Phenotypic Mutation 'sweetie' (pdf version)
Allelesweetie
Mutation Type missense
Chromosome17
Coordinate43,450,983 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Adgrf5
Gene Name adhesion G protein-coupled receptor F5
Synonym(s) Gpr116, 8430401C09Rik
Chromosomal Location 43,360,451-43,459,557 bp (+)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001081178; MGI:2182928

MappedYes 
Amino Acid Change Serine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000109229] [ENSMUSP00000153373] [ENSMUSP00000153049]
AlphaFold G5E8Q8
SMART Domains Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: S1190C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 118 161 8e-14 BLAST
Pfam:SEA 165 263 9.2e-14 PFAM
IG 276 366 1.54e-4 SMART
Blast:IG_like 374 464 2e-31 BLAST
IG 475 561 1.04e-1 SMART
low complexity region 815 823 N/A INTRINSIC
GPS 949 1004 6.49e-16 SMART
Pfam:7tm_2 1011 1264 1.2e-35 PFAM
low complexity region 1328 1347 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
(Using ENSMUST00000113599)
Predicted Effect possibly damaging

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
(Using ENSMUST00000225962)
Predicted Effect probably damaging

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
(Using ENSMUST00000226087)
Meta Mutation Damage Score 0.6467 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotype question? Literature verified References
30 min GTT hyperglycemic 22971422
Candidate Explorer Status CE: not good candidate; Verification probability: 0.034; ML prob: 0.038; human score: -1.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(8) : Targeted(8)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adgrf5 APN 17 43449915 missense possibly damaging 0.79
IGL00590:Adgrf5 APN 17 43453147 missense probably damaging 1.00
IGL01128:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01131:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01132:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01392:Adgrf5 APN 17 43450012 missense probably benign 0.00
IGL01475:Adgrf5 APN 17 43450354 missense probably benign 0.00
IGL01614:Adgrf5 APN 17 43424471 missense possibly damaging 0.53
IGL01654:Adgrf5 APN 17 43451170 missense possibly damaging 0.89
IGL02053:Adgrf5 APN 17 43450167 missense possibly damaging 0.47
IGL02175:Adgrf5 APN 17 43451010 missense probably damaging 1.00
IGL02416:Adgrf5 APN 17 43444980 splice site probably null
IGL02525:Adgrf5 APN 17 43449963 missense probably damaging 1.00
IGL03035:Adgrf5 APN 17 43430627 missense possibly damaging 0.80
duct_tape UTSW 17 43445115 missense probably benign 0.04
Flypaper UTSW 17 43422661 splice site probably benign
Heaped UTSW 17 43447036 missense possibly damaging 0.93
la_brea UTSW 17 43452323 critical splice donor site probably null
Motel UTSW 17 43450380 missense probably damaging 1.00
noel UTSW 17 43430612 missense probably damaging 1.00
Schmutzfinger UTSW 17 43424818 nonsense probably null
sticky UTSW 17 43437571 missense probably damaging 0.98
PIT4812001:Adgrf5 UTSW 17 43450369 missense probably damaging 1.00
R0699:Adgrf5 UTSW 17 43422661 splice site probably null
R0972:Adgrf5 UTSW 17 43450983 missense probably damaging 0.96
R1521:Adgrf5 UTSW 17 43430552 missense probably benign 0.03
R1523:Adgrf5 UTSW 17 43450153 missense probably benign 0.00
R1758:Adgrf5 UTSW 17 43424593 critical splice donor site probably null
R1767:Adgrf5 UTSW 17 43450564 missense possibly damaging 0.87
R1799:Adgrf5 UTSW 17 43440067 missense probably damaging 0.98
R1800:Adgrf5 UTSW 17 43451082 missense probably damaging 1.00
R1888:Adgrf5 UTSW 17 43427005 splice site probably null
R1888:Adgrf5 UTSW 17 43427005 splice site probably null
