13
IGL01777:Dst APN 1 34199397 missense probably benign 0.07
IGL01800:Dst APN 1 34262092 missense probably damaging 1.00
IGL01811:Dst APN 1 34164092 missense probably damaging 1.00
IGL01960:Dst APN 1 34290489 missense probably damaging 1.00
IGL02031:Dst APN 1 34189917 missense possibly damaging 0.95
IGL02103:Dst APN 1 34190118 missense possibly damaging 0.90
IGL02121:Dst APN 1 34228657 missense probably damaging 1.00
IGL02315:Dst APN 1 34198665 missense probably damaging 1.00
IGL02317:Dst APN 1 34295163 missense probably damaging 1.00
IGL02469:Dst APN 1 34188828 missense probably damaging 1.00
IGL02492:Dst APN 1 34152193 splice site probably benign
IGL02510:Dst APN 1 34229251 splice site probably null
IGL02522:Dst APN 1 34250700 splice site probably benign
IGL02540:Dst APN 1 34135204 missense probably damaging 1.00
IGL02588:Dst APN 1 34117484 missense probably damaging 1.00
IGL02676:Dst APN 1 34307587 missense probably damaging 1.00
IGL02688:Dst APN 1 34195952 missense probably damaging 1.00
IGL02700:Dst APN 1 34262120 missense probably damaging 1.00
IGL02794:Dst APN 1 34270829 missense probably damaging 1.00
IGL02823:Dst APN 1 34192083 missense possibly damaging 0.83
IGL02935:Dst APN 1 34186845 nonsense probably null
IGL02940:Dst APN 1 34289587 missense probably benign 0.36
IGL02994:Dst APN 1 34229252 splice site probably benign
IGL02996:Dst APN 1 34188398 missense possibly damaging 0.93
IGL02998:Dst APN 1 34268275 missense probably damaging 1.00
IGL03027:Dst APN 1 34186025 missense possibly damaging 0.51
IGL03033:Dst APN 1 34169745 splice site probably benign
IGL03099:Dst APN 1 34275781 missense probably damaging 1.00
IGL03119:Dst APN 1 34161062 missense probably damaging 1.00
IGL03121:Dst APN 1 34217803 splice site probably benign
IGL03132:Dst APN 1 34256641 missense probably benign 0.06
IGL03220:Dst APN 1 34185995 missense probably damaging 0.99
IGL03230:Dst APN 1 34184052 nonsense probably null
IGL03245:Dst APN 1 34211148 splice site probably null
IGL03380:Dst APN 1 34257800 missense probably damaging 1.00
Doodle UTSW 1 34208558 nonsense probably null
gobble UTSW 1 34165155 critical splice donor site probably null
tinsel UTSW 1 34164167 missense probably damaging 1.00
Wastable UTSW 1 34295289 missense probably damaging 1.00
E0370:Dst UTSW 1 34249471 splice site probably benign
FR4304:Dst UTSW 1 34200964 missense probably damaging 0.99
IGL02799:Dst UTSW 1 34179849 missense possibly damaging 0.92
R0006:Dst UTSW 1 34228918 missense probably benign 0.30
R0006:Dst UTSW 1 34228918 missense probably benign 0.30
R0023:Dst UTSW 1 34189119 missense probably damaging 1.00
R0023:Dst UTSW 1 34189119 missense probably damaging 1.00
R0024:Dst UTSW 1 34189119 missense probably damaging 1.00
R0027:Dst UTSW 1 34189119 missense probably damaging 1.00
R0049:Dst UTSW 1 34275781 missense probably damaging 1.00
R0053:Dst UTSW 1 34294550 splice site probably null
R0053:Dst UTSW 1 34294550 splice site probably null
R0058:Dst UTSW 1 34006224 missense possibly damaging 0.93
R0066:Dst UTSW 1 34189553 missense possibly damaging 0.67
R0066:Dst UTSW 1 34189553 missense possibly damaging 0.67
R0085:Dst UTSW 1 34229187 missense probably damaging 1.00
R0125:Dst UTSW 1 34270903 missense probably damaging 1.00
