Phenotypic Mutation 'Nephro' (pdf version)
AlleleNephro
Mutation Type missense
Chromosome5
Coordinate104,486,806 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Pkd2
Gene Name polycystic kidney disease 2
Synonym(s) C030034P18Rik, TRPP2, polycystin-2, PC2
Chromosomal Location 104,459,450-104,505,819 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in cardiac septation, kidney and pancreatic cysts, impaired left-right axis determination, and late-gestation lethality. Heterozygotes show kidney and liver lesions and have reduced longevity. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008861; MGI:1099818

Mapped No 
Amino Acid Change Tryptophan changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000084041]
SMART Domains Protein: ENSMUSP00000084041
Gene: ENSMUSG00000034462
AA Change: W568R

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
Pfam:PKD_channel 265 685 1.3e-171 PFAM
Pfam:Ion_trans 454 690 2.6e-25 PFAM
coiled coil region 765 794 N/A INTRINSIC
PDB:3HRN|A 834 893 8e-31 PDB
low complexity region 900 915 N/A INTRINSIC
low complexity region 949 963 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000086831)
Meta Mutation Damage Score 0.9729 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
renal/urinary system 18782757
Candidate Explorer Status CE: failed initial filter
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(25) : Chemically induced (ENU)(1) Gene trapped(12) Targeted(11) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pkd2 APN 5 104483135 missense probably damaging 1.00
IGL01527:Pkd2 APN 5 104498884 splice site probably benign
IGL01805:Pkd2 APN 5 104483093 missense probably benign 0.41
IGL02146:Pkd2 APN 5 104489291 missense probably damaging 1.00
IGL02326:Pkd2 APN 5 104477075 missense probably benign 0.38
IGL02481:Pkd2 APN 5 104486770 missense probably damaging 1.00
IGL02952:Pkd2 APN 5 104480160 missense possibly damaging 0.48
IGL03026:Pkd2 APN 5 104494887 splice site probably benign
IGL03409:Pkd2 APN 5 104489349 nonsense probably null
reggae UTSW 5 104477179 splice site probably null
samba UTSW 5 104477123 missense probably benign 0.01
IGL02988:Pkd2 UTSW 5 104503605 nonsense probably null
PIT1430001:Pkd2 UTSW 5 104459788 missense probably damaging 0.99
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0045:Pkd2 UTSW 5 104455805 unclassified probably benign
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0315:Pkd2 UTSW 5 104459850 missense possibly damaging 0.94
R0316:Pkd2 UTSW 5 104477166 missense probably damaging 1.00
R0570:Pkd2 UTSW 5 104455605 unclassified probably benign
R1277:Pkd2 UTSW 5 104502359 missense probably damaging 0.97
R1883:Pkd2 UTSW 5 104483228 missense probably damaging 1.00
R1907:Pkd2 UTSW 5 104486806 missense probably damaging 1.00
R1937:Pkd2 UTSW 5 104478924 missense probably damaging 1.00
R2023:Pkd2 UTSW 5 104466878 splice site probably null
R2080:Pkd2 UTSW 5 104477123 missense probably benign 0.01
R2081:Pkd2 UTSW 5 104460211 missense probably benign 0.00
R2098:Pkd2 UTSW 5 104478902 missense probably damaging 1.00
R2117:Pkd2 UTSW 5 104483176 missense probably damaging 1.00
R2146:Pkd2 UTSW 5 104455590 unclassified probably benign
R2163:Pkd2 UTSW 5 104455677 unclassified probably benign
R3401:Pkd2 UTSW 5 104480327 missense possibly damaging 0.68
R3732:Pkd2 UTSW 5 104489419 splice site probably null
R3733:Pkd2 UTSW 5 104489419 splice site probably null
R4409:Pkd2 UTSW 5 104466884 splice site silent
R4582:Pkd2 UTSW 5 104502344 nonsense probably null
R5189:Pkd2 UTSW 5 104459919 missense probably benign 0.22
R5191:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5195:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5198:Pkd2 UTSW 5 104483092 missense probably benign 0.06
R5326:Pkd2 UTSW 5 104486649 splice site silent
R5406:Pkd2 UTSW 5 104480332 missense probably damaging 1.00
R5542:Pkd2 UTSW 5 104486649 splice site silent
R5543:Pkd2 UTSW 5 104489333 missense probably damaging 1.00
R5633:Pkd2 UTSW 5 104498506 missense probably damaging 0.98
R5887:Pkd2 UTSW 5 104498539 missense probably damaging 1.00
R5906:Pkd2 UTSW 5 104477179 splice site probably null
R5924:Pkd2 UTSW 5 104498558 missense probably damaging 0.99
R6361:Pkd2 UTSW 5 104486680 nonsense probably null
R6455:Pkd2 UTSW 5 104459924 missense probably benign 0.00
R6495:Pkd2 UTSW 5 104489293 missense probably damaging 1.00
R6735:Pkd2 UTSW 5 104480329 missense probably damaging 1.00
R6837:Pkd2 UTSW 5 104477043 missense probably damaging 1.00
R7192:Pkd2 UTSW 5 104486657 missense probably benign 0.00
R7477:Pkd2 UTSW 5 104483242 missense probably benign 0.19
R7560:Pkd2 UTSW 5 104480353 missense probably damaging 1.00
R7867:Pkd2 UTSW 5 104483120 missense probably damaging 1.00
R7894:Pkd2 UTSW 5 104480237 missense probably damaging 1.00
R8251:Pkd2 UTSW 5 104498487 missense probably benign 0.01
Z1088:Pkd2 UTSW 5 104498861 missense probably damaging 1.00
Z1176:Pkd2 UTSW 5 104460049 missense probably benign 0.43
Mode of Inheritance Unknown
Local Stock Live Mice
MMRRC Submission 038225-MU
Last Updated 2019-09-04 9:48 PM by Anne Murray
Record Created 2014-10-30 11:56 AM by Lauren Prince
Record Posted 2016-05-16
Phenotypic Description
Figure 1. Representation of the phenotype observed in the nephro mice. The left mouse is a depiction of the anatomy of a wild-type mouse, while the right mouse is a depiction of the kidney phenotype in the nephro mouse.

