Phenotypic Mutation 'Nephro' (pdf version)
Allele | Nephro |
Mutation Type |
missense
|
Chromosome | 5 |
Coordinate | 104,634,672 bp (GRCm39) |
Base Change | T ⇒ A (forward strand) |
Gene |
Pkd2
|
Gene Name | polycystin 2, transient receptor potential cation channel |
Synonym(s) | TRPP2, polycystin-2, C030034P18Rik, PC2 |
Chromosomal Location |
104,607,316-104,653,685 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011] PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in cardiac septation, kidney and pancreatic cysts, impaired left-right axis determination, and late-gestation lethality. Heterozygotes show kidney and liver lesions and have reduced longevity. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_008861; MGI:1099818
|
Mapped | No |
Amino Acid Change |
Tryptophan changed to Arginine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000084041]
|
AlphaFold |
O35245 |
SMART Domains |
Protein: ENSMUSP00000084041 Gene: ENSMUSG00000034462 AA Change: W568R
Domain | Start | End | E-Value | Type |
low complexity region
|
25 |
43 |
N/A |
INTRINSIC |
low complexity region
|
58 |
79 |
N/A |
INTRINSIC |
low complexity region
|
93 |
115 |
N/A |
INTRINSIC |
low complexity region
|
119 |
138 |
N/A |
INTRINSIC |
transmembrane domain
|
225 |
247 |
N/A |
INTRINSIC |
Pfam:PKD_channel
|
265 |
685 |
1.3e-171 |
PFAM |
Pfam:Ion_trans
|
454 |
690 |
2.6e-25 |
PFAM |
coiled coil region
|
765 |
794 |
N/A |
INTRINSIC |
PDB:3HRN|A
|
834 |
893 |
8e-31 |
PDB |
low complexity region
|
900 |
915 |
N/A |
INTRINSIC |
low complexity region
|
949 |
963 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000086831)
|
Meta Mutation Damage Score |
0.9729 |
Is this an essential gene? |
Essential (E-score: 1.000) |
Phenotypic Category |
Unknown |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All mutations/alleles(25) : Chemically induced (ENU)(1) Gene trapped(12) Targeted(11) Transgenic(1)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00898:Pkd2
|
APN |
5 |
104631001 |
missense |
probably damaging |
1.00 |
IGL01527:Pkd2
|
APN |
5 |
104646750 |
splice site |
probably benign |
|
IGL01805:Pkd2
|
APN |
5 |
104630959 |
missense |
probably benign |
0.41 |
IGL02146:Pkd2
|
APN |
5 |
104637157 |
missense |
probably damaging |
1.00 |
IGL02326:Pkd2
|
APN |
5 |
104624941 |
missense |
probably benign |
0.38 |
IGL02481:Pkd2
|
APN |
5 |
104634636 |
missense |
probably damaging |
1.00 |
IGL02952:Pkd2
|
APN |
5 |
104628026 |
missense |
possibly damaging |
0.48 |
IGL03026:Pkd2
|
APN |
5 |
104642753 |
splice site |
probably benign |
|
IGL03409:Pkd2
|
APN |
5 |
104637215 |
nonsense |
probably null |
|
reggae
|
UTSW |
5 |
104625045 |
splice site |
probably null |
|
samba
|
UTSW |
5 |
104624989 |
missense |
probably benign |
0.01 |
IGL02988:Pkd2
|
UTSW |
5 |
104651471 |
nonsense |
probably null |
|
PIT1430001:Pkd2
|
UTSW |
5 |
104607654 |
missense |
probably damaging |
0.99 |
R0020:Pkd2
|
UTSW |
5 |
104651382 |
missense |
probably damaging |
1.00 |
R0020:Pkd2
|
UTSW |
5 |
104651382 |
missense |
probably damaging |
1.00 |
R0045:Pkd2
|
UTSW |
5 |
104603671 |
unclassified |
probably benign |
|
R0070:Pkd2
|
UTSW |
5 |
104614856 |
missense |
probably damaging |
0.99 |
R0070:Pkd2
|
UTSW |
5 |
104614856 |
missense |
probably damaging |
0.99 |
R0315:Pkd2
|
UTSW |
5 |
104607716 |
missense |
possibly damaging |
0.94 |
R0316:Pkd2
|
UTSW |
5 |
104625032 |
missense |
probably damaging |
1.00 |
R0570:Pkd2
|
UTSW |
5 |
104603471 |
unclassified |
probably benign |
|
R1277:Pkd2
|
UTSW |
5 |
104650225 |
missense |
probably damaging |
0.97 |
R1883:Pkd2
|
UTSW |
5 |
104631094 |
missense |
probably damaging |
1.00 |
R1907:Pkd2
|
UTSW |
5 |
104634672 |
missense |
probably damaging |
1.00 |
R1937:Pkd2
|
UTSW |
5 |
104626790 |
missense |
probably damaging |
1.00 |
R2023:Pkd2
|
UTSW |
5 |
104614744 |
splice site |
probably null |
|
R2080:Pkd2
|
UTSW |
5 |
104624989 |
