Phenotypic Mutation 'Dionysis' (pdf version)
AlleleDionysis
Mutation Type missense
Chromosome5
Coordinate66,452,250 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Apbb2
Gene Name amyloid beta (A4) precursor protein-binding, family B, member 2
Synonym(s) TR2L, Rirl1, Zfra, 2310007D03Rik, FE65L1
Chromosomal Location 66,298,703-66,618,784 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the cytoplasmic domains of amyloid beta (A4) precursor protein and amyloid beta (A4) precursor-like protein 2. This protein contains two phosphotyrosine binding (PTB) domains, which are thought to function in signal transduction. Polymorphisms in this gene have been associated with Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal brain morphology. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009686 (variant 1), NM_001204143 (variant 2), NM_001201414 (variant 3), NM_001201415 (variant 4), NM_001201416 (variant 5), NM_001310626 (variant 6); MGI:108405

MappedYes 
Amino Acid Change Methionine changed to Lysine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000084511] [ENSMUSP00000124127] [ENSMUSP00000124807] [ENSMUSP00000125211] [ENSMUSP00000123778] [ENSMUSP00000123766] [ENSMUSP00000123978] [ENSMUSP00000124350] [ENSMUSP00000125550] [ENSMUSP00000123752] [ENSMUSP00000125116] [ENSMUSP00000124139] [ENSMUSP00000125603]
AlphaFold Q9DBR4
SMART Domains Protein: ENSMUSP00000084511
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 3.15e-38 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
(Using ENSMUST00000087256)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000124807
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 292 323 1.06e-7 SMART
PTB 394 538 2.87e-41 SMART
PTB 565 695 2.5e-41 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
(Using ENSMUST00000159512)
SMART Domains Protein: ENSMUSP00000125211
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 4.29e-40 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
(Using ENSMUST00000159786)
SMART Domains Protein: ENSMUSP00000123778
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 292 323 6.1e-10 SMART
PTB 415 510 1.3e-3 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
(Using ENSMUST00000160063)
Predicted Effect possibly damaging

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
(Using ENSMUST00000160103)
SMART Domains Protein: ENSMUSP00000123978
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 564 694 2.5e-41 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
(Using ENSMUST00000160870)
Predicted Effect probably benign
Predicted Effect probably damaging

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
(Using ENSMUST00000161879)
SMART Domains Protein: ENSMUSP00000123752
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 558 2.87e-41 SMART
PTB 585 715 2.5e-41 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
(Using ENSMUST00000162349)
SMART Domains Protein: ENSMUSP00000125116
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 563 693 2.5e-41 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
(Using ENSMUST00000162366)
Predicted Effect probably damaging

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
(Using ENSMUST00000162382)
Predicted Effect probably benign

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
(Using ENSMUST00000162994)
Meta Mutation Damage Score 0.9082 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotype question? Literature verified References
30 min GTT hyperglycemic 29457786
30 min GTT hyperglycemic (male)
post-MCMV FACS effector memory CD8 T cells in CD8 T cells - increased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.537; ML prob: 0.514; human score: -0.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(154) : Chemically induced (other)(2) Gene trapped(147) Radiation induced(1) Spontaneous(1) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Apbb2 APN 5 66451512 missense probably damaging 1.00
IGL01615:Apbb2 APN 5 66307701 missense probably benign 0.06
IGL01945:Apbb2 APN 5 66400251 missense probably damaging 1.00
IGL03108:Apbb2 APN 5 66400231 missense probably damaging 1.00
IGL03324:Apbb2 APN 5 66312157 critical splice donor site probably null
bund UTSW 5 66400255 missense probably damaging 1.00
R0266:Apbb2 UTSW 5 66302611 missense probably benign 0.32
R0309:Apbb2 UTSW 5 66310988 splice site probably benign
R0410:Apbb2 UTSW 5 66451806 missense possibly damaging 0.88
R0564:Apbb2 UTSW 5 66452250 missense probably damaging 0.99
R0882:Apbb2 UTSW 5 66400255 missense probably damaging 1.00
R1075:Apbb2 UTSW 5 66302678 missense probably damaging 1.00
R1822:Apbb2 UTSW 5 66400177 missense probably benign 0.00
R1929:Apbb2 UTSW 5 66307615 missense probably benign 0.33
R4157:Apbb2 UTSW 5 66302604 nonsense probably null
R4299:Apbb2 UTSW 5 66313378 missense probably damaging 1.00
R4627:Apbb2 UTSW 5 66400076 splice site probably null
R4780:Apbb2 UTSW 5 66362817 missense probably damaging 1.00
R4940:Apbb2 UTSW 5 66452261 missense probably null
R5002:Apbb2 UTSW 5 66313325 missense possibly damaging 0.87
R5102:Apbb2 UTSW 5 66312249 splice site probably null
R5760:Apbb2 UTSW 5 66362757 missense probably benign
R5868:Apbb2 UTSW 5 66452096 missense probably damaging 1.00
R6272:Apbb2 UTSW 5 66311072 missense probably damaging 0.97
R6280:Apbb2 UTSW 5 66364982 missense probably damaging 1.00
R6399:Apbb2 UTSW 5 66451467 critical splice donor site probably null
R7091:Apbb2 UTSW 5 66313334 missense probably damaging 1.00
R7204:Apbb2 UTSW 5 66451603 missense probably damaging 1.00
R7984:Apbb2 UTSW 5 66307692 missense probably damaging 1.00
R8026:Apbb2 UTSW 5 66451644 missense probably benign 0.00
R8201:Apbb2 UTSW 5 66309115 missense probably benign
R8309:Apbb2 UTSW 5 66362836 missense probably benign 0.01
R8773:Apbb2 UTSW 5 66451909 missense probably damaging 0.99
R8876:Apbb2 UTSW 5 66451657 missense probably benign
R8988:Apbb2 UTSW 5 66452101 missense probably damaging 1.00
R9076:Apbb2 UTSW 5 66312164 missense probably damaging 1.00
R9105:Apbb2 UTSW 5 66302672 nonsense probably null
R9109:Apbb2 UTSW 5 66451675 missense probably benign 0.20
X0020:Apbb2 UTSW 5 66391799 missense probably damaging 1.00
Z1088:Apbb2 UTSW 5 66302696 missense probably damaging 1.00
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm
Repository
Last Updated 2021-11-30 7:49 AM by Diantha La Vine
Record Created 2014-10-13 4:28 PM by Jeff SoRelle
Record Posted 2018-04-05
Phenotypic Description