R0152:Dst UTSW 1 34189119 missense probably damaging 1.00
R0165:Dst UTSW 1 34154646 splice site probably benign
R0172:Dst UTSW 1 34270854 missense probably damaging 1.00
R0207:Dst UTSW 1 34186935 missense probably benign 0.02
R0219:Dst UTSW 1 34303478 missense probably damaging 0.99
R0349:Dst UTSW 1 34199553 missense probably benign 0.12
R0386:Dst UTSW 1 34217836 missense probably damaging 1.00
R0389:Dst UTSW 1 34294550 splice site probably null
R0395:Dst UTSW 1 34189119 missense probably damaging 1.00
R0423:Dst UTSW 1 34278035 missense possibly damaging 0.95
R0443:Dst UTSW 1 34294550 splice site probably null
R0472:Dst UTSW 1 34266960 critical splice donor site probably null
R0490:Dst UTSW 1 34307368 nonsense probably null
R0513:Dst UTSW 1 34219531 splice site probably benign
R0539:Dst UTSW 1 34189119 missense probably damaging 1.00
R0562:Dst UTSW 1 34227981 missense probably damaging 1.00
R0569:Dst UTSW 1 34293427 missense probably damaging 1.00
R0600:Dst UTSW 1 34189119 missense probably damaging 1.00
R0608:Dst UTSW 1 34290356 splice site probably null
R0609:Dst UTSW 1 34266960 critical splice donor site probably null
R0630:Dst UTSW 1 34193450 missense probably benign 0.05
R0630:Dst UTSW 1 34199473 missense probably damaging 0.98
R0632:Dst UTSW 1 34271413 missense probably damaging 1.00
R0713:Dst UTSW 1 34189119 missense probably damaging 1.00
R0724:Dst UTSW 1 34188677 missense probably benign 0.00
R0761:Dst UTSW 1 34182767 missense probably benign 0.33
R0801:Dst UTSW 1 34170389 missense probably damaging 0.99
R0829:Dst UTSW 1 34163220 missense probably damaging 1.00
R0939:Dst UTSW 1 34244383 missense probably damaging 1.00
R0945:Dst UTSW 1 34271419 missense probably damaging 1.00
R0992:Dst UTSW 1 34199536 missense probably damaging 0.97
R1018:Dst UTSW 1 34194093 missense probably damaging 1.00
R1077:Dst UTSW 1 34164167 missense probably damaging 1.00
R1079:Dst UTSW 1 34186863 missense possibly damaging 0.86
R1127:Dst UTSW 1 34275277 missense probably damaging 1.00
R1129:Dst UTSW 1 34199554 missense probably benign 0.28
R1141:Dst UTSW 1 34188696 missense possibly damaging 0.85
R1167:Dst UTSW 1 34223858 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1333:Dst UTSW 1 34228347 missense probably damaging 1.00
R1352:Dst UTSW 1 34229248 critical splice donor site probably null
R1365:Dst UTSW 1 34188194 missense probably benign 0.02
R1382:Dst UTSW 1 34268833 missense probably damaging 0.99
R1389:Dst UTSW 1 34211232 missense probably damaging 1.00
R1394:Dst UTSW 1 34165155 critical splice donor site probably null
R1395:Dst UTSW 1 34165155 critical splice donor site probably null
R1435:Dst UTSW 1 34113945 missense probably damaging 1.00
R1450:Dst UTSW 1 34188395 missense probably damaging 1.00
R1450:Dst UTSW 1 34212259 missense probably damaging 0.99
R1453:Dst UTSW 1 34189446 missense possibly damaging 0.85
R1479:Dst UTSW 1 34264515 splice site probably null
R1483:Dst UTSW 1 34252998 missense probably damaging 1.00
R1491:Dst UTSW 1 34154594 missense probably damaging 0.99
R1536:Dst UTSW 1 34260372 splice site probably benign
R1551:Dst UTSW 1 34192212 missense probably benign 0.01
R1573:Dst UTSW 1 34201231 missense probably damaging 1.00
R1614:Dst UTSW 1 34275263 missense probably damaging 1.00