R2057:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2058:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2059:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2410:Adgrf5 UTSW 17 43455266 missense probably benign 0.11
R2568:Adgrf5 UTSW 17 43437671 missense probably damaging 1.00
R2847:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R2848:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R3800:Adgrf5 UTSW 17 43447060 splice site probably benign
R3856:Adgrf5 UTSW 17 43447036 missense possibly damaging 0.93
R4021:Adgrf5 UTSW 17 43430714 splice site probably benign
R4075:Adgrf5 UTSW 17 43450195 missense probably damaging 1.00
R4366:Adgrf5 UTSW 17 43441969 missense probably damaging 0.99
R4409:Adgrf5 UTSW 17 43441847 missense probably damaging 1.00
R4570:Adgrf5 UTSW 17 43445115 missense probably benign 0.04
R4616:Adgrf5 UTSW 17 43452440 missense probably benign 0.38
R4623:Adgrf5 UTSW 17 43450983 missense probably benign 0.16
R4645:Adgrf5 UTSW 17 43437525 missense probably damaging 1.00
R5211:Adgrf5 UTSW 17 43422620 missense probably benign 0.32
R5268:Adgrf5 UTSW 17 43450999 missense probably damaging 1.00
R5280:Adgrf5 UTSW 17 43426334 missense probably damaging 1.00
R5326:Adgrf5 UTSW 17 43440074 missense probably damaging 0.98
R5762:Adgrf5 UTSW 17 43430695 missense probably null 0.16
R5856:Adgrf5 UTSW 17 43446120 missense probably benign 0.09
R6007:Adgrf5 UTSW 17 43437571 missense probably damaging 0.98
R6153:Adgrf5 UTSW 17 43451083 missense possibly damaging 0.96
R6451:Adgrf5 UTSW 17 43424818 nonsense probably null
R6535:Adgrf5 UTSW 17 43440029 missense probably benign 0.05
R6536:Adgrf5 UTSW 17 43422661 splice site probably benign
R6602:Adgrf5 UTSW 17 43450304 missense probably benign 0.32
R6882:Adgrf5 UTSW 17 43450380 missense probably damaging 1.00
R6992:Adgrf5 UTSW 17 43452323 critical splice donor site probably null
R7137:Adgrf5 UTSW 17 43450897 missense probably damaging 1.00
R7170:Adgrf5 UTSW 17 43446138 missense possibly damaging 0.92
R7313:Adgrf5 UTSW 17 43445083 missense probably benign 0.01
R7313:Adgrf5 UTSW 17 43452477 critical splice donor site probably null
R7331:Adgrf5 UTSW 17 43437593 missense probably damaging 0.99
R7346:Adgrf5 UTSW 17 43451179 missense probably damaging 1.00
R7350:Adgrf5 UTSW 17 43428444 critical splice acceptor site probably null
R7667:Adgrf5 UTSW 17 43446039 missense probably benign 0.01
R7717:Adgrf5 UTSW 17 43450753 missense probably damaging 1.00
R7731:Adgrf5 UTSW 17 43450560 missense probably damaging 1.00
R7877:Adgrf5 UTSW 17 43441838 missense possibly damaging 0.63
R7950:Adgrf5 UTSW 17 43451157 missense probably damaging 0.99
R7988:Adgrf5 UTSW 17 43439813 intron probably benign
R8188:Adgrf5 UTSW 17 43430612 missense probably damaging 1.00
R8219:Adgrf5 UTSW 17 43449859 missense probably benign 0.13
R8284:Adgrf5 UTSW 17 43455270 missense unknown
R8460:Adgrf5 UTSW 17 43439808 intron probably benign
R8504:Adgrf5 UTSW 17 43446949 missense probably benign 0.01
R8751:Adgrf5 UTSW 17 43437683 missense possibly damaging 0.80
R8852:Adgrf5 UTSW 17 43453098 missense possibly damaging 0.82
X0017:Adgrf5 UTSW 17 43427045 missense probably damaging 1.00
Z1177:Adgrf5 UTSW 17 43445053 missense probably benign 0.00
Z1191:Adgrf5 UTSW 17 43445035 missense probably benign 0.17
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 038226-MU
Last Updated 2021-11-10 7:25 AM by Diantha La Vine
Record Created 2014-10-03 8:58 AM by Jeff SoRelle
Record Posted 2015-11-16
Phenotypic Description
Figure 1. Sweetie mice exhibited impaired glucose tolerance. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The sweetie phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0972, some of which exhibited elevated blood glucose levels 30 minutes after glucose injection (Figure 1). 