The Nephro phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1907, some of which showed swollen abdomens; dissection of the affected mice revealed that the mice had polycystic kidneys (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 114 mutations. The polycystic kidney phenotype mimicked that of other mice with mutations in Pkd2 (see MGI for a list of Pkd2 alleles). The mutation in Pkd2 is a T to A transversion at base pair 56,423,352 (v38) on chromosome 7, or base pair 29,583 in the GenBank genomic region NC_000071 encoding Pkd2. The mutation corresponds to residue 1,882 in the NM_008861 mRNA sequence in exon 7 of 15 total exons. 

 

1867 ATGGTATTTTTGGTCTGGATTAAGCTCTTCAAA

563  -M--V--F--L--V--W--I--K--L--F--K-

 

The mutated nucleotide is indicated in red. The mutation results in a tryptophan (W) to arginine (G) substitution at position 568 (W568R) in the polycystin-2 (PC2) protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction
Figure 2. Domain organization and topology of PC-2. PC-2 has six transmembrane domains, an EF-hand (EF-H) and a coiled-coil (CC) motif. The Nephro mutation results in a tryptophan (W) to arginine (R) substitution at position 568 (W568R). The location of the Nephro mutation is indicated in both the domain (A) and topology (B) images.

Pkd2 encodes polycystin-2 (PC-2; alternatively, PKD2 or transient receptor potential (TRP) cation channel, subfamily P, member 2 [TRPP2]) is a member of the TRP cation channel superfamily (see the record for gingame for information about TRPV5 [TRP cation channel, subfamily V, member 5]). PC-2 has six transmembrane domains (amino acids 222-242, 467-487, 504-524, 549-569, 597-617, and 657-677) and cytoplasmic N- and C-termini [Figure 2; (1;2)]. A pore structure is formed by transmembrane domains 5 and 6 (amino acids 634-659); transmembrane domains 1-4 function as a sensor (1;3).