R1615:Dst UTSW 1 34199371 missense probably damaging 1.00
R1645:Dst UTSW 1 34225722 missense probably damaging 1.00
R1655:Dst UTSW 1 34282576 nonsense probably null
R1663:Dst UTSW 1 34163385 missense probably damaging 1.00
R1674:Dst UTSW 1 34223795 splice site probably null
R1702:Dst UTSW 1 34167340 missense probably damaging 1.00
R1707:Dst UTSW 1 34167646 missense probably damaging 1.00
R1747:Dst UTSW 1 34160709 missense probably damaging 1.00
R1760:Dst UTSW 1 34228603 missense probably damaging 1.00
R1773:Dst UTSW 1 34291899 missense probably damaging 0.99
R1793:Dst UTSW 1 34152471 nonsense probably null
R1842:Dst UTSW 1 34164119 missense probably null 0.98
R1869:Dst UTSW 1 34252832 missense probably damaging 0.99
R1879:Dst UTSW 1 34188843 missense probably benign 0.15
R1883:Dst UTSW 1 34189308 missense possibly damaging 0.74
R1912:Dst UTSW 1 34291850 missense probably damaging 1.00
R1920:Dst UTSW 1 34161029 missense probably damaging 0.99
R1921:Dst UTSW 1 34161029 missense probably damaging 0.99
R1943:Dst UTSW 1 34228369 missense possibly damaging 0.67
R1958:Dst UTSW 1 34163721 missense probably damaging 1.00
R1962:Dst UTSW 1 34191016 missense possibly damaging 0.47
R1991:Dst UTSW 1 34190258 missense probably benign 0.11
R1998:Dst UTSW 1 34256347 missense probably damaging 1.00
R2001:Dst UTSW 1 34184063 missense probably damaging 0.97
R2007:Dst UTSW 1 34226012 splice site probably benign
R2021:Dst UTSW 1 34166291 missense possibly damaging 0.70
R2022:Dst UTSW 1 34166291 missense possibly damaging 0.70
R2035:Dst UTSW 1 34271413 missense probably damaging 1.00
R2077:Dst UTSW 1 34211170 missense probably damaging 1.00
R2103:Dst UTSW 1 34190258 missense probably benign 0.11
R2111:Dst UTSW 1 34169178 missense probably damaging 1.00
R2112:Dst UTSW 1 34169178 missense probably damaging 1.00
R2113:Dst UTSW 1 34275236 missense probably damaging 0.97
R2201:Dst UTSW 1 34195921 missense possibly damaging 0.60
R2214:Dst UTSW 1 34271401 missense probably damaging 1.00
R2219:Dst UTSW 1 34170433 missense probably damaging 1.00
R2233:Dst UTSW 1 34274262 missense probably damaging 1.00
R2267:Dst UTSW 1 34295466 missense probably damaging 1.00
R2290:Dst UTSW 1 34229200 missense probably damaging 1.00
R2323:Dst UTSW 1 34228437 missense possibly damaging 0.93
R2424:Dst UTSW 1 34167060 missense probably damaging 1.00
R2426:Dst UTSW 1 34192812 missense probably benign 0.03
R2495:Dst UTSW 1 34199373 missense probably damaging 0.99
R2507:Dst UTSW 1 34011909 missense probably damaging 0.98
R2507:Dst UTSW 1 34188417 missense possibly damaging 0.85
R2510:Dst UTSW 1 34212286 missense probably benign
R2831:Dst UTSW 1 34275292 missense probably damaging 1.00
R2929:Dst UTSW 1 34167062 nonsense probably null
R3033:Dst UTSW 1 34152285 missense probably damaging 0.99
R3121:Dst UTSW 1 34289648 missense probably damaging 1.00
R3424:Dst UTSW 1 34198505 splice site probably benign
R3437:Dst UTSW 1 34190222 missense probably damaging 1.00
R3699:Dst UTSW 1 34213074 splice site probably benign
R3739:Dst UTSW 1 34268894 splice site probably benign
R3796:Dst UTSW 1 34181915 missense probably benign 0.15
R3847:Dst UTSW 1 34212319 missense probably damaging 1.00
R3848:Dst UTSW 1 34212319 missense probably damaging 1.00