Nature of Mutation

Figure 2. Linkage mapping of the elevated impaired glucose tolerance using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 73 mutations (X-axis) identified in the G1 male of pedigree R0972.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 73 mutations. The hyperglycemia phenotype was linked by continuous variable mapping to a mutation in Adgrf5 (Gpr116): an A to T transversion at base pair 43,450,983 (v38) on chromosome 17, or base pair 90,655 in the GenBank genomic region NC_000083. Linkage was found with a recessive model of inheritance (P = 2.687 x 10-5), wherein 5 variant homozygotes departed phenotypically from 10 homozygous reference mice and 13 heterozygous mice (Figure 2).   

 

The mutation corresponds to residue 3,834 in the mRNA sequence NM_001081178 within exon 17 of 21 total exons.

 

3819 GTGGTGGTAAATGTGAGCATCACAGTTGTGGTC
1185 -V--V--V--N--V--S--I--T--V--V--V-

 

The mutated nucleotide is indicated in red. The mutation results in a serine (S) to cysteine (C) substitution at position 1,190 (S1190C) in the ADGRF5 protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.957) (1).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Topology of the ADGRs. The ADGRs are G protein-coupled receptors and have seven transmembrane domains. The members of the ADGR family have variable intracellular N-terminal domains that vary in length and composition. The C-terminus is extracellular.

Figure. Domain structure of ADGRF5 (GPR116). ADGRF5 has several domains including a signal peptide (SP), a sperm protein-enterokinase-agrin (SEA) domain, immunoglobulin (IG) domains, a GPCR autoproteolysis-inducing (GAIN) domain, a GPCR proteolysis site (GPS), and seven transmembrane (TM) domains.The duct_tape mutation results in a serine (S) to threonine (T) substitution at position 655. The large N-terminus is extracellular and the C-terminus is intracellular. Other mutations found in the protein are noted in red.

ADGRF5 (alternatively, GPR116 or Ig-Hepta) is a member of the adhesion G protein-coupled receptors (ADGR) subfamily of G protein-coupled receptors (GPCRs). Similar to other GPCRs, ADGRs have seven transmembrane domains (amino acids 1011-1264 in ADGRF5); the N-terminus is extracellular and the C-terminus is intracellular (Figure 3).

 

The N-terminal domains of the ADGR proteins are variable in composition and length and can include a combination of domains including cadherin, epidermal growth factor (EGF), immunoglobulin (Ig), R (scavenger receptor cysteine-rich), and Kringle domains [Figure 4; reviewed in (2)]. ADGRF5 has a SEA (sperm protein-enterokinase-agrin) domain (amino acids 163-264) and two Ig domains (amino acids 276-366 and 475-561) within the N-terminal tail. SEA domains are extracellular domains of unknown function, but it is proposed to mediate the binding of carbohydrate sidechains (SMART). In addition, the SEA domain is often found in membrane-associated proteins that are released from the cell surface. It has been proposed to function in the cleavage event of these proteins as well as in the association of the subunits (3). The SEA module contains a highly conserved GSVVV or GSIVV sequence that is a cleavage site. Ig domains are characteristic of the Ig superfamily of cell-surface proteins (4;5). X-ray and NMR studies have shown that Ig-like domains form Greek-key β-sandwich structures with the varying types differing in the number of strands in the β-sheets as well as in their sequence patterns.  By convention, the strands are labeled a to g in sequence with the two strands present between the c and d strands in V domains being labelled c' and c″.  One β-sheet consists of strands a, b, e and possibly d while the other contains strands c, f, g and possibly c' and c″.  In addition, the C-terminal ends of strands a and g may form a small stretch of parallel β-sheet, disrupting the original strands and giving rise to strands a' and/or g' (6).  Ig-like domains are classified into V-type having all strands, C-type (for the C1-set) lacking the c' and c″ strands, S-type (for the C2-set) having the c' strand but not the c″ or d strands and the H-type, which lacks the c″ strand.  Ig-like domains usually contain a structural motif composed of cysteine residues generally located in the b and f strands that form a disulfide bridge, and a tryptophan residue located in the c strand (5).