 

The N-terminus of PC-2 contains a dimerization domain that mediates formation of PC-2 tetramers (4). In addition to the N-terminus, Cys632 within the third extracellular loop is essential for PC-2 dimerization and is proposed to function in disulfide bond formation between PC-2 monomers (5). Mutation of Cys632 to alanine (C632A) reduced the calcium release function of PC-2, indicating that it is required to form functional ER tetrameric PC-2 channels (5).

 

Amino acids 797-820 are predicted to comprise an ER-retention motif.  An acidic cluster at the end of the ER-retention motif is essential for the interaction between PC-2 and IP3R (6).

 

Within the C-terminus of PC-2, a coiled-coil region (amino acids 821-966; UniProt) is linked to a calcium-binding EF-hand (amino acids 702-797; UniProt) by a flexible acidic linker (4;7-10). The coiled-coil domain mediates heteromultimeric interactions between PC-2 and several proteins (e.g., polycystin-1 (PC-1), alpha-actinins, Hax-1, filamin, ID2, TRPC-1, TRPV4, InsP3R, RyR2, and PDE4C), which facilitates functional diversity among several channel complexes [Table 1; (3;8;11)]; the coiled-coil domain is not necessary for PC-2 homomeric interactions (4). The EF-hand of PC-2 binds calcium and is required for channel gating (7;9;10). In response to calcium binding, discrete conformational changes in the C-terminus of PC-2 mediates gating (7;9). Mutations within the EF-hand domain prevent calcium binding and result in completely inactive PC-2, subsequently inhibiting calcium release from the endoplasmic reticulum (ER) (7).

 

Table 1. PC-2-interacting proteins

PC-2-interacting protein

Brief Description

PC-2-associated function

References

PC-1

Receptor-activated non-selective calcium permeable cation channel

Regulates several signaling pathways to maintain normal renal tubular structure and function; see the Background section, below, for more details

(4;10-15)

Alpha-actinins

Microfilament protein

Mediates cell adhesion, proliferation, and migration

(16)

Hax-1 and cortactin

F-actin-binding proteins

Links PC-2 to cell-matrix contacts

(17)

Filamin

Actin cross-linking protein that functions in scaffolding, membrane stabilization, and signal transduction

Inhibits the channel function of PC-2

(18)

ID2

Cell cycle regulatory protein and inhibitor of basic helix-loop-helix transcription factors (e.g., the cyclin-dependent kinase inhibitor, p21)

Sequesters ID2 in the cytoplasm to promote cell proliferation and inhibit differentiation through the ID2-p21-CDK2 pathway

(19)

TRPC1

Non-selective calcium permeable cation channel

Unknown

(3;20)

TRPV4

Non-selective calcium permeable cation channel

Cutaneous thermosensation in primary cilia; regulates cell proliferation and cyst formation in renal collecting duct cells upon epidermal growth factor (EGF; see Velvet for information about the EGF receptor) stimulation

(21-24)

TRPC1 & TRPV4

Non-selective calcium permeable cation channels

PC-2-TRPC1-TRPV4 multimer mediates flow-induced calcium increase in native vascular endothelial cells

(25)

InsP3R

Intracellular calcium channel in the ER

Stimulates PC-2 to function as an intracellular calcium release channel in the ER

(6;26;27)

RyR2

Intracellular calcium channel in the ER essential for the regulation of muscle contraction

Inhibits RyR2 function

(28-30)

PDE4C-AKAP150-Adenyl cylase 5/6-PKA complex

 

Modulates cyclic AMP levels and subsequent signaling in primary cilia

(31)

Abbreviations: PC-1, polycystin-1; Hax-1, HCLS1 associated X-1; ID2, inhibitor of DNA binding 2; TRPC-1, transient receptor potential cation channel, subfamily C, member 1; TRPV4, transient receptor potential cation channel, subfamily V, member 4; InsP3R, inositol 1,4,5-trisphosphate receptor 1; RyR2, cardiac ryanodine receptor 2; PDE4C, phosphodiesterase 4C; PKA, protein kinase A; AKAP150, A-kinase anchoring protein 150

 

