Phenotypic Mutation 'bund' (pdf version)
Allelebund
Mutation Type missense
Chromosome5
Coordinate66,400,255 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Apbb2
Gene Name amyloid beta (A4) precursor protein-binding, family B, member 2
Synonym(s) TR2L, Rirl1, Zfra, 2310007D03Rik, FE65L1
Chromosomal Location 66,298,703-66,618,784 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the cytoplasmic domains of amyloid beta (A4) precursor protein and amyloid beta (A4) precursor-like protein 2. This protein contains two phosphotyrosine binding (PTB) domains, which are thought to function in signal transduction. Polymorphisms in this gene have been associated with Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal brain morphology. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009686 (variant 1), NM_001204143 (variant 2), NM_001201414 (variant 3), NM_001201415 (variant 4), NM_001201416 (variant 5), NM_001310626 (variant 6); MGI:108405

Mapped Yes 
Amino Acid Change Threonine changed to Serine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000084511] [ENSMUSP00000124807] [ENSMUSP00000125211] [ENSMUSP00000123778] [ENSMUSP00000123978] [ENSMUSP00000123752] [ENSMUSP00000125116]
SMART Domains Protein: ENSMUSP00000084511
Gene: ENSMUSG00000029207
AA Change: T288S

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 3.15e-38 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
(Using ENSMUST00000087256)
SMART Domains Protein: ENSMUSP00000124807
Gene: ENSMUSG00000029207
AA Change: T289S

DomainStartEndE-ValueType
WW 292 323 1.06e-7 SMART
PTB 394 538 2.87e-41 SMART
PTB 565 695 2.5e-41 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
(Using ENSMUST00000159512)
SMART Domains Protein: ENSMUSP00000125211
Gene: ENSMUSG00000029207
AA Change: T288S

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 4.29e-40 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
(Using ENSMUST00000159786)
SMART Domains Protein: ENSMUSP00000123778
Gene: ENSMUSG00000029207
AA Change: T289S

DomainStartEndE-ValueType
WW 292 323 6.1e-10 SMART
PTB 415 510 1.3e-3 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
(Using ENSMUST00000160063)
SMART Domains Protein: ENSMUSP00000123978
Gene: ENSMUSG00000029207
AA Change: T288S

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 564 694 2.5e-41 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
(Using ENSMUST00000160870)
SMART Domains Protein: ENSMUSP00000123752
Gene: ENSMUSG00000029207
AA Change: T288S

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 558 2.87e-41 SMART
PTB 585 715 2.5e-41 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
(Using ENSMUST00000162349)
SMART Domains Protein: ENSMUSP00000125116
Gene: ENSMUSG00000029207
AA Change: T288S

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 563 693 2.5e-41 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
(Using ENSMUST00000162366)
Phenotypic Category
Phenotypequestion? Literature verified References
30 min GTT hyperglycemic 29457786
30 min GTT hyperglycemic (male)
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(154) : Chemically induced (other)(2) Gene trapped(147) Radiation induced(1) Spontaneous(1) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Apbb2 APN 5 66451512 missense probably damaging 1.00
IGL01615:Apbb2 APN 5 66307701 missense probably benign 0.06
IGL01945:Apbb2 APN 5 66400251 missense probably damaging 1.00
IGL03108:Apbb2 APN 5 66400231 missense probably damaging 1.00
IGL03324:Apbb2 APN 5 66312157 critical splice donor site probably null
Dionysis UTSW 5 66452250 missense probably damaging 0.99
R0266:Apbb2 UTSW 5 66302611 missense probably benign 0.32
R0309:Apbb2 UTSW 5 66310988 splice site probably benign
R0410:Apbb2 UTSW 5 66451806 missense possibly damaging 0.88
R0564:Apbb2 UTSW 5 66452250 missense probably damaging 0.99
R0882:Apbb2 UTSW 5 66400255 missense probably damaging 1.00
R1075:Apbb2 UTSW 5 66302678 missense probably damaging 1.00
R1822:Apbb2 UTSW 5 66400177 missense probably benign 0.00
R1929:Apbb2 UTSW 5 66307615 missense probably benign 0.33
R4157:Apbb2 UTSW 5 66302604 nonsense probably null
R4299:Apbb2 UTSW 5 66313378 missense probably damaging 1.00
R4627:Apbb2 UTSW 5 66400076 splice site probably null
R4780:Apbb2 UTSW 5 66362817 missense probably damaging 1.00
R4940:Apbb2 UTSW 5 66452261 missense probably null
R5002:Apbb2 UTSW 5 66313325 missense possibly damaging 0.87
R5102:Apbb2 UTSW 5 66312249 splice site probably null
R5760:Apbb2 UTSW 5 66362757 missense probably benign
R5868:Apbb2 UTSW 5 66452096 missense probably damaging 1.00
R6272:Apbb2 UTSW 5 66311072 missense probably damaging 0.97
R6280:Apbb2 UTSW 5 66364982 missense probably damaging 1.00
R6399:Apbb2 UTSW 5 66451467 critical splice donor site probably null
X0020:Apbb2 UTSW 5 66391799 missense probably damaging 1.00
Z1088:Apbb2 UTSW 5 66302696 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
Repository
Last Updated 2018-10-04 4:44 AM by External Program
Record Created 2014-10-13 3:25 PM by Jeff SoRelle
Record Posted 2018-04-05
Phenotypic Description

Figure 1. Bund mice exhibited hyperglycemia 30 minutes after glucose challenge. Normalized gene-based superpedigree data are shown for pedigrees R0882, R4780, and R4299. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The bund phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0882 by gene-based superpedigree analysis in which some mice showed hyperglycemia 30 minutes after glucose challenge (Figure 1).

Nature of Mutation

Figure 2. Gene-based supedigree linkage mapping of the hyperglycemia 30 minutes after glucose challenge phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of mutations (X-axis) identified in the G1 male of pedigrees R0882, R4780, and R4299. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 3. Mice with CRISPR-mediated knockout of Apbb2 exhibited hyperglycemia 30 minutes after glucose challenge. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 49 mutations. The hyperglycemia phenotype was linked by continuous variable mapping to a mutation in Apbb2:  an A to T transversion at base pair 66,400,255 (v38) on chromosome 5, or base pair 218,563 in the GenBank genomic region NC_000071 encoding Apbb2. Linkage was found by gene-based superipedigree analysis of Apbb2 mutations in three pedigrees (R0882, R4780, and R4299) with a recessive model of inheritance, wherein five variant homozygotes departed phenotypically from 13 homozygous reference mice and 17 heterozygous mice with a P value of 4.701 x 10-5 (Figure 2).  

 

The mutation corresponds to residue 1,433 in the mRNA sequence NM_001201415 within exon 6 of 16 total exons.

 

1418 GATCACTCATTTCAGACAGATCCCGATTTGCCG

283  -D--H--S--F--Q--T--D--P--D--L--P-

 

The mutated nucleotide is indicated in red.  The mutation results in a threonine (T) to serine (S) substitution at position 288 (T288S) in the APBB2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.977).

 

The mutation in Apbb2 was confirmed to be causative of the hyperglycemia phenotype by CRISPR-mediated knockout of Apbb2 (Figure 3; P = 3.865 x 10-4).

Protein Prediction
Figure 3. Domain organization of APBB2. The location of the bund mutation is indicated. Other mutations found in APBB2 are noted in red. This image is interactive. Click on the mutations for more specific information.

APBB2 (alternatively, FE65L1) is a member of the FE65 family of adaptor proteins, which also includes FE65 (alternatively, APBB1) and APBB3 (alternatively, FE65L2). Each FE65 protein has several conserved domains, including a WW (tryptophan, tryptophan) domain and two phosphotyrosine binding (PTB)/PID domains. The members of the FE65 protein family are different at their respective N-termini. APBB2 has a 290-amino acid N-terminus preceding the WW domain, while the N-terminus of APBB1 and APBB3 are 253- and 29-amino acids in length, respectively. APBB2 also has a putative conserved 56-amino acid TR2L sequence (1). The TR2L sequence is an apoptosis inhibitory domain that blocks TNF (see the record for Panr1) cytotoxicity (2).

 

The mutation results in a threonine (T) to serine (S) substitution at position 288 (T288S) in the APBB2 protein; amino acid 288 is within an undefined region of APBB2 immediately preceding the WW domain. 

 

For more information about Apbb2, please see the record for Dionysis.

Putative Mechanism

APBB2 is one of four phosphotyrosines-binding proteins (i.e., APBA1, APBA2 (please see the record for guadalupe), APBB1/Fe65, and APBB2) that bind APP to promote APP processing (3-7). APBB2 is also putative regulator of low density lipoprotein (LDL) receptor-related protein 1 (LRP1) by promoting the association of LRP1 with APP (8;9), and overexpression of APBB2 promotes LRP1 degradation (9;10).

 

Apbb2-deficient mice exhibited prenatal lethality (MGI:5574593) and cortical cataracts (11). Heterozygous Apbb2 mice exhibited reduced circulating insulin levels (MGI:5574593). The grip strength in Apbb2-deficient mice was slightly reduced, but was not significantly different than wild-type mice (12). Apbb2-deficient mice also showed spatial learning defects and neuromuscular abnormalities (12). FE65 and APBB2 putatively have overlapping functions at central and peripheral synapses (12). Fe65 and Apbb2 double knockout mice exhibited neurodevelopmental defects, lens degeneration, limb clasping, defects in peripheral motor function, reduced anxiety, and reduced grip strength (10-13).

 

Mutations in APBB2 are putatively linked cases of late-onset Alzheimer’s disease due to aberrant increased production of Aβ (14). Furthermore, an APBB2 polymorphism (hCV1558625-rs13133980 AG haplotype) is associated with severe cognitive impairment in centenarians (15).

 

APBB2 is required for proper β-cell function through its regulation of LRP1 (16). Apbb2-deficient mice showed glucose intolerance with high circulating glucose levels and a lower glucose infusion rate (16). Islets from the Apbb2-deficient mice exhibited reduced insulin secretion upon high glucose stimulation (16).Loss of APBB2 expression was proposed to disrupt the function of LRP1 in cholesterol metabolism as well as the assembly of the LRP1-APP-APBB2 signaling complex.

Primers PCR Primer
bund(F):5'- ACTAAGTGACCCTTTCCTAGAGCCG -3'
bund(R):5'- CCTAAAAGTGTGCAGTGCAGAGTCC -3'

Sequencing Primer
bund_seq(F):5'- TCCTAGAGCCGTGGAGATCTG -3'
bund_seq(R):5'- CAGACATTTCTGGGTGTCGGGTT -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine, Katherine Timer
AuthorsZhe Chen, Jeff SoRelle, William McAlpine, and Bruce Beutler