Phenotypic Mutation 'guotie' (pdf version)
Alleleguotie
Mutation Type nonsense
Chromosome1
Coordinate138,068,401 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Ptprc
Gene Name protein tyrosine phosphatase, receptor type, C
Synonym(s) B220, Ly-5, Lyt-4, CD45, T200
Chromosomal Location 138,062,861-138,175,708 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001111316 (isoform 1), NM_011210 (isoform 2), NM_001268286 (isoform 3); MGI: 97810

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000138800] [ENSMUSP00000138275] [ENSMUSP00000138350]
SMART Domains Protein: ENSMUSP00000027645
Gene: ENSMUSG00000026395
AA Change: Q1068*

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5e-16 PFAM
low complexity region 109 126 N/A INTRINSIC
low complexity region 168 203 N/A INTRINSIC
Pfam:CD45 210 267 3.1e-20 PFAM
FN3 372 456 2.28e0 SMART
FN3 472 550 3.48e-1 SMART
transmembrane domain 565 586 N/A INTRINSIC
PTPc 639 901 7.57e-127 SMART
PTPc 930 1216 1.39e-102 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5.8e-13 PFAM
low complexity region 31 64 N/A INTRINSIC
Pfam:CD45 70 129 1.8e-24 PFAM
FN3 233 317 2.28e0 SMART
FN3 333 411 3.48e-1 SMART
transmembrane domain 426 447 N/A INTRINSIC
PTPc 500 762 7.57e-127 SMART
PTPc 791 1077 1.39e-102 SMART
Predicted Effect noncoding transcript
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: Q931*

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: Q907*

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: Q1070*

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
30 min GTT hypoglycemic
30 min GTT hypoglycemic (male)
FACS B cells - decreased 22724066
FACS B:T cells - decreased
FACS B1 cells - increased
FACS B1a cells in B1 cells - decreased
FACS B1b cells - increased
FACS B2 cells - decreased
FACS CD11c+ DCs - increased
FACS CD4:CD8 - increased
FACS CD4+ T cells - decreased 20346773
FACS CD4+ T cells in CD3+ T cells - increased 20346773
FACS CD44+ CD4 T cells - decreased 20346773
FACS CD44+ CD8 MFI - decreased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - decreased
FACS CD44+ T cells - decreased 22724066
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - decreased
FACS central memory CD8 T cells in CD8 T cells - increased 19299707
FACS effector memory CD4 T cells in CD4 T cells - increased 19299707
FACS effector memory CD8 T cells in CD8 T cells - increased 19299707
FACS IgD+ B cell percentage - decreased 22724066
FACS IgM MFI - increased
FACS IgM+ B cells - decreased 22724066
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS NK T cells - decreased
FACS T cells - decreased 22724066
post-MCMV FACS B cells - decreased 22724066
post-MCMV FACS B:T cells - decreased
post-MCMV FACS B1 cells - increased
post-MCMV FACS B1a cells in B1 cells - decreased
post-MCMV FACS B1b cells in B1 cells - increased
post-MCMV FACS B220 MFI - decreased
post-MCMV FACS CD11b+ DCs (gated in CD11c+ cells) - increased
post-MCMV FACS CD4:CD8 - increased
post-MCMV FACS CD4+ T cells - decreased 20346773
post-MCMV FACS CD44+ CD8 MFI - increased
post-MCMV FACS CD44+ T MFI - increased
post-MCMV FACS CD8+ T cells - decreased
post-MCMV FACS CD8+ T cells in CD3+ T cells - decreased
post-MCMV FACS central memory CD8 T cells in CD8 T cells - increased 19299707
post-MCMV FACS IgD MFI - decreased
post-MCMV FACS IgD+ B cell percentage - decreased 22724066
post-MCMV FACS IgM MFI - increased
post-MCMV FACS IgM+ B cells - decreased 22724066
post-MCMV FACS macrophages - decreased
post-MCMV FACS naive CD8 T cells in CD8 T cells - decreased
post-MCMV FACS neutrophils - increased
post-MCMV FACS pDCs - decreased
post-MCMV FACS T cells - decreased 22724066
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
total IgE level - decreased
Penetrance  
Alleles Listed at MGI

All mutations/alleles(12) : Chemically induced (ENU)(5) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
Chor_muang UTSW 1 138113562 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository
Last Updated 2019-02-01 1:50 PM by Diantha La Vine
Record Created 2014-10-26 8:56 PM by Ming Zeng
Record Posted 2015-01-14
Phenotypic Description