PC-2 undergoes several posttranslational modifications. PC-2 is phosphorylated at several sites including Ser76, Ser801, and Ser812 (1;32-34). Glycogen synthase kinase (GSK)-3-dependent phosphorylation of Ser76 is required for PC-2 retention at the basolateral membrane and for pronephric development in zebrafish (33). CK2-dependent phosphorylation of Ser812 is required for the retrograde trafficking of PC-2 through binding to the adaptor proteins PACS-1 and PACS-2 as well as for the cytoplasmic retention of ID2 (19;34;35). Protein kinase D (PrKD)-mediated phosphorylation of Ser801 is increased in response to serum and EGF stimulation (32). Mutation of Ser801 results in inhibition of ATP-stimulated calcium release from ER stores in Madin-Darby canine kidney (MDCK) cells and reduction in PC-2-mediated inhibition of cell proliferation (32). PC-2 has seven putative N-glycosylation sites at Asn3, 299, 305, 328, 362, 375, and 580 in humans (36). Four asparagines (Asn297, 303, 326, and 360) in mouse and five asparagines (Asn299, 305, 328, 362, and 375) in humans are located within the first extracellular loop between TM 1 and TM2 (amino acids 245-468) (36). Mutations of all of the putative glycosylated asparagines within the first extracellular loop to glycines (N299G/N305G/N328G/N362G) or glutamines (N299Q/N305Q/N328Q/N362Q) resulted in deficient synthesis of PC-2.

 

Alternative splicing of exons 6 (PC-2Δ6), 7 (PC-2Δ7), 9 (PC-2Δ9) and 12-13 (PC-2Δ12-13) in Pkd2 generates multiple PC-2 isoforms (37). The PC-2Δ6 transcript lacks a portion of exon 6 and results in a shift in the reading frame to generate a truncated protein of 481 amino acids. The PC-2Δ7 transcript lacks all of exon 7 and encodes an in-frame protein of 910 amino acids. The PC-2Δ7 protein is stable, but does not interact with PC-1 due to alterations of the topology of the C-terminus (37). The PC-2Δ7 protein is expressed primarily in the brain, with lower level of expression in kidney and lung (37). The PC-2Δ9 transcript lacks all of exon 9, resulting in a frameshift that would encode a protein of 644 amino acids. The PC-2Δ12-13 transcript is a minor form of PC-2, resulting in an in-frame deletion of exons 12 and 13 that encodes a protein of 872 amino acids.

 

The mutation in the Nephro mice is a tryptophan (W) to arginine (R) substitution at position 568 (W568R). Amino acid 568 is within TM domain 4.

Expression/Localization

PC-2 is ubiquitously expressed during development through the two-cell to compact blastocyst stage (38). As development progresses, PC-2 is expressed in the ovary, fetal craniofacial structures, fetal and adult kidney, testis, small intestine, pancreas, liver, lung, bowel, brain, thymus, reproductive organs, placenta, skeletal muscle, aortic vascular smooth muscle, and rat left ventricular myocytes (1;39-44). Within the kidney, PC-2 localizes to the plasma membrane of primary cilia of the kidney epithelium (24), the plasma membrane of cells of the ascending limb of Henle, the distal convoluted tubule, the proximal tubule, and collecting ducts (41). PC-2 also localizes to the ER membrane (29). In mouse inner medullar collecting duct cells and Madin-Darby canine kidney (MDCK) epithelial cells, endogenous PC-2 localized at the plasma membrane and the primary cilium; heterologously-expressed PC-2 exhibited predominant ER localization (45).

Background

The TRP ion channel family has seven subfamilies: TRP Canonical (TRPC), TRP Melastatin (TRPM), TRP Ankyrin (TRPA), TRP Mucolipin (TRPML), TRP Polycystin (TRPP), TRP NOPMC (TRPN), and TRP Vanilloid (TRPV) (46;47).  These receptor subfamilies respond to several external stimuli such as light (i.e. phototransduction), chemicals, and temperature as well as mechanical and osmotic pressures (48;49). TRP channels have roles in diverse processes including olfaction, nociception, speech, regulation of blood circulation, pain signal transduction, gut motility, mineral absorption, fluid balance, epithelial Ca2+ transport, development of airway and bladder hypersensitivities, and cell survival, growth and death (48). The TRP channels function by facilitating the transmembrane flow of cations (i.e. Na+ and Ca2+) down electrochemical gradients to depolarize the cell as well as to mediate signal transduction (50). TRP channels can be activated through the activation of phospholipase C (PLC) by G protein-coupled receptors and receptor tyrosine kinases. 