R3849:Dst UTSW 1 34212319 missense probably damaging 1.00
R3850:Dst UTSW 1 34189274 nonsense probably null
R3850:Dst UTSW 1 34212319 missense probably damaging 1.00
R3873:Dst UTSW 1 34289620 missense probably damaging 1.00
R3875:Dst UTSW 1 34171247 missense probably damaging 1.00
R3973:Dst UTSW 1 34011898 missense probably benign 0.34
R4014:Dst UTSW 1 34191282 nonsense probably null
R4043:Dst UTSW 1 34190684 missense probably benign 0.03
R4057:Dst UTSW 1 34186054 splice site probably benign
R4074:Dst UTSW 1 34192269 missense probably benign 0.20
R4074:Dst UTSW 1 34228461 missense probably damaging 0.97
R4075:Dst UTSW 1 34192269 missense probably benign 0.20
R4076:Dst UTSW 1 34192269 missense probably benign 0.20
R4206:Dst UTSW 1 34212247 missense probably damaging 1.00
R4230:Dst UTSW 1 34195828 missense probably benign 0.04
R4242:Dst UTSW 1 34006216 missense possibly damaging 0.88
R4273:Dst UTSW 1 34192340 missense possibly damaging 0.72
R4366:Dst UTSW 1 34251878 missense probably damaging 1.00
R4370:Dst UTSW 1 34251728 frame shift probably null
R4379:Dst UTSW 1 34163235 missense probably damaging 1.00
R4379:Dst UTSW 1 34227975 missense probably benign 0.07
R4380:Dst UTSW 1 34163235 missense probably damaging 1.00
R4381:Dst UTSW 1 34163235 missense probably damaging 1.00
R4423:Dst UTSW 1 34188393 missense possibly damaging 0.76
R4427:Dst UTSW 1 34181460 missense probably benign 0.19
R4456:Dst UTSW 1 34190719 missense probably benign 0.06
R4469:Dst UTSW 1 34191842 missense probably benign 0.02
R4502:Dst UTSW 1 34247691 missense probably damaging 0.99
R4503:Dst UTSW 1 34262253 critical splice donor site probably null
R4545:Dst UTSW 1 34188738 missense probably damaging 0.99
R4610:Dst UTSW 1 34169856 missense probably damaging 1.00
R4633:Dst UTSW 1 34170434 missense probably damaging 1.00
R4675:Dst UTSW 1 34275703 missense possibly damaging 0.94
R4687:Dst UTSW 1 34201123 missense probably damaging 1.00
R4739:Dst UTSW 1 34191147 missense probably benign 0.01
R4751:Dst UTSW 1 34191884 missense probably benign 0.21
R4754:Dst UTSW 1 34212309 missense probably damaging 1.00
R4771:Dst UTSW 1 34249484 missense probably damaging 1.00
R4819:Dst UTSW 1 33968835 missense probably benign 0.03
R4830:Dst UTSW 1 34198505 splice site probably null
R4839:Dst UTSW 1 34190862 missense probably damaging 0.96
R4845:Dst UTSW 1 34193127 missense probably benign 0.02
R4904:Dst UTSW 1 34169798 missense probably damaging 0.99
R4932:Dst UTSW 1 34228683 missense possibly damaging 0.47
R4934:Dst UTSW 1 34208588 missense probably damaging 1.00
R4952:Dst UTSW 1 34271422 missense probably damaging 1.00
R4961:Dst UTSW 1 33968823 missense possibly damaging 0.53
R4976:Dst UTSW 1 34195969 nonsense probably null
R4980:Dst UTSW 1 34256288 missense probably damaging 1.00
R5011:Dst UTSW 1 34250647 missense probably damaging 1.00
R5013:Dst UTSW 1 34250647 missense probably damaging 1.00
R5059:Dst UTSW 1 34163346 missense possibly damaging 0.70
R5074:Dst UTSW 1 34295263 missense probably damaging 1.00
R5114:Dst UTSW 1 34202559 missense probably damaging 0.98
R5119:Dst UTSW 1 34195969 nonsense probably null
R5182:Dst UTSW 1 34179086 missense probably benign
R5236:Dst UTSW 1 34164417 missense probably damaging 1.00
R5240:Dst UTSW 1 34208558 nonsense probably null