 

ADGRF5 undergoes post-translational processing at generate four fragments: a presequence (amino acids 1-24), a pro-α-fragment (amino acids 25-223), a β-chain (amino acids 224-993), and a γ-chain (amino acids 994-1349) (7). The pro-α-fragment undergoes further processing by furin (between Lys51 and Ala52) to generate the α-fragment (amino acids 52-223), which reassociates with the β- and γ-chains (7-9).

 

Most of the ADGRs contain a GPCR autoproteolysis-inducing (GAIN) domain (amino acids 949-1004), which mediates autoproteolysis and subsequent attachment of the N-terminal (NTF) and C-terminal (CTF) fragments. It has not been experimentally verified if ADGRF5 undergoes autocatalytic cleavage within the GAIN domain. Within the GAIN domain is a cysteine-rich GPCR proteolysis site (GPS) (10;11). Autocatalytic cleavage at the GPS occurs between a conserved aliphatic amino acid (usually leucine) and a threonine, serine, or cysteine. Cleavage occurs in the lumen of the endoplasmic reticulum during biosynthesis (2). Autoproteolysis of the ADGRs is proposed to be ligand-dependent. As most ADGRs undergo autoproteolysis of the GPS, it is proposed that GPS cleavage regulates receptor activity. The GPS motif and the GAIN domain may also have a function independent of receptor cleavage, namely acting as a hinge for receptor activity and signal transduction (10). In addition, the GAIN domain may facilitate ligand interactions of intramolecular interactions (10). The NTF and CTF of several ADGRs have been shown to have separate functions. The NTF, but not CTF, of GPR126 is essential for heart development (12). The NTFs of ADGRs can stimulate non cell-autonomous activities. Soluble ADGRE5 (CD97) can bind α5β1 and αvβ3 integrins to stimulate angiogenesis (13). The NTF of ADGRA2 (GPR124) can bind αvβ3 integrin to promote endothelial cell survival (14). In addition, the NTF of ADGRB1 (BAI1) can interact with integrins to inhibit angiogenesis (15).

 

Similar to GPCRs, ADGFR5 forms dimers (16). Within the exodomain, there are 20 N-linked glycosylation consensus sequences (Asn-Xxx-Ser/Thr; where Xxx can be any amino acid) (16). There is also one N-linked glycosylation consensus sequence within the first exoloop (16). The ADGRs have several interacting partners including, but not limited to, α5β1 and αvβ3 integrins (ADGRE5) (13), chondroitin sulfate B (ADGRE2) (17), collagen III (ADGRG1) (18), phosphatidylserine (ADGRB1) (19), lipopolysaccharide (ADGRB1) (20), and surfactant protein D (ADGRF5) (21).

 

A splice variant of Adgrf5 has been identified in human, mouse, rat, cow, and dog. The variant contains an insertion at the end of the transmembrane domain region.

 

The sweetie mutation results in a serine to cysteine substitution at position 1,190, within the transmembrane domain region of ADGRF5. The exact locations and functions of each transmembrane domain in ADGRF5 are unknown.

Expression/Localization

In the rat, Adgrf5 is highly expressed in the lung, with lower expression in the kidney and heart (16). Comparison of postnatal day (P) 3 and 14 week-old rat lung extracts determined that Adgrf5 is upregulated postnatally (16). In the mouse, Adgrf5 is ubiquitously expressed in adult mouse tissues, with higher expression in the lung, liver, heart, kidney, spleen, testes, and thymus (22). Similar to the rat, mouse Adgrf5 expression is developmentally regulated (23). In the human, ADGRF5 mRNA is expressed in vasculature endothelial cells as well as fetal and adult lung (2;21;23;24).

 

Mouse ADGRF5 protein is expressed in alveolar cells of the lung, proximal, distal, and collecting tubules of the kidney, myocytes, mammary gland epithelial cells, and adipose tissue (25). During preadipocyte differentiation, Adgrf5 expression increased during the first six days of differentiation, but was reduced at day eight (25). In rat lung and kidney sections, ADGRF5 is localized in alveolar walls and intercalated cells in the collecting duct, respectively (16). Mouse and rat ADGRF5 is localized to the apical surface of type I and II epithelial cells (23).

Background
Figure 5. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, the GPCR undergoes conformational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.