missense |
probably benign |
0.01 |
R2081:Pkd2
|
UTSW |
5 |
104608077 |
missense |
probably benign |
0.00 |
R2098:Pkd2
|
UTSW |
5 |
104626768 |
missense |
probably damaging |
1.00 |
R2117:Pkd2
|
UTSW |
5 |
104631042 |
missense |
probably damaging |
1.00 |
R2146:Pkd2
|
UTSW |
5 |
104603456 |
unclassified |
probably benign |
|
R2163:Pkd2
|
UTSW |
5 |
104603543 |
unclassified |
probably benign |
|
R3401:Pkd2
|
UTSW |
5 |
104628193 |
missense |
possibly damaging |
0.68 |
R3732:Pkd2
|
UTSW |
5 |
104637285 |
splice site |
probably null |
|
R3733:Pkd2
|
UTSW |
5 |
104637285 |
splice site |
probably null |
|
R4409:Pkd2
|
UTSW |
5 |
104614750 |
splice site |
silent |
|
R4582:Pkd2
|
UTSW |
5 |
104650210 |
nonsense |
probably null |
|
R5189:Pkd2
|
UTSW |
5 |
104607785 |
missense |
probably benign |
0.22 |
R5191:Pkd2
|
UTSW |
5 |
104634547 |
missense |
probably benign |
0.05 |
R5195:Pkd2
|
UTSW |
5 |
104634547 |
missense |
probably benign |
0.05 |
R5198:Pkd2
|
UTSW |
5 |
104630958 |
missense |
probably benign |
0.06 |
R5326:Pkd2
|
UTSW |
5 |
104634515 |
splice site |
silent |
|
R5406:Pkd2
|
UTSW |
5 |
104628198 |
missense |
probably damaging |
1.00 |
R5542:Pkd2
|
UTSW |
5 |
104634515 |
splice site |
silent |
|
R5543:Pkd2
|
UTSW |
5 |
104637199 |
missense |
probably damaging |
1.00 |
R5633:Pkd2
|
UTSW |
5 |
104646372 |
missense |
probably damaging |
0.98 |
R5887:Pkd2
|
UTSW |
5 |
104646405 |
missense |
probably damaging |
1.00 |
R5906:Pkd2
|
UTSW |
5 |
104625045 |
splice site |
probably null |
|
R5924:Pkd2
|
UTSW |
5 |
104646424 |
missense |
probably damaging |
0.99 |
R6361:Pkd2
|
UTSW |
5 |
104634546 |
nonsense |
probably null |
|
R6455:Pkd2
|
UTSW |
5 |
104607790 |
missense |
probably benign |
0.00 |
R6495:Pkd2
|
UTSW |
5 |
104637159 |
missense |
probably damaging |
1.00 |
R6735:Pkd2
|
UTSW |
5 |
104628195 |
missense |
probably damaging |
1.00 |
R6837:Pkd2
|
UTSW |
5 |
104624909 |
missense |
probably damaging |
1.00 |
R7192:Pkd2
|
UTSW |
5 |
104634523 |
missense |
probably benign |
0.00 |
R7477:Pkd2
|
UTSW |
5 |
104631108 |
missense |
probably benign |
0.19 |
R7560:Pkd2
|
UTSW |
5 |
104628219 |
missense |
probably damaging |
1.00 |
R7867:Pkd2
|
UTSW |
5 |
104630986 |
missense |
probably damaging |
1.00 |
R7894:Pkd2
|
UTSW |
5 |
104628103 |
missense |
probably damaging |
1.00 |
R8251:Pkd2
|
UTSW |
5 |
104646353 |
missense |
probably benign |
0.01 |
R8360:Pkd2
|
UTSW |
5 |
104607653 |
nonsense |
probably null |
|
R8368:Pkd2
|
UTSW |
5 |
104607653 |
nonsense |
probably null |
|
R8526:Pkd2
|
UTSW |
5 |
104637102 |
missense |
probably damaging |
1.00 |
R8751:Pkd2
|
UTSW |
5 |
104637151 |
missense |
probably damaging |
1.00 |
R8956:Pkd2
|
UTSW |
5 |
104631090 |
missense |
probably damaging |
1.00 |
R9101:Pkd2
|
UTSW |
5 |
104628230 |
missense |
probably damaging |
1.00 |
R9271:Pkd2
|
UTSW |
5 |
104626959 |
splice site |
probably null |
|
R9452:Pkd2
|
UTSW |
5 |
104614841 |
missense |
probably damaging |
1.00 |
R9459:Pkd2
|
UTSW |
5 |
104614800 |
missense |
probably damaging |
1.00 |
R9541:Pkd2
|
UTSW |
5 |
104607927 |
missense |
probably damaging |
0.98 |
R9671:Pkd2
|
UTSW |
5 |
104637256 |
missense |
probably damaging |
1.00 |
R9682:Pkd2
|
UTSW |
5 |
104626790 |
missense |
probably damaging |
1.00 |
R9737:Pkd2
|
UTSW |
5 |
104651349 |
missense |
possibly damaging |
0.92 |
Z1088:Pkd2
|
UTSW |
5 |
104646727 |
missense |
probably damaging |
1.00 |
Z1176:Pkd2
|
UTSW |
5 |
104607915 |
missense |
probably benign |
0.43 |
|
Mode of Inheritance |
Unknown |
Local Stock | Live Mice |
MMRRC Submission |
038225-MU
|
Last Updated |
2019-09-04 9:48 PM
by Anne Murray
|
Record Created |
2014-10-30 11:56 AM
by Lauren Prince
|
Record Posted |
2016-05-16 |
Phenotypic Description |
The Nephro phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1907, some of which showed swollen abdomens; dissection of the affected mice revealed that the mice had polycystic kidneys (Figure 1).