R5254:Dst UTSW 1 34177931 nonsense probably null
R5275:Dst UTSW 1 34180148 missense probably benign 0.13
R5281:Dst UTSW 1 34257782 missense probably benign 0.29
R5299:Dst UTSW 1 34135092 missense probably damaging 1.00
R5316:Dst UTSW 1 34223848 missense probably damaging 0.97
R5319:Dst UTSW 1 34225977 missense possibly damaging 0.95
R5425:Dst UTSW 1 34179750 missense probably benign 0.00
R5443:Dst UTSW 1 34228539 missense probably damaging 1.00
R5522:Dst UTSW 1 34257873 missense possibly damaging 0.46
R5537:Dst UTSW 1 34189878 missense probably benign 0.25
R5548:Dst UTSW 1 34189328 missense probably benign
R5557:Dst UTSW 1 34282586 missense probably damaging 1.00
R5597:Dst UTSW 1 34192713 missense probably benign 0.07
R5623:Dst UTSW 1 34190133 missense possibly damaging 0.56
R5630:Dst UTSW 1 34188785 frame shift probably null
R5660:Dst UTSW 1 34282493 missense probably damaging 1.00
R5730:Dst UTSW 1 34117526 unclassified probably null
R5762:Dst UTSW 1 34179357 missense probably damaging 0.99
R5810:Dst UTSW 1 34183040 intron probably benign
R5816:Dst UTSW 1 34179234 missense probably benign
R5846:Dst UTSW 1 34195861 nonsense probably null
R5874:Dst UTSW 1 34179589 missense probably damaging 0.98
R5899:Dst UTSW 1 34295289 missense probably damaging 1.00
R5923:Dst UTSW 1 34181759 missense probably benign 0.00
R5936:Dst UTSW 1 34307458 missense probably damaging 1.00
R5946:Dst UTSW 1 34174192 missense probably benign 0.01
R5950:Dst UTSW 1 34262060 missense probably damaging 1.00
R5958:Dst UTSW 1 34186050 missense probably damaging 0.97
R5973:Dst UTSW 1 34156857 missense probably damaging 1.00
R5979:Dst UTSW 1 34160372 intron probably benign
R5980:Dst UTSW 1 34182891 missense probably benign 0.34
R5984:Dst UTSW 1 34172263 missense probably benign 0.05
R6000:Dst UTSW 1 34212223 missense possibly damaging 0.92
R6014:Dst UTSW 1 34264834 missense probably damaging 1.00
R6042:Dst UTSW 1 34188972 missense probably damaging 1.00
R6064:Dst UTSW 1 34194051 missense probably damaging 1.00
R6126:Dst UTSW 1 34228183 missense probably damaging 1.00
R6157:Dst UTSW 1 34211172 missense probably damaging 1.00
R6162:Dst UTSW 1 34006237 missense probably damaging 0.99
R6185:Dst UTSW 1 34173080 missense probably damaging 0.99
R6226:Dst UTSW 1 34270874 missense probably damaging 1.00
R6227:Dst UTSW 1 34194540 missense probably benign 0.41
R6232:Dst UTSW 1 34188172 missense probably damaging 1.00
R6259:Dst UTSW 1 34182396 missense probably benign 0.26
R6267:Dst UTSW 1 34228672 missense probably damaging 1.00
R6273:Dst UTSW 1 34275266 missense probably damaging 1.00
R6284:Dst UTSW 1 34229085 missense probably damaging 1.00
R6347:Dst UTSW 1 34179684 unclassified probably null
R6365:Dst UTSW 1 34191927 missense probably damaging 1.00
R6385:Dst UTSW 1 34307468 missense possibly damaging 0.85
R6389:Dst UTSW 1 34193184 missense probably damaging 0.99
R6395:Dst UTSW 1 34182690 missense probably benign 0.17
R6416:Dst UTSW 1 34116128 missense probably damaging 1.00
R6467:Dst UTSW 1 34295196 missense probably damaging 1.00
R6470:Dst UTSW 1 34295237 missense probably damaging 1.00
R6477:Dst UTSW 1 34208728 intron probably null
R6485:Dst UTSW 1 34294529 missense probably damaging 1.00
R6491:Dst UTSW 1 34193012 missense probably benign 0.10