GCPRs couple with a heterotrimeric G protein to mediate downstream effects. G proteins consist of an α subunit that binds and hydrolyzes GTP (Gα) as well as β and γ subunits that are constitutively associated in a complex [reviewed in (26)Figure 5]. In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated. Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit.  GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis, an activity intrinsic to Gα and one that may be stimulated by GTPase activating proteins (GAPs) such as regulators of G protein signaling (RGS) proteins. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. Ligand-induced phosphorylation of the GPCR by G protein coupled receptor kinases (GRKs) leads to sequestration of the receptor from the cell surface thereby downregulating signaling.

 

The ligands that activate the ADGRs are largely unknown. ADGRs are proposed to interact with Gαo [in the case of ADGRL1 (latrophilin-1) (27)], Gαq/11 [ADGRG1 (GPR56) (28)], Gαs and Gαi [ADGRG6 (GPR126) (29) and ADGRD1 (GPR133) (30;31)], and Gαi [ADGRV1 (VLGR1) (32)]. Coupling to Gαs, Gαq, Gαi/o, or Gα12/13 proteins has been shown in vitro for other ADGRs including ADGRE2 (EMR2), ADGRF1 (GPR110), ADGRF4 (GPR115), ADGRB1 (BAI1), ADGRG3 (GPR97), ADGRG5 (GPR114), and ADGRG6 (GPR126) (33;34).

 

ADGRB1 (BAI1) has been shown to activate G protein-independent signaling pathways. ADGRB1 (BAI1) can interact with the guanine nucleotide exchange factor complex for Rac1, ELMO (engulfment and cell motility)-DOCK180 (dedicator of cytokinesis 180; see the record frazz (Dock2) for information about DOCK proteins) to mediate the phagocytosis of apoptotic cells and Gram-negative bacteria (19;20;35). During spinogenesis and synaptogenesis, ADGRB1 (BAI1) recruits Par3 (partitioning defective 3)/Tiam1 (T-lymphoma invasion and metastasis-inducing protein 1) to synaptic sites, subsequently promoting Rac1 activation (36). The Par3/Tiam1 complex facilitates Rac1 activation.

 

The ADGRs activate several signaling pathways including Ca2+ signaling (in the case of ADGRL1) (37), RhoA-associated signaling (ADGRG1) (38), and cAMP-associated signaling [ADGRG6 (GPR126) (39)]. ADGRs have known functions in the regulation of cytoskeletal organization (40;41) and development (42). Members of the ADGRC (CELSR) and ADGRB (BAI) subfamilies of ADGRs regulate the size and shape of cell membranes through the modulation of actin reorganization downstream of Rho/Rac/Cdc42 (43). In addition, ADGRB1 (BAI1) binding to integrins, suggesting a function in cell adhesion and cell polarity.

 

ADGRF5 has documented functions in the respiratory system and tumorigenesis. ADGRF5 is also proposed to have functions in the skin. In the lung, ADGRF5 is essential in the maintenance of lung surfactant homeostasis by acting as a sensor of alveolar surfactant pool sizes in alveolar type II pneumocytes (16;21;23;24). Proper surfactant levels in the alveoli are essential to maintain lung volumes as well as efficient gas exchange across the air/blood barrier. Adgrf5-deficient (Adgrf5-/-) mice exhibit alveolar enlargement, inflammation, and accumulation of surfactant lipids and proteins in the alveolar space, subsequent labored breathing, and reduced lifespan (23;24;44). In the Adgrf5-/- mice, alveolar macrophages are activated and release matrix metalloproteinases (MMPs) through NF-κB activation (44).

 

ADGRF5 expression is associated with poor prognosis in breast cancer patients. The level of ADGRF5 expression increases during the progression of breast cancer; highest expression was observed in tumors with distant metastases (45). In breast cancer cell lines, ADGRF5 regulated the morphology and motility of the cells through the Gαq–p63RhoGEF-Rho–GTPase pathway (45).