Figure 1. Guotie mice exhibit a reduced B:T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Guotie mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Guotie mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Guotie mice exhibit decreased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Guotie mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Guotie mice exhibit increased frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Guotie mice exhibit increased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM+ B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Guotie mice exhibit reduced frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ and CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Guotie mice exhibit increased CD4+ T cell to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ and CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Guotie mice exhibit decreased frequencies of CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Guotie mice exhibit increased frequencies of CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Guotie mice exhibit decreased frequencies of CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Guotie mice exhibit decreased frequencies of CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Guotie mice exhibit decreased frequencies of naïve CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine naïve CD8+T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Guotie mice exhibit decreased frequencies of CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44+T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Guotie mice exhibit decreased frequencies of CD44+ CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44+ CD4+T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Guotie mice exhibit decreased frequencies of CD44+ CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44+ CD8+T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Guotie mice exhibit increased CD44+ T cell mean fluorescence intensity (MFI). Flow cytometric analysis of peripheral blood was utilized to determine CD44+ T cell MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 19. Guotie mice exhibit increased CD44+ CD8+ T cell MFI. Flow cytometric analysis of peripheral blood was utilized to determine CD44+ CD8+ T cell MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 20. Guotie mice exhibit increased frequencies of neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 21. Guotie mice exhibit increased frequencies of CD11c+ dendritic cells (DCs). Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 22. Guotie mice exhibit increased peripheral IgM MFI. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 23. Guotie mice exhibit reduced B220 MFI after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 24. Guotie mice exhibit increased central memory CD8+ T cell frequency after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 25. Guotie mice exhibit a decreased IgD+ B cell percentage after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine IgD+ B cell percentage. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 26. Guotie mice exhibit decreased frequencies of plasmacytoid DCs (pDCs) after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine pDC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 27. Guotie mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide (OVA-alum). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 28. Guotie mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The guotie phenotype was identified among ENU-mutagenized G3 mice of the pedigree R0942, some of which showed a decrease in the B:T cell ratio (Figure 1), a reduced frequency of B cells (Figure 2), an increased frequency of B1 cells (Figure 3), a decreased frequency of B1a cells in B1 cells (Figure 4), an increased frequency of B1b cells (Figure 5), a decreased frequency of B2 cells (Figure 6), a decreased frequency of IgM+ B cells (Figure 7), an reduced frequency of T cells (Figure 8), an increase in the CD4+ to CD8+ T cell ratio (Figure 9) due to a reduced frequency of CD4+ T cells (Figure 10), an increased frequency of CD4+ T cells in CD3+ T cells (Figure 11), a reduced frequency of CD8+ T cells (Figure 12), a reduced frequency of CD8+ T cells in CD3+ T cells (Figure 13), and a reduced frequency of naïve CD8+ T cells (Figure 14), all in the peripheral blood. Some mice had a reduced frequency of peripheral CD44+ T cells (Figure 15) including CD44+ CD4+ T cells (Figure 16) and CD44+ CD8+ T cells (Figure 17). The CD44+ T cell mean fluorescence intensity (MFI) (Figure 18) and CD44+ CD8 MFI (Figure 19) were both increased in the peripheral blood. The frequency of neutrophils (Figure 20) and CD11c+ dendritic cells (Figure 21) as well as the MFI of IgM (Figure 22) were also increased in the peripheral blood.

 

After mouse cytomegalovirus (MCMV) infection all of the above-mentioned flow cytometry phenotypes were observed as well as a decreased B220 MFI (Figure 23), an increased frequency of central memory CD8+ T cells (Figure 24), a reduced percentage of IgD+ B cells (Figure 25), and a decreased frequency of pDCs (Figure 26).

 

The T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 27) and the response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal), were reduced (Figure 28).

Nature of Mutation

Figure 29. Linkage mapping of reduced frequency of peripheral T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 39 mutations (X-axis) identified in the G1 male of pedigree R0942.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 39 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ptprc: a C to T transition at base pair 138,068,401 (v38) on chromosome 1, or base pair 110,989 in the GenBank genomic region NC_000067.  The strongest association was found with a recessive model of linkage to the normalized peripheral T cell frequency, wherein 5 variant homozygotes departed phenotypically from 5 homozygous reference mice and 18 heterozygous mice with a P value of 7.414 x 10-18 (Figure 29). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. The mutation corresponds to residue 3,658 in the mRNA sequence NM_001111316 within exon 33 of 33 total exons, residue 3,339 in the mRNA sequence NM_011210 within exon 30 of 30 total exons, and residue 3,267 in the mRNA sequence NM_001268286 within exon 29 of 29 total exons.

 

110980 AGCTATGAGCAATACCAGTTCCTCTATGACATC

1207   -S--Y--E--Q--Y--Q--F--L--Y--D--I- NP_001104786 (CD45-RABC)

1063   -S--Y--E--Q--Y--Q--F--L--Y--D--I-  NP_035340 (CD45-RAB)

1042   -S--Y--E--Q--Y--Q--F--L--Y--D--I-  NP_001255215  (CD45-RO)

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamine (Q)1212 (CD45-RABC), Q1068 (CD45-RAB), or Q1047 (CD45-RO) to a stop codon (*) in the CD45 protein isoforms.

Protein Prediction
Figure 30. Domain structure of the CD45RABC isoform. The extracellular N-terminal A, B, and C regions are encoded by exons 4, 5, and 6, respectively, and are heavily O-glycosylated. The remainder of the extracelluar domain contains 15 sites for N-glycosylation. The catalytic cysteine (828) is indicated within the PTP D1 domain. The guotie mutation (shown in red) converts glutamine 1212 to a stop codon. FNIII=Type III fibronectin; TM=Transmembrane domain; PTP=Protein tyrosine phosphatase. This image is interactive. Other mutations found in CD45 are noted in red. Click on the mutations for more specific information.

Ptprc encodes CD45, a receptor-like protein tyrosine phosphatase (PTP) expressed by cells of the immune system. It is known by several names, including T200 (1), B220 for the B cell form (2), the mouse allotypic marker Ly-5 (3), and CD45. CD45 is a type I transmembrane glycoprotein containing a large N-terminal extracellular domain of ~400-500 residues (depending on the expression of several alternative exons, see below), a single transmembrane domain (22 amino acids), and a C-terminal cytoplasmic domain of 707 residues containing tandem PTP domains only one of which is enzymatically active (Figure 30). Following the PTP domains is a 79 residue C-terminal tail. 

 

Exons 4, 5, and 6 of Ptprc are alternatively spliced to generate three protein isoforms with variations in the most N-terminal domain, furthest from the cell membrane. The three peptides are designated as A, B, and C, respectively. The protein isoforms are commonly named based on the exons included, with the largest isoform (RABC) including all three exons, RAB including exons 4 and 5, etc., and the smallest isoform lacking all three exons designated RO. The guotie mutation is a premature stop codon at amino acid 1,212 in full-length CD45 (CD45RABC), amino acid 1,068 in CD45RAB, and amino acid 1,047 in CD45RO within the D2 domain of all variants. The D2 domain is a protein tyrosine phosphatase (PTP) domain that is enzymatically inactive, but optimal phosphatase activity in cells requires both the D1 and the D2 domains (4). Within the D2 domain is a unique acidic region of 19 residues that contains multiple sites for serine phosphorylation by casein kinase II (5;6). This modification is important for optimal CD45 phosphatase activity toward a model substrate in vitro and for cellular signaling leading to Ca2+ flux in Jurkat T cells, although the mechanistic basis for these effects is unknown. The D2 domain may also modulate substrate access and localization, as suggested by the interaction of D2 with the CD45 substrate Lck (7).

 

Please see the record for belittle for information about CD45.

Putative Mechanism

The physiological function of CD45 has been examined most extensively in T cells. Studies with CD45-deficient cell lines identified CD45 as an obligate positive regulator of antigen receptor signaling, since T cells lacking CD45 failed to proliferate or produce cytokines in response to TCR stimulation (8;9). CD45 can regulate both the activating and inhibitory tyrosines of Src family kinases.

 

Ptprc-/- mice have profound defects in thymic development due to dysfunctional signaling through the preTCR and TCR, leading to a block in thymocyte development at β selection and at the DP stage (10-12). As a result, the absolute number of DP thymocytes is reduced twofold, and the number of single positive (SP) thymocytes is reduced five-fold. Peripheral B cell numbers are actually increased in CD45-deficient mice.  CD45 deficiency has less severe consequences for B cells than for T cells. Peripheral B cell numbers are actually increased in CD45-deficient mice (10-12). Marginal zone B cells are increased, while B1 cell production is decreased, and B cell development is blocked at the transitional 2 (T2) to mature follicular B cell transition (13). Humans deficient in CD45 develop severed combined immunodeficiency (SCID) with defects in T and B cell development and function (OMIM #608971) (14;15)

 

The T cell phenotype of the Ptprcguotie/guotie mice is similar to that of the Ptprc-/- mice suggesting that the guotie mutation abrogates CD45 expression. In contrast to the Ptprc-/- mice, the peripheral frequencies of total B cells as well as B1a and B2 cell frequency were reduced in Ptprcguotie/guotie mice, while B1 and B1b cell frequencies were increased compared to wild-type levels. However, another ENU-induced Ptprc allele, storm (MGI:4819159), exhibited decreased B cell numbers as well as reduced T cell numbers. The expression and localization of CD45guotie have not been examined; however, the phenotype of the guotie mice indicates that the guotie mice doe not express functional CD45.

Primers
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsMing Zeng, Jin Huk Choi, Kuan-Wen Wang, Apiruck Watthanasurorot, Bruce Beutler