Figure 1. Dionysis mice exhibited hyperglycemia 30 minutes after glucose challenge. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Dionysis phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0564 in which some mice showed hyperglycemia 30 minutes after glucose challenge (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hyperglycemia phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R0564. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 3. Mice with CRISPR-mediated knockout of Apbb2 exhibited hyperglycemia 30 minutes after glucose challengeAbbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. The hyperglycemia phenotype was linked by continuous variable mapping to a mutation in Apbb2: a T to A transversion at base pair 66,452,250 (v38) on chromosome 5, or base pair 166,568 in the GenBank genomic region NC_000071 encoding Apbb2. Linkage was found by with an additive model of inheritance, wherein one variant homozygote and seven heterozygous mice departed phenotypically from seven homozygous reference mice with a P value of 2.31 x 10-4 (Figure 2).  

 

The mutation corresponds to residue 624 in the mRNA sequence NM_001201415 within exon 5 of 16 total exons.

 
608 ACCTTGGCAGTGTTTATGGCCAGCAGCGGATCC
13  -T--L--A--V--F--M--A--S--S--G--S-
 

The mutated nucleotide is indicated in red.  The mutation results in a methionine (M) to lysine (K) substitution at position 18 (M18K) in the APBB2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.943).

 

The mutation in Apbb2 was confirmed to be causative of the hyperglycemia phenotype by CRISPR-mediated knockout of Apbb2 (Figure 3; P = 3.865 x 10-4).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 4. PTB2 domain of APBB2 complexed with a 32-amino acid peptide of APP. PTB2 domain is shown in pink, and APP-32mer is shown in blue. Figure was generated using UCSF Chimeria and is based on PDB: 2ROZ.

APBB2 (alternatively, FE65L1) is a member of the FE65 family of adaptor proteins, which also includes FE65 (alternatively, APBB1) and APBB3 (alternatively, FE65L2). Each FE65 protein has a conserved WW (tryptophan, tryptophan) domain that mediates interactions with the P2X2 receptor subunit; the functional significance of this interaction is unknown [Figure 4; (1)]. The FE65 proteins also have two conserved phosphotyrosine binding (PTB)/PID domains, PTB1 and PTB2. Although the FE65 proteins share similar domains, they differ significantly at their respective N-termini: APBB2 has a 290-amino acid N-terminus preceding the WW domain, and the N-termini of FE65 and APBB3 are 253- and 29-amino acids in length, respectively.