 

Figure 3. Function of PC-2 in Ca2+ signaling. Store operated channels (SOC), the plasma membrane Ca2+-ATPase (PMCA), G-coupled protein receptor (GPCR), and polycystin-1 (PC-1) are on the plasma membrane. PC-1 and PC-2 interact via their coiled-coil domains in the primary cilia. When the cilia sense flow, PC-1 is activated through an unknown mechanism. Upon PC-1 activation, PC-1 subsequently activates PC-2, which leads to entry of Ca2+ from the extracellular space into the cytosol. The Ca2+ then activates the RyR in a Ca2+-induced Ca2+ release (CICR) mechanism. On the plasma membrane, GPCRs activate a trimeric G-protein containing Gq; Gq then stimulates phospholipase C beta (PLCβ) to break down phosphatidylinositol-4,5-bisphosphate (PIP2) into InsP3 and diacylglycerol. When InsP3 binds to InsP3R, Ca2+ is released from the endoplasmic reticulum (ER) into the cytosol. Ca2+ release through the InsP3R can activate PC2 to potentiate Ca2+ release from the ER stores.  Figure and legend adapted from G.I. Anyatonwu and B.E. Ehrlich (2004).

PC-2 is a calcium-permeable nonselective cation channel that functions at several locations including the primary cilia, basolateral membrane, and the ER to subsequently mediate proliferation, apoptosis, tubulogenesis, and fluid secretion through the regulation of calcium transport and calcium signaling [Figure 3; (3;45)]. PC-2, often together with PC-1, respond to physical or chemical stimuli (e.g., fluid flow) to stimulate calcium influx through PC-2, subsequently resulting in calcium release from intracellular stores (14;24;29). PC-2 is activated by upon EGF stimulation (23). Activation of PLC leads to hydrolysis of PIP2, producing diacylglycerol (DAG) and inositol (1,4,5) triphosphate (IP3).  Strong evidence supports roles for PIP2 hydrolysis and DAG production in modulating TRP channel activity. 

 

InsP3R and RyR2 are intracellular calcium channels in the ER. RyR2 is a calcium release channel that is essential for calcium-induced calcium release, a prerequisite for excitation-contraction coupling (51). Interactions between PC-2 and InsP3R or RyR2 stimulates PC-2 to function as an intracellular calcium release channel in the ER (26-29). In smooth muscle, PC-2 reduced the activity of store-operated calcium channels (40). Interaction between PC-2 and RyR2 resulted in functional inhibition of RyR2 by PC-2 by stabilizing RyR2 in the closed state and subsequently inhibiting the release of calcium (28). Loss of PC-2-mediated inhibition of RyR2 in PC-2-deficient cardiomyocytes results in a higher frequency of spontaneous calcium oscillations, reduced sarcoplasmic reticulum calcium stores, and reduced calcium transient amplitude compared to wild-type cells (28). In autosomal dominant polycystic kidney disease patients with PKD2 mutations, there is a high rate of idiopathic dilated cardiomyopathy compared to the general population (51).

 

In the embryonic node, ciliary movement generate nodal flow, an external liquid flow that determines left-right (L-R) asymmetric gene expression including Nodal and Cerl-2 (52-56). Increased levels of endodermal cell calcium is proposed to regulate the conversion of nodal flow to asymmetric gene expression (55). PC-2 acts independently of PC-1 to regulate L-R symmetry at the embryonic node (38;57;58). Field et al. propose that Pkd1l1 and PC-2 form a cilia-specific, stress-responsive channel in the node that regulates L-R asymmetry (59). PC-2 physically interacts with Pkd1l1 in the cilium to mediate L-R patterning (59). Mutations in Pkdl1l phenocopy those of Pkd2 mutants in that both develop gross situs abnormalities; Pkd1l1 mutants do not exhibit kidney development defects (59). Pkd2-deficient (Pkd2−/−LacZ+/+) mice exhibit right pulmonary isomerism, randomization of embryonic turning, heart looping, and abdominal situs (38). PC-2 is proposed to act downstream or in parallel to sonic hedgehog (Shh) and upstream of the Nodal cascade. Mutations in human PKD2 have also been linked to left-right asymmetry defects (56).