R6525:Dst UTSW 1 34163135 missense probably damaging 1.00
R6533:Dst UTSW 1 34303509 missense probably benign 0.08
R6595:Dst UTSW 1 34250680 missense probably damaging 1.00
R6622:Dst UTSW 1 34179251 missense probably benign 0.22
R6646:Dst UTSW 1 34268807 missense possibly damaging 0.80
R6648:Dst UTSW 1 34262041 missense possibly damaging 0.84
R6700:Dst UTSW 1 34256323 missense probably damaging 1.00
R6743:Dst UTSW 1 34270890 missense probably damaging 1.00
R6761:Dst UTSW 1 34214550 missense probably damaging 1.00
R6766:Dst UTSW 1 34294483 missense probably damaging 1.00
R6768:Dst UTSW 1 34181712 missense probably damaging 0.98
R6810:Dst UTSW 1 34212298 missense probably damaging 1.00
R6815:Dst UTSW 1 34228369 missense possibly damaging 0.67
R6820:Dst UTSW 1 34211256 missense probably damaging 1.00
R6822:Dst UTSW 1 34275674 missense probably damaging 0.99
R6831:Dst UTSW 1 34190684 missense probably benign 0.03
R6874:Dst UTSW 1 34289651 missense probably benign 0.29
R6945:Dst UTSW 1 34190490 missense probably damaging 1.00
R6985:Dst UTSW 1 34190853 missense probably benign 0.08
R6995:Dst UTSW 1 34166234 missense probably damaging 1.00
R7038:Dst UTSW 1 34182798 nonsense probably null
R7043:Dst UTSW 1 34257911 missense probably damaging 0.99
R7070:Dst UTSW 1 34275302 missense probably damaging 1.00
R7097:Dst UTSW 1 34169260 missense probably damaging 1.00
R7139:Dst UTSW 1 34299807 missense probably damaging 0.97
R7144:Dst UTSW 1 34152243 missense probably damaging 1.00
R7145:Dst UTSW 1 34189882 missense probably benign
R7158:Dst UTSW 1 34274285 missense probably benign
R7207:Dst UTSW 1 34163337 missense probably damaging 0.98
R7320:Dst UTSW 1 34191094 missense probably benign
R7324:Dst UTSW 1 34006224 missense possibly damaging 0.93
R7327:Dst UTSW 1 34201405 missense probably damaging 1.00
R7340:Dst UTSW 1 34190729 missense probably benign 0.01
R7358:Dst UTSW 1 34191673 missense probably benign
R7373:Dst UTSW 1 34188391 missense probably benign 0.02
R7376:Dst UTSW 1 34192689 missense probably benign
R7453:Dst UTSW 1 34191358 missense possibly damaging 0.95
R7467:Dst UTSW 1 34191155 missense probably benign 0.00
R7471:Dst UTSW 1 34194570 missense possibly damaging 0.49
R7472:Dst UTSW 1 34218497 missense probably benign 0.02
R7485:Dst UTSW 1 34274189 missense probably benign 0.31
R7504:Dst UTSW 1 34201017 missense probably damaging 1.00
R7516:Dst UTSW 1 34170479 missense probably benign 0.10
R7524:Dst UTSW 1 34291893 missense possibly damaging 0.94
R7528:Dst UTSW 1 34294522 missense probably damaging 1.00
R7560:Dst UTSW 1 34182451 missense possibly damaging 0.92
R7582:Dst UTSW 1 34169883 missense probably damaging 1.00
R7585:Dst UTSW 1 34114015 missense possibly damaging 0.50
R7594:Dst UTSW 1 34213013 missense probably damaging 1.00
R7600:Dst UTSW 1 34266930 missense probably damaging 1.00
R7619:Dst UTSW 1 34199428 missense probably benign 0.02
R7623:Dst UTSW 1 34170436 missense probably damaging 0.99
R7649:Dst UTSW 1 34167697 missense probably benign 0.13
R7654:Dst UTSW 1 34228977 missense probably damaging 1.00
R7654:Dst UTSW 1 34228978 missense probably damaging 1.00
R7661:Dst UTSW 1 34256353 critical splice donor site probably null
R7667:Dst UTSW 1 34179035 missense possibly damaging 0.82