 

In FE65, the PTB1 domain mediates interactions with LRP1 (low density lipoprotein receptor-related protein 1) and ApoEr2. The FE65-LRP1 and FE65-ApoER2 complexes subsequently interact with amyloid precursor protein (APP). The PTB2 domain mediates interaction with the intracellular domain of APP. The structure of the PTB2 domain complexed with a 32-amino acid peptide of APP has been solved [Figure 5; PDB: 2ROZ; (2)]. The PTB2 domain exhibits a canonical PTB/PID fold, which is comprised of seven antiparallel β-strands that form two orthogonal β-sheets (3). The β-sandwich is capped at the C-terminus by an α-helix. The PTB/PID fold has a peptide-binding pocket formed by the β5 strand and the α-helix. Residues in the loop regions near the N-terminus of the PTB/PID fold form a highly basic phospholipid-binding “crown”. The NPTY (Asn-Pro-Thr-Tyr) motif of the APP peptide forms an antiparallel β-sheet with the β5 strand of the APBB2 PTB2 domain, and the N-terminal region of the APP peptide forms a 2.5-turn α-helix in order to interact with the peripheral regions of the PTB2 domain.

 

APBB2 has a 56-amino acid apoptosis inhibitory domain (AID; alternatively, TR2L sequence) (4). The AID blocks TNF (see the record for Panr1) cytotoxicity (5) by putatively affecting affect receptor clustering and/or the assembly of the death-inducing signaling complex (DISC). The TNF receptor (TNFR1) binds to the TNFR-associated death domain (TRADD) protein that subsequently recruits TNF receptor-associated factor 2 (TRAF2) and/or TRAF5, and the Ser/Thr kinase receptor-interacting protein (RIP). Subsequently, activation of the TAB2/TAK1 complex activates the IKK complex to phosphorylate IκB, resulting in release of NF-κB for translocation to the nucleus and activation of gene expression. TNFR1 activates JNK through sequential recruitment of TRAF2, MEKK1 and MKK7. TRADD recruitment to TNFR1 also leads to the induction of apoptosis through FAS-associated death domain (FADD) protein, caspase-8 and caspase-3 (the DISC complex).

 

APBB2 encodes three isoforms by alternative splicing (termed a, b, and c). Variants “a” and “b” include exon 8, while variant “c” excludes exon 8. The pol III-transcribed non-coding RNA 45A maps to intron 1 of APBB2 in an antisense configuration. Overexpression of 45A promotes alternative splicing of APBB2 and the synthesis of splice variants “a” and “b” (6). 45A alters the ratio of alternative protein variants resulting in exon 8 inclusion, causing a reduction in the amount of β-amyloid released as well as promotion of cell cycle progression and inhibition of DNA damage responses (6).

 

The Dionysis mutation results in a methionine (M) to lysine (K) substitution at position 18 (M18K) in the APBB2 protein; amino acid 18 is within an undefined region of APBB2. 

Expression/Localization

Apbb2 is ubiquitously expressed [(7) and NCBI]. APBB2 localizes to both the cytoplasm and the nucleus (8).

Background
Figure 6. APBB2 binds APP to promote APP processing. The C-terminal fragments of APP (CTFα or CTFβ if cleaved by α- or β-secretase, respectively) are then cleaved by γ-secretase. Cleavage by γ-secretase produces APPsα or APPsβ, the p3 peptide, β-amyloid peptide, and the APP intracellular domain.

The FE65 proteins form multi-molecular complexes that function in several processes, including calcium homeostasis, actin remodeling, nuclear signaling, DNA repair, synaptic vesicle loading and release, and signal transduction [reviewed in (9)]. APBB2 and the other members of the FE65 family have putative functions in cell cycle regulation (8). During the cell cycle, APBB2 downregulates thymidylate synthase expression by inhibiting LSF (LSF/CP2/LBP1)-mediated activation of the thymidylate synthase gene promoter (8). The mechanism by which the FE65 proteins inhibit LSF is unknown. Bruni and colleagues propose that the FE65 proteins prevent the LSF—DNA interaction by blocking the DNA-binding domain of LSF and/or that the FE65 proteins prevent LSF oligomerization.

 

APBB2 is one of four phosphotyrosines-binding proteins (i.e., X11 (alternatively, APBA1), X11-like (alternatively, APBA2; see the record for guadalupe), FE65, and APBB2) that bind APP to promote APP processing (7;10-12). APP is a single-pass transmembrane domain that is initially cleaved N-terminal to the transmembrane domain by α- or β-secretase. The C-terminal fragments of APP (CTFα or CTFβ if cleaved by α- or β-secretase, respectively) are then cleaved by γ-secretase [see the records for truffle (Ncstn) and hiortron (Psen1)]. Cleavage by γ-secretase produces APPsα or APPsβ (i.e., secreted APP ectodomains), the p3 peptide (the result of cleavage by α- and γ-secretases), β-amyloid peptide (Aβ; the result of cleavage by β- and γ-secretases), and the APP intracellular domain. APBB2 overexpression results in increased maturation and secretion of APP, increased production of Aβ, and reduced responses to apoptotic stimuli (4). Mutations in APBB2 are putatively linked cases of late-onset Alzheimer’s disease (13). Alzheimer’s disease is caused accumulation of Aβ in the brain as well as by hyperphosphorylated and cleaved forms of the microtubule-associated protein tau. An APBB2 polymorphism (hCV1558625-rs13133980 AG haplotype) is also associated with severe cognitive impairment in centenarians (14).

 

Apbb2-deficient (Apbb2-/-) mice exhibited prenatal lethality (MGI:5574593) and cortical cataracts (15). The grip strength in Apbb2-/- mice was slightly reduced, but was not significantly different than wild-type mice (16). Apbb2-/- mice also showed spatial learning defects, neuromuscular abnormalities, and reduced circulating insulin levels [(16); MGI:5574593]. Fe65 and Apbb2 double knockout (Apbb1-/-Apbb2-/-) mice exhibited neurodevelopmental defects, lens degeneration, limb clasping, defects in peripheral motor function, reduced anxiety, and reduced grip strength (15-18). Strecker and colleagues proposed that FE65 and APBB2 have overlapping functions at central and peripheral synapses (16).

Putative Mechanism
Figure 7. APBB2 associates with LRP1, which regulates IR-associated signaling. LRP1 interacts with IRβ through which it regulates insulin signaling. LRP1 also affects glucose metabolism through modulation of glucose transporter expression and function.
Figure 8. Apbb2 deletion impairs β-cell function in RD-fed mice. Adult Apbb2 knockout mice (Apbb2-/-) and wild-type littermates (Apbb2+/+) were fed on RD.  (A) Blood glucose during intraperitoneal glucose tolerance test (1 mg/g body weight). n=6 (Apbb2+/+) and 9 (Apbb2-/-) mice. (B) 30 islets per genotypes were subjected to perifusion with glucose concentration at 2.7 mM (0-30 min), 16.7 mM (30-45 min) and 2.7 mM (45-55 min). Insulin concentrations of perifusion fractions were assayed and presented. (C to E) Plasma insulin (C), blood glucose (D) and glucose infusion rate (E) during hyperglycemic clamp. n=3 mice per genotype. Data are presented as the mean±SEM. *P<0.05, **P<0.01 for Apbb2-/- versus Apbb2+/+ mice. Figure and legend adapted from (27).

Several ligands bind LRP1, including apolipoprotein E (ApoE), α2M, and PDGFβ. Binding of these proteins to LRP1 suppresses aneurysm formation and atherosclerosis in vascular smooth muscle (19) as well as promotes glucose and lipid metabolism in neurons (20;21), adipose tissue (22), and liver (23;24).

 

APBB2 putatively regulates LRP1 function, and its associated functions, by promoting the association of LRP1 with APP (25;26). APBB2 is required for proper β-cell function through its regulation of LRP1 (27). Apbb2-deficient (Apbb2-/-; Apbb2 CRISPR mice [Figure 3]) mice showed glucose intolerance (Figure 8A). Isolated islets from the Apbb2-/- mice exhibited reduced insulin secretion upon high glucose stimulation (Figure 8B) (27). During hyperglycemic clamp, the Apbb2-/- mice showed high levels of plasma insulin (Figure 8C) and blood glucose (Figure 8D) as well as a lower glucose infusion rate (Figure 8E) at the hyperglycemic stage (27). Loss of APBB2 expression was proposed to disrupt the function of LRP1 in cholesterol metabolism as well as the assembly of the LRP1-APP-APBB2 signaling complex (27).

Primers PCR Primer
Dionysis_pcr_F: CTTCTCGGAGGTTAGGTTGATGA
Dionysis_pcr_R: GTGCCTTACAACCCATTTCCTTT

Sequencing Primer
Dionysis_seq_F: CAGGGCTGAGGTTCTTGTTG
Dionysis_seq_R: AACCCATTTCCTTTCTGTTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

 

The following sequence of 419 nucleotides is amplified (chromosome 5, - strand):

 

 

1   gtgccttaca acccatttcc tttctgttcc ctatagctga ctcaggtgtt ggcaccttgg
61  cagtgtttat ggccagcagc ggatccacag acattgcaaa ccggaacagc ccagccacac
121 caccaaatac cctcaatctc cgttcctccc acaatgaact attaaatgca gagatcaaac
181 actcagatgc caagaacagc acgcccccca aatgcaggaa aaaatatgca ctgactaata
241 ttcaggcggc catgggcctc tcggatccag ctgtacagcc cctgctggga aacggctctg
301 ccaacatcaa gctggttaaa aatggggaga accagctccg caaggctgca gaacaggggc
361 agcaggaccc caacaagaac ctcagccctg cagccgtcat caacctaacc tccgagaag

 

 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Katherine Timer
AuthorsZhe Chen, Jeff SoRelle, William McAlpine, and Bruce Beutler