Putative Mechanism
Figure 6. Adaption of the metabolism in liver cells upon low glucose levels. The α cells of the pancreas secrete glucagon in response to low blood glucose levels. Glucagon binds cell surface receptors primarily found on hepatocytes. The glucagon receptor is a Gα-coupled G protein-coupled receptor. Glucagon binding to the receptor results in activation of adenylate cyclase (AC). AC activation leads to an increase in the formation of cAMP, which binds to, and activates, protein kinase A (PKA). Binding of cAMP to the regulatory subunits of PKA leads to release and subsequent activation of the catalytic subunits. The catalytic subunits phosphorylate many target proteins such as phosphorylase kinase, a multi-subunit enzyme in skeletal muscle and liver. Activated phosphorylase kinase phosphorylates glycogen phosphorylase to promote glycogenolysis. The catalytic subunits of PKA can enter the nucleus and phosphorylate cAMP-responsive element (CRE)-binding protein (CREB). Phosphorylated CREB promotes target gene expression at promoters that contain CREs. CREB increases the expression of genes involved in gluconeogenesis through the induction of peroxisome proliferator-activated receptor-γ (PPARγ) co-activator 1α (PPARGC1A) as well as members of the nuclear receptor subfamily 4 group A family of nuclear hormone receptors. HNF-4α, the coactivator PGC-1, and the glucocorticoid receptor (GR) are involved in the transcriptional regulation of the phosphoenolpyruvate carboxykinase (PEPCK) gene, which functions in gluconeogenesis.

ADGRF6 is essential for 3T3-L1 preadipocyte differentiation (25). Adipose-specific deletion of Adgrf5 (Adgrf5 CKO) in the mouse resulted in reduced adipocyte size and increased lipid accumulation in the liver compared to wild-type mice as well as glucose intolerance and insulin resistance (25); no changes in body weight or food intake were observed in the Adgrf5 CKO mice. Serum insulin levels were reduced in the Adgrf5 CKO mice at early time points after glucose injection compared to wild-type mice (25). Akt was hypophosphorylated in the liver and skeletal soleus muscle of the Adgrf5 CKO mice compared to that in wild-type mice upon insulin stimulation, indicating defective insulin signaling upon the loss of AGRF5 expression. In addition, hepatic gluconeogenic genes (G6pc and Pck1) were upregulated after high fat diet feeding in the Adgrf5 CKO mice, indicating that the glucose intolerance and insulin resistance is partially caused by an increase in hepatic glucose production (Figure 6). The expression of several inflammatory genes including those that encode IL-6, TNF-α, MCP-1 and IL-1β were increased in the Adgrf5 CKO adipose tissues on high-fat diet compared to wild-type mice on high-fat diets (25). Nie et al. proposed that ADGRF5 may protect from metabolic disorders under pathological conditions, but it may not have a prominent function in normal functions of the body.

 

Similar to the Adgrf5 CKO mice, the sweetie mice exhibit impaired glucose tolerance, indicating loss of ADGRF5sweetie function. Lung function in the sweetie mice has not been examined.

Primers PCR Primer
sweetie_pcr_F: TGCATAGTCAACATTGCCTTTTGCC
sweetie_pcr_R: ACAGCATTGCTTCCCTGGATCAC

Sequencing Primer
sweetie_seq_F: TCAACGAAACAGCCTGTGTG
sweetie_seq_R: CTGGATCACTGTGGCAAGAC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

 

The following sequence of 581 nucleotides is amplified (chromosome 17, + strand):

 

 

1   tgcatagtca acattgcctt ttgccttctg attgctgaca tctggttcat tgtggctggt
61  gctatccacg acggtcgcta cccactcaac gaaacagcct gtgtggccgc cacattcttc
121 attcacttct tctacctcag tgtcttcttc tggatgctaa ctctaggcct catgctcttc
181 taccggctga ttttcattct acacgatgca agcaagtcca ctcagaaagc catcgcattt
241 tctctaggct atggctgtcc cctcattatc tcctctatca cagtgggggt tacgcagcca
301 caggaagtct acatgaggaa gaacgcgtgt tggctcaact gggaggacac cagagcactg
361 ctggcttttg ccatccccgc gttgattatt gtggtggtaa atgtgagcat cacagttgtg
421 gtcatcacca agatcctgag gccctccatt ggggacaagc caggcaagca agagaagagc
481 agcctattcc agatcagcaa gagtatcggg gtcctcacac cactcttggg gctcacttgg
541 ggtttcggtc ttgccacagt gatccaggga agcaatgctg t

 

 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsZhe Chen, Jeff SoRelle, William McAlpine, Noelle Hutchins