 

PC-2 functions as a mechanoreceptor in postnatal craniofacial development and growth (44). Conditional knockout of Pkd2 in neural crest-derived cells resulted in craniofacial structural abnormalities (e.g., fractured molar roots, distorted incisors, alveolar bone loss, compressed temporomandibular joints, and skull shape abnormalities) (44).

 

In human syncytiotrophoblast, PC-2 functions as a nonselective cation channel with a high permeability rate to calcium (60). PC-2 (and PC-1) are required for normal placental development in both the trophoblast and fetal vascular compartments (39). Deletion of either Pkd1 or Pkd2 resulted in placental abnormality (i.e., polyhydramnios) and reduced embryonic viability (39).

 

Hepatocyte growth factor (HGF) and EGF stimulate cell proliferation and branching via ERK1/2 in the p42/44 MAPK pathway (61;62). Exogenous expression of PC-2 resulted in decreased HGF-induced branching morphogenesis in kidney epithelial cells, indicating that PC-2 mediates tubule maturation by negatively regulating cell growth (62).

 

Mutations in PKD2 are linked to autosomal dominant polycystic kidney disease 2 (ADPKD2; OMIM: #613095) (1;63-65). Patients with ADPKD2 have renal cysts, liver cysts, and intracranial aneurysm. In addition, patients often have acute and chronic pain as well as nephrolithiasis. ADPKD2 leads to progressive destruction of normal kidney tissue and approximately 50% of patients with ADPKD2 develop end-stage renal disease by 60 years of age. Patients with ADPKD2 exhibit variable phenotypes including differences in the rate of loss of glomerular filtration, the age of onset of end-stage renal disease, occurrence of hypertension, symptomatic extrarenal cysts, and subarachnoid hemorrhage.

Putative Mechanism

Pkd2-deficient (Pkd2-/-) mice are embryonic lethal between embryonic day (E) 13.5 and birth (38;66). Mice that express mutant Pkd2 alleles (e.g., Pkd2WS25) as well as Pkd2-/- and Pkd2+/- mice develop polycystic kidney similar to those observed in humans with ADPKD2 (66;67). The Pkd2-/- mice exhibit progressive cyst formation in the nephrons and pancreatic ducts starting at E15.5 as well as defects in cardiac septation (66). Kidney development was normal up to E14.5, while pancreatic development was normal up to E13.5 in the Pkd2-/- mice (66). After E14.5, the pancreatic ducts in the Pkd2-/- mice exhibited progressive cystic dilation. Heterozygous Pkd2 (Pkd2+/-) mice exhibited renal failure and premature death by approximately 65 weeks (66).  The phenotype observed in the Nephro mice indicate that PC-2Nephro is defective.

Primers PCR Primer
Nephro_pcr_F: GGCTCAGTAATATGGTCAGTCC
Nephro_pcr_R: TGCCATCTACATGACTGCAAAC

Sequencing Primer
Nephro_seq_F: TCAGTAATATGGTCAGTCCTCTAATC
Nephro_seq_R: CTATGCAGCAACCTCATCTGG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 448 nucleotides is amplified (chromosome 5, + strand):


1   ggctcagtaa tatggtcagt cctctaatca gtagattaaa aataggcatt ttaaggtaga
61  gtgtctattt cttaactgat gtgataagta taactctttt tgtcttccag ttatctgtag
121 tagctatggt gattaacatt taccgaatgt caaatgcaga ggggctgcta cagtttcttg
181 aagatcaaaa ttctttcccc aactttgagc atgtggcata ctggcaaata cagttcaaca
241 atataagtgc tgtcatggta tttttggtct ggattaaggt aacttatgtc acattcttca
301 tatatagatg cattgatgat gatgatgatg atgatgatga tgatgatgat gatttacaca
361 gatcattgga agacatagat ttgccttttt aggctgattg aaatggccag atgaggttgc
421 tgcatagttt gcagtcatgt agatggca


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsLauren Prince, Jamie Russell, and Bruce Beutler