R7677:Dst UTSW 1 34169322 critical splice donor site probably null
R7698:Dst UTSW 1 34190387 missense probably benign 0.02
R7765:Dst UTSW 1 34275694 missense probably damaging 0.97
R7772:Dst UTSW 1 34181388 missense possibly damaging 0.90
R7779:Dst UTSW 1 34194597 missense probably damaging 0.99
R7791:Dst UTSW 1 34154592 missense probably damaging 0.99
R7821:Dst UTSW 1 34275362 critical splice donor site probably null
RF014:Dst UTSW 1 34247679 missense probably benign 0.00
X0026:Dst UTSW 1 34213055 missense probably damaging 0.97
X0028:Dst UTSW 1 34192199 missense probably damaging 1.00
X0063:Dst UTSW 1 34195895 missense probably damaging 1.00
X0066:Dst UTSW 1 34275703 nonsense probably null
Mode of Inheritance Unknown
Local Stock
MMRRC Submission 038169-MU
Last Updated 2019-10-23 1:57 PM by Anne Murray
Record Created 2014-09-24 2:37 PM by Carlos Reyna
Record Posted 2015-03-03
Phenotypic Description

Figure 1. The phenotype of the phelps mice.

The phelps phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1674, some of which showed an ataxic gait and an inability to walk (Figure 1). 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 96 mutations. A mutation in Dst was presumed to be causative because the phelps phenotype mirrored those of other Dst alleles (see gobble, tinsel, and MGI). The Dst mutation is a T to A transversion at base pair 34,223,795 (v38) on chromosome 1, or base pair 315,589 in the GenBank genomic region NC_000067 affecting the acceptor splice site of intron 54 in the longest isoform (NM_134448). The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 200-base pair exon 55 (out of 98 total exons) causing a frame-shift, coding of 13 aberrant amino acids followed by a premature stop codon after amino acid 4,546.


             <--exon 54         <--intron 54 exon 55-->      exon 56-->
4529   -A--L--A--E--M--……                    D--T--K--W--Q-……D--S--A--A--R-……-E--S--S--V--*  4546
         correct                                 deleted                aberrant


Genomic numbering corresponds to NC_000067. The acceptor splice site of intron 54, which is affected by the phelps mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 2. Dst encodes several DST isoforms. The DST-b1, -a1, and e isoforms are shown. Alternative splicing of the first 5' exons yields three dystonin-a/b isoforms (e.g., DST-a1, DST-a2, and DST-a3 and DST-b1, DST-b2, and DST-b3, respectively). Dystonin-a/b1 contain a unique N-terminal region followed by CH1 and CH2 domains in tandem. Dystonin-a/b2 (not shown) contain a highly conserved N-terminal transmembrane (TM) domain followed by a CH1 and CH2 domain in tandem. Dystonin-a/b3 (not shown) harbor a conserved myristoylation motif (myr) followed by a single CH2 domain. The spectrin domain contains several plectin and spectrin repeats. See the text for more details. The phelps mutation is within intron 54 and is predicted to affect the DST-a and DST-b isoforms only; mutation is shown in the DST-b1 isoform only. Image is interactive; click to view other Dst mutations. Abbreviations: SPEC, spectrin repeat domain; EF, EF hands; CH1/2, calponin homology domains; IFBD, intermediate filament-binding domain, PRD, plakin-repeat domain.

Dst encodes dystonin (DST) [alternatively, bullous pemphigoid antigen 1 (Bpag1), a member of the plakin family of proteins [(1); Figure 2]. DST has an N-terminal plakin domain as well as different combinations of structural domains including an actin-binding domain (ABD), a spectrin-repeat (SR)-containing rod domain, and a microtubule-binding domain (MTBD). Dst encodes three tissue-specific DST isoforms, including a neuronal isoform (DST-a), a muscle isoform (DST-b), and an epithelial isoform (DST-e) [(1-4); reviewed in (5)]. DST-e has the plakin domain, rod domain, and a C-terminal intermediate filament-binding domain/plakin-repeat domain 2 (IFBD/PRD2) only (6). The DST-a and DST-b isoforms share similar domains including the ABD, plakin, and rod domains as well as the EF hand calcium-binding motifs and a growth arrest specific protein 2 (GAS2) related (GAR) domain that contains a MTBD and a Gly-Ser-Arg (GSR) repeat region (2;6). DST-b differs from DST-a in that DST-b has a putative IFBD/PRD2 domain following the plakin domain. Alternative splicing of 5’ exons in Dst results in three tissue-specific isoforms in muscle (i.e., DST-b1/2/3) and neurons (i.e., DST-a1/2/3) [(2;7;8); reviewed in (5)]. Each DST isoform has different domains upstream of the ABD (1;9). The unique N-terminal domains in the DST-a isoforms facilitate cell-specific localization and function (8;10-12). DST-a2/b2 have an N-terminal transmembrane domain upstream of tandem calponin-homology (CH)1/CH2 domains (7). The DST-a1/b1 isoforms lack N-terminal transmembrane domains, but have CH1 and CH2 domains [reviewed in (5)]. The DST-a3/b3 isoforms do not have a transmembrane domain or a CH1 domain, but have a myristoylation motif followed by one CH2 domain [reviewed in (5)]. The phelps mutation affects the SR-containing rod domain and is predicted to result in the loss of the C-terminus of DST including several of the SR domains, the EF hand calcium-binding domain, and the MTBD in the DST-a and DST-b isoforms only.


Please see the record gobble for more information about Dst.

Putative Mechanism

Proteins in the plakin family are scaffold proteins that link intermediate filaments to desmosomes and hemidesmosomes to regulate cytoskeletal dynamics, cell migration, differentiation, and stress responses (8;13). Homozygous mutations in DST that cause loss of DST-a1/2/3 expression have been documented to cause hereditary sensory and autonomic neuropathy type 6 (HSAN6) (14;15). Patients with HSAN6 exhibit limb contractures and dysautonomia; HSAN6 is ultimately fatal (15). A mutation within the MTBD of the DST-a/b isoforms leads to sensory autonomic neuropathy with dysautonomia, severe psychomotor retardation, and early death (14). Collectively, the phenotype of mice with mutations in Dst is referred to as dystonia musculorum (dt) and is characterized by sensory neuron degeneration, ataxia, tremor, muscle weakness, low body weights, and reduced numbers of motor neurons at approximately 2 weeks after birth (16-19). The phenotype of the phelps mice indicates that the mutation results in loss of function in the DST protein(s). The expression and localization of DSTphelps has not been examined.

Primers PCR Primer

Sequencing Primer
Phelps_seq_F: gagatgtagcttagggtcatgc

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 486 nucleotides is amplified (chromosome 1, + strand):

1   agcgaccggc atcttattat ggcgggctca tgatctaacg tgtagtccat gtatcatctc
61  acacaagtac ttcttgtaag ttggaattaa taggaagggg ggttaccaga tgtgaacaag
121 ctagagatgt agcttagggt catgcttgcc tagtaccaag gccctaggtt tacattctaa
181 caaagggaac aagaggaatg ccatctatta tgtatcgttt gaatacatag ttacagtttt
241 ctgatggtga tattaaatga agaaaaaaag aaaagaaaac aaatagcagc ttggtccttt
301 ttcttgtttt cagacactaa gtggcaagag ctcaaccagt tgaccatgga caggcaacaa
361 aagctggaag agtcctccaa taatctaacc cagttccaga ccacagaggc ccagttaaaa
421 cagtggctca tggagaagga gctgatggtc agcgtgctcg gccccttgtc cattgaccca
481 aacatg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna Tiana Purrington