|
Nature of Mutation | Whole exome HiSeq sequencing of the G1 grandsire identified 114 mutations. The polycystic kidney phenotype mimicked that of other mice with mutations in Pkd2 (see MGI for a list of Pkd2 alleles). The mutation in Pkd2 is a T to A transversion at base pair 56,423,352 (v38) on chromosome 7, or base pair 29,583 in the GenBank genomic region NC_000071 encoding Pkd2. The mutation corresponds to residue 1,882 in the NM_008861 mRNA sequence in exon 7 of 15 total exons.
1867 ATGGTATTTTTGGTCTGGATTAAGCTCTTCAAA
563 -M--V--F--L--V--W--I--K--L--F--K-
|
The mutated nucleotide is indicated in red. The mutation results in a tryptophan (W) to arginine (G) substitution at position 568 (W568R) in the polycystin-2 (PC2) protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Pkd2 encodes polycystin-2 (PC-2; alternatively, PKD2 or transient receptor potential (TRP) cation channel, subfamily P, member 2 [TRPP2]) is a member of the TRP cation channel superfamily (see the record for gingame for information about TRPV5 [TRP cation channel, subfamily V, member 5]). PC-2 has six transmembrane domains (amino acids 222-242, 467-487, 504-524, 549-569, 597-617, and 657-677) and cytoplasmic N- and C-termini [Figure 2; (1;2)]. A pore structure is formed by transmembrane domains 5 and 6 (amino acids 634-659); transmembrane domains 1-4 function as a sensor (1;3). The N-terminus of PC-2 contains a dimerization domain that mediates formation of PC-2 tetramers (4). In addition to the N-terminus, Cys632 within the third extracellular loop is essential for PC-2 dimerization and is proposed to function in disulfide bond formation between PC-2 monomers (5). Mutation of Cys632 to alanine (C632A) reduced the calcium release function of PC-2, indicating that it is required to form functional ER tetrameric PC-2 channels (5). Amino acids 797-820 are predicted to comprise an ER-retention motif. An acidic cluster at the end of the ER-retention motif is essential for the interaction between PC-2 and IP3R (6). Within the C-terminus of PC-2, a coiled-coil region (amino acids 821-966; UniProt) is linked to a calcium-binding EF-hand (amino acids 702-797; UniProt) by a flexible acidic linker (4;7-10). The coiled-coil domain mediates heteromultimeric interactions between PC-2 and several proteins (e.g., polycystin-1 (PC-1), alpha-actinins, Hax-1, filamin, ID2, TRPC-1, TRPV4, InsP3R, RyR2, and PDE4C), which facilitates functional diversity among several channel complexes [Table 1; (3;8;11)]; the coiled-coil domain is not necessary for PC-2 homomeric interactions (4). The EF-hand of PC-2 binds calcium and is required for channel gating (7;9;10). In response to calcium binding, discrete conformational changes in the C-terminus of PC-2 mediates gating (7;9). Mutations within the EF-hand domain prevent calcium binding and result in completely inactive PC-2, subsequently inhibiting calcium release from the endoplasmic reticulum (ER) (7). Table 1. PC-2-interacting proteins
PC-2-interacting protein
|
Brief Description
|
PC-2-associated function
|
References
|
PC-1
|
Receptor-activated non-selective calcium permeable cation channel
|
Regulates several signaling pathways to maintain normal renal tubular structure and function; see the Background section, below, for more details
|
(4;10-15)
|
Alpha-actinins
|
Microfilament protein
|
Mediates cell adhesion, proliferation, and migration
|
(16)
|
Hax-1 and cortactin
|
F-actin-binding proteins
|
Links PC-2 to cell-matrix contacts
|
(17)
|
Filamin
|
Actin cross-linking protein that functions in scaffolding, membrane stabilization, and signal transduction
|
Inhibits the channel function of PC-2
|
(18)
|
ID2
|
Cell cycle regulatory protein and inhibitor of basic helix-loop-helix transcription factors (e.g., the cyclin-dependent kinase inhibitor, p21)
|
Sequesters ID2 in the cytoplasm to promote cell proliferation and inhibit differentiation through the ID2-p21-CDK2 pathway
|
(19)
|
TRPC1
|
Non-selective calcium permeable cation channel
|
Unknown
|
(3;20)
|
TRPV4
|
Non-selective calcium permeable cation channel
|
Cutaneous thermosensation in primary cilia; regulates cell proliferation and cyst formation in renal collecting duct cells upon epidermal growth factor (EGF; see Velvet for information about the EGF receptor) stimulation
|
(21-24)
|
TRPC1 & TRPV4
|
Non-selective calcium permeable cation channels
|
PC-2-TRPC1-TRPV4 multimer mediates flow-induced calcium increase in native vascular endothelial cells
|
(25)
|
InsP3R
|
Intracellular calcium channel in the ER
|
Stimulates PC-2 to function as an intracellular calcium release channel in the ER
|
(6;26;27)
|
RyR2
|
Intracellular calcium channel in the ER essential for the regulation of muscle contraction
|
Inhibits RyR2 function
|
(28-30)
|
PDE4C-AKAP150-Adenyl cylase 5/6-PKA complex
|
|
Modulates cyclic AMP levels and subsequent signaling in primary cilia
|
(31)
|
Abbreviations: PC-1, polycystin-1; Hax-1, HCLS1 associated X-1; ID2, inhibitor of DNA binding 2; TRPC-1, transient receptor potential cation channel, subfamily C, member 1; TRPV4, transient receptor potential cation channel, subfamily V, member 4; InsP3R, inositol 1,4,5-trisphosphate receptor 1; RyR2, cardiac ryanodine receptor 2; PDE4C, phosphodiesterase 4C; PKA, protein kinase A; AKAP150, A-kinase anchoring protein 150 PC-2 undergoes several posttranslational modifications. PC-2 is phosphorylated at several sites including Ser76, Ser801, and Ser812 (1;32-34). Glycogen synthase kinase (GSK)-3-dependent phosphorylation of Ser76 is required for PC-2 retention at the basolateral membrane and for pronephric development in zebrafish (33). CK2-dependent phosphorylation of Ser812 is required for the retrograde trafficking of PC-2 through binding to the adaptor proteins PACS-1 and PACS-2 as well as for the cytoplasmic retention of ID2 (19;34;35). Protein kinase D (PrKD)-mediated phosphorylation of Ser801 is increased in response to serum and EGF stimulation (32). Mutation of Ser801 results in inhibition of ATP-stimulated calcium release from ER stores in Madin-Darby canine kidney (MDCK) cells and reduction in PC-2-mediated inhibition of cell proliferation (32). PC-2 has seven putative N-glycosylation sites at Asn3, 299, 305, 328, 362, 375, and 580 in humans (36). Four asparagines (Asn297, 303, 326, and 360) in mouse and five asparagines (Asn299, 305, 328, 362, and 375) in humans are located within the first extracellular loop between TM 1 and TM2 (amino acids 245-468) (36). Mutations of all of the putative glycosylated asparagines within the first extracellular loop to glycines (N299G/N305G/N328G/N362G) or glutamines (N299Q/N305Q/N328Q/N362Q) resulted in deficient synthesis of PC-2. Alternative splicing of exons 6 (PC-2Δ6), 7 (PC-2Δ7), 9 (PC-2Δ9) and 12-13 (PC-2Δ12-13) in Pkd2 generates multiple PC-2 isoforms (37). The PC-2Δ6 transcript lacks a portion of exon 6 and results in a shift in the reading frame to generate a truncated protein of 481 amino acids. The PC-2Δ7 transcript lacks all of exon 7 and encodes an in-frame protein of 910 amino acids. The PC-2Δ7 protein is stable, but does not interact with PC-1 due to alterations of the topology of the C-terminus (37). The PC-2Δ7 protein is expressed primarily in the brain, with lower level of expression in kidney and lung (37). The PC-2Δ9 transcript lacks all of exon 9, resulting in a frameshift that would encode a protein of 644 amino acids. The PC-2Δ12-13 transcript is a minor form of PC-2, resulting in an in-frame deletion of exons 12 and 13 that encodes a protein of 872 amino acids. The mutation in the Nephro mice is a tryptophan (W) to arginine (R) substitution at position 568 (W568R). Amino acid 568 is within TM domain 4.
|
Expression/Localization | PC-2 is ubiquitously expressed during development through the two-cell to compact blastocyst stage (38). As development progresses, PC-2 is expressed in the ovary, fetal craniofacial structures, fetal and adult kidney, testis, small intestine, pancreas, liver, lung, bowel, brain, thymus, reproductive organs, placenta, skeletal muscle, aortic vascular smooth muscle, and rat left ventricular myocytes (1;39-44). Within the kidney, PC-2 localizes to the plasma membrane of primary cilia of the kidney epithelium (24), the plasma membrane of cells of the ascending limb of Henle, the distal convoluted tubule, the proximal tubule, and collecting ducts (41). PC-2 also localizes to the ER membrane (29). In mouse inner medullar collecting duct cells and Madin-Darby canine kidney (MDCK) epithelial cells, endogenous PC-2 localized at the plasma membrane and the primary cilium; heterologously-expressed PC-2 exhibited predominant ER localization (45).
|
Background | The TRP ion channel family has seven subfamilies: TRP Canonical (TRPC), TRP Melastatin (TRPM), TRP Ankyrin (TRPA), TRP Mucolipin (TRPML), TRP Polycystin (TRPP), TRP NOPMC (TRPN), and TRP Vanilloid (TRPV) (46;47). These receptor subfamilies respond to several external stimuli such as light (i.e. phototransduction), chemicals, and temperature as well as mechanical and osmotic pressures (48;49). TRP channels have roles in diverse processes including olfaction, nociception, speech, regulation of blood circulation, pain signal transduction, gut motility, mineral absorption, fluid balance, epithelial Ca2+ transport, development of airway and bladder hypersensitivities, and cell survival, growth and death (48). The TRP channels function by facilitating the transmembrane flow of cations (i.e. Na+ and Ca2+) down electrochemical gradients to depolarize the cell as well as to mediate signal transduction (50). TRP channels can be activated through the activation of phospholipase C (PLC) by G protein-coupled receptors and receptor tyrosine kinases.
PC-2 is a calcium-permeable nonselective cation channel that functions at several locations including the primary cilia, basolateral membrane, and the ER to subsequently mediate proliferation, apoptosis, tubulogenesis, and fluid secretion through the regulation of calcium transport and calcium signaling [Figure 3; (3;45)]. PC-2, often together with PC-1, respond to physical or chemical stimuli (e.g., fluid flow) to stimulate calcium influx through PC-2, subsequently resulting in calcium release from intracellular stores (14;24;29). PC-2 is activated by upon EGF stimulation (23). Activation of PLC leads to hydrolysis of PIP2, producing diacylglycerol (DAG) and inositol (1,4,5) triphosphate (IP3). Strong evidence supports roles for PIP2 hydrolysis and DAG production in modulating TRP channel activity. InsP3R and RyR2 are intracellular calcium channels in the ER. RyR2 is a calcium release channel that is essential for calcium-induced calcium release, a prerequisite for excitation-contraction coupling (51). Interactions between PC-2 and InsP3R or RyR2 stimulates PC-2 to function as an intracellular calcium release channel in the ER (26-29). In smooth muscle, PC-2 reduced the activity of store-operated calcium channels (40). Interaction between PC-2 and RyR2 resulted in functional inhibition of RyR2 by PC-2 by stabilizing RyR2 in the closed state and subsequently inhibiting the release of calcium (28). Loss of PC-2-mediated inhibition of RyR2 in PC-2-deficient cardiomyocytes results in a higher frequency of spontaneous calcium oscillations, reduced sarcoplasmic reticulum calcium stores, and reduced calcium transient amplitude compared to wild-type cells (28). In autosomal dominant polycystic kidney disease patients with PKD2 mutations, there is a high rate of idiopathic dilated cardiomyopathy compared to the general population (51). In the embryonic node, ciliary movement generate nodal flow, an external liquid flow that determines left-right (L-R) asymmetric gene expression including Nodal and Cerl-2 (52-56). Increased levels of endodermal cell calcium is proposed to regulate the conversion of nodal flow to asymmetric gene expression (55). PC-2 acts independently of PC-1 to regulate L-R symmetry at the embryonic node (38;57;58). Field et al. propose that Pkd1l1 and PC-2 form a cilia-specific, stress-responsive channel in the node that regulates L-R asymmetry (59). PC-2 physically interacts with Pkd1l1 in the cilium to mediate L-R patterning (59). Mutations in Pkdl1l phenocopy those of Pkd2 mutants in that both develop gross situs abnormalities; Pkd1l1 mutants do not exhibit kidney development defects (59). Pkd2-deficient (Pkd2−/−LacZ+/+) mice exhibit right pulmonary isomerism, randomization of embryonic turning, heart looping, and abdominal situs (38). PC-2 is proposed to act downstream or in parallel to sonic hedgehog (Shh) and upstream of the Nodal cascade. Mutations in human PKD2 have also been linked to left-right asymmetry defects (56). PC-2 functions as a mechanoreceptor in postnatal craniofacial development and growth (44). Conditional knockout of Pkd2 in neural crest-derived cells resulted in craniofacial structural abnormalities (e.g., fractured molar roots, distorted incisors, alveolar bone loss, compressed temporomandibular joints, and skull shape abnormalities) (44). In human syncytiotrophoblast, PC-2 functions as a nonselective cation channel with a high permeability rate to calcium (60). PC-2 (and PC-1) are required for normal placental development in both the trophoblast and fetal vascular compartments (39). Deletion of either Pkd1 or Pkd2 resulted in placental abnormality (i.e., polyhydramnios) and reduced embryonic viability (39). Hepatocyte growth factor (HGF) and EGF stimulate cell proliferation and branching via ERK1/2 in the p42/44 MAPK pathway (61;62). Exogenous expression of PC-2 resulted in decreased HGF-induced branching morphogenesis in kidney epithelial cells, indicating that PC-2 mediates tubule maturation by negatively regulating cell growth (62). Mutations in PKD2 are linked to autosomal dominant polycystic kidney disease 2 (ADPKD2; OMIM: #613095) (1;63-65). Patients with ADPKD2 have renal cysts, liver cysts, and intracranial aneurysm. In addition, patients often have acute and chronic pain as well as nephrolithiasis. ADPKD2 leads to progressive destruction of normal kidney tissue and approximately 50% of patients with ADPKD2 develop end-stage renal disease by 60 years of age. Patients with ADPKD2 exhibit variable phenotypes including differences in the rate of loss of glomerular filtration, the age of onset of end-stage renal disease, occurrence of hypertension, symptomatic extrarenal cysts, and subarachnoid hemorrhage.
|
Putative Mechanism | Pkd2-deficient (Pkd2-/-) mice are embryonic lethal between embryonic day (E) 13.5 and birth (38;66). Mice that express mutant Pkd2 alleles (e.g., Pkd2WS25) as well as Pkd2-/- and Pkd2+/- mice develop polycystic kidney similar to those observed in humans with ADPKD2 (66;67). The Pkd2-/- mice exhibit progressive cyst formation in the nephrons and pancreatic ducts starting at E15.5 as well as defects in cardiac septation (66). Kidney development was normal up to E14.5, while pancreatic development was normal up to E13.5 in the Pkd2-/- mice (66). After E14.5, the pancreatic ducts in the Pkd2-/- mice exhibited progressive cystic dilation. Heterozygous Pkd2 (Pkd2+/-) mice exhibited renal failure and premature death by approximately 65 weeks (66). The phenotype observed in the Nephro mice indicate that PC-2Nephro is defective.
|
Primers |
PCR Primer
Nephro_pcr_F: GGCTCAGTAATATGGTCAGTCC
Nephro_pcr_R: TGCCATCTACATGACTGCAAAC
Sequencing Primer
Nephro_seq_F: TCAGTAATATGGTCAGTCCTCTAATC
Nephro_seq_R: CTATGCAGCAACCTCATCTGG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 448 nucleotides is amplified (chromosome 5, + strand):
1 ggctcagtaa tatggtcagt cctctaatca gtagattaaa aataggcatt ttaaggtaga 61 gtgtctattt cttaactgat gtgataagta taactctttt tgtcttccag ttatctgtag 121 tagctatggt gattaacatt taccgaatgt caaatgcaga ggggctgcta cagtttcttg 181 aagatcaaaa ttctttcccc aactttgagc atgtggcata ctggcaaata cagttcaaca 241 atataagtgc tgtcatggta tttttggtct ggattaaggt aacttatgtc acattcttca 301 tatatagatg cattgatgat gatgatgatg atgatgatga tgatgatgat gatttacaca 361 gatcattgga agacatagat ttgccttttt aggctgattg aaatggccag atgaggttgc 421 tgcatagttt gcagtcatgt agatggca
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Mochizuki, T., Wu, G., Hayashi, T., Xenophontos, S. L., Veldhuisen, B., Saris, J. J., Reynolds, D. M., Cai, Y., Gabow, P. A., Pierides, A., Kimberling, W. J., Breuning, M. H., Deltas, C. C., Peters, D. J., and Somlo, S. (1996) PKD2, a Gene for Polycystic Kidney Disease that Encodes an Integral Membrane Protein. Science. 272, 1339-1342.
3. Zhang, P., Luo, Y., Chasan, B., Gonzalez-Perrett, S., Montalbetti, N., Timpanaro, G. A., Cantero Mdel, R., Ramos, A. J., Goldmann, W. H., Zhou, J., and Cantiello, H. F. (2009) The Multimeric Structure of Polycystin-2 (TRPP2): Structural-Functional Correlates of Homo- and Hetero-Multimers with TRPC1. Hum Mol Genet. 18, 1238-1251.
4. Giamarchi, A., Feng, S., Rodat-Despoix, L., Xu, Y., Bubenshchikova, E., Newby, L. J., Hao, J., Gaudioso, C., Crest, M., Lupas, A. N., Honore, E., Williamson, M. P., Obara, T., Ong, A. C., and Delmas, P. (2010) A Polycystin-2 (TRPP2) Dimerization Domain Essential for the Function of Heteromeric Polycystin Complexes. EMBO J. 29, 1176-1191.
6. Sammels, E., Devogelaere, B., Mekahli, D., Bultynck, G., Missiaen, L., Parys, J. B., Cai, Y., Somlo, S., and De Smedt, H. (2010) Polycystin-2 Activation by Inositol 1,4,5-Trisphosphate-Induced Ca2+ Release Requires its Direct Association with the Inositol 1,4,5-Trisphosphate Receptor in a Signaling Microdomain. J Biol Chem. 285, 18794-18805.
7. Celic, A. S., Petri, E. T., Benbow, J., Hodsdon, M. E., Ehrlich, B. E., and Boggon, T. J. (2012) Calcium-Induced Conformational Changes in C-Terminal Tail of Polycystin-2 are Necessary for Channel Gating. J Biol Chem. 287, 17232-17240.
8. Ferreira, F. M., Oliveira, L. C., Germino, G. G., Onuchic, J. N., and Onuchic, L. F. (2011) Macromolecular Assembly of Polycystin-2 Intracytosolic C-Terminal Domain. Proc Natl Acad Sci U S A. 108, 9833-9838.
9. Petri, E. T., Celic, A., Kennedy, S. D., Ehrlich, B. E., Boggon, T. J., and Hodsdon, M. E. (2010) Structure of the EF-Hand Domain of Polycystin-2 Suggests a Mechanism for Ca2+-Dependent Regulation of Polycystin-2 Channel Activity. Proc Natl Acad Sci U S A. 107, 9176-9181.
10. Celic, A., Petri, E. T., Demeler, B., Ehrlich, B. E., and Boggon, T. J. (2008) Domain Mapping of the Polycystin-2 C-Terminal Tail using De Novo Molecular Modeling and Biophysical Analysis. J Biol Chem. 283, 28305-28312.
11. Tsiokas, L., Kim, E., Arnould, T., Sukhatme, V. P., and Walz, G. (1997) Homo- and Heterodimeric Interactions between the Gene Products of PKD1 and PKD2. Proc Natl Acad Sci U S A. 94, 6965-6970.
12. Qian, F., Germino, F. J., Cai, Y., Zhang, X., Somlo, S., and Germino, G. G. (1997) PKD1 Interacts with PKD2 through a Probable Coiled-Coil Domain. Nat Genet. 16, 179-183.
14. Hanaoka, K., Qian, F., Boletta, A., Bhunia, A. K., Piontek, K., Tsiokas, L., Sukhatme, V. P., Guggino, W. B., and Germino, G. G. (2000) Co-Assembly of Polycystin-1 and -2 Produces Unique Cation-Permeable Currents. Nature. 408, 990-994.
15. Newby, L. J., Streets, A. J., Zhao, Y., Harris, P. C., Ward, C. J., and Ong, A. C. (2002) Identification, Characterization, and Localization of a Novel Kidney Polycystin-1-Polycystin-2 Complex. J Biol Chem. 277, 20763-20773.
16. Li, Q., Montalbetti, N., Shen, P. Y., Dai, X. Q., Cheeseman, C. I., Karpinski, E., Wu, G., Cantiello, H. F., and Chen, X. Z. (2005) Alpha-Actinin Associates with Polycystin-2 and Regulates its Channel Activity. Hum Mol Genet. 14, 1587-1603.
17. Gallagher, A. R., Cedzich, A., Gretz, N., Somlo, S., and Witzgall, R. (2000) The Polycystic Kidney Disease Protein PKD2 Interacts with Hax-1, a Protein Associated with the Actin Cytoskeleton. Proc Natl Acad Sci U S A. 97, 4017-4022.
18. Wang, Q., Dai, X. Q., Li, Q., Wang, Z., Cantero Mdel, R., Li, S., Shen, J., Tu, J. C., Cantiello, H., and Chen, X. Z. (2012) Structural Interaction and Functional Regulation of Polycystin-2 by Filamin. PLoS One. 7, e40448.
19. Li, X., Luo, Y., Starremans, P. G., McNamara, C. A., Pei, Y., and Zhou, J. (2005) Polycystin-1 and Polycystin-2 Regulate the Cell Cycle through the Helix-Loop-Helix Inhibitor Id2. Nat Cell Biol. 7, 1202-1212.
20. Tsiokas, L., Arnould, T., Zhu, C., Kim, E., Walz, G., and Sukhatme, V. P. (1999) Specific Association of the Gene Product of PKD2 with the TRPC1 Channel. Proc Natl Acad Sci U S A. 96, 3934-3939.
21. Zhang, Z. R., Chu, W. F., Song, B., Gooz, M., Zhang, J. N., Yu, C. J., Jiang, S., Baldys, A., Gooz, P., Steele, S., Owsianik, G., Nilius, B., Komlosi, P., and Bell, P. D. (2013) TRPP2 and TRPV4 Form an EGF-Activated Calcium Permeable Channel at the Apical Membrane of Renal Collecting Duct Cells. PLoS One. 8, e73424.
22. Kottgen, M., Buchholz, B., Garcia-Gonzalez, M. A., Kotsis, F., Fu, X., Doerken, M., Boehlke, C., Steffl, D., Tauber, R., Wegierski, T., Nitschke, R., Suzuki, M., Kramer-Zucker, A., Germino, G. G., Watnick, T., Prenen, J., Nilius, B., Kuehn, E. W., and Walz, G. (2008) TRPP2 and TRPV4 Form a Polymodal Sensory Channel Complex. J Cell Biol. 182, 437-447.
23. Ma, R., Li, W. P., Rundle, D., Kong, J., Akbarali, H. I., and Tsiokas, L. (2005) PKD2 Functions as an Epidermal Growth Factor-Activated Plasma Membrane Channel. Mol Cell Biol. 25, 8285-8298.
24. Nauli, S. M., Alenghat, F. J., Luo, Y., Williams, E., Vassilev, P., Li, X., Elia, A. E., Lu, W., Brown, E. M., Quinn, S. J., Ingber, D. E., and Zhou, J. (2003) Polycystins 1 and 2 Mediate Mechanosensation in the Primary Cilium of Kidney Cells. Nat Genet. 33, 129-137.
25. Du, J., Ma, X., Shen, B., Huang, Y., Birnbaumer, L., and Yao, X. (2014) TRPV4, TRPC1, and TRPP2 Assemble to Form a Flow-Sensitive Heteromeric Channel. FASEB J. 28, 4677-4685.
26. Mekahli, D., Sammels, E., Luyten, T., Welkenhuyzen, K., van den Heuvel, L. P., Levtchenko, E. N., Gijsbers, R., Bultynck, G., Parys, J. B., De Smedt, H., and Missiaen, L. (2012) Polycystin-1 and Polycystin-2 are both Required to Amplify Inositol-Trisphosphate-Induced Ca2+ Release. Cell Calcium. 51, 452-458.
27. Li, Y., Wright, J. M., Qian, F., Germino, G. G., and Guggino, W. B. (2005) Polycystin 2 Interacts with Type I Inositol 1,4,5-Trisphosphate Receptor to Modulate Intracellular Ca2+ Signaling. J Biol Chem. 280, 41298-41306.
28. Anyatonwu, G. I., Estrada, M., Tian, X., Somlo, S., and Ehrlich, B. E. (2007) Regulation of Ryanodine Receptor-Dependent Calcium Signaling by Polycystin-2. Proc Natl Acad Sci U S A. 104, 6454-6459.
29. Koulen, P., Cai, Y., Geng, L., Maeda, Y., Nishimura, S., Witzgall, R., Ehrlich, B. E., and Somlo, S. (2002) Polycystin-2 is an Intracellular Calcium Release Channel. Nat Cell Biol. 4, 191-197.
31. Choi, Y. H., Suzuki, A., Hajarnis, S., Ma, Z., Chapin, H. C., Caplan, M. J., Pontoglio, M., Somlo, S., and Igarashi, P. (2011) Polycystin-2 and Phosphodiesterase 4C are Components of a Ciliary A-Kinase Anchoring Protein Complex that is Disrupted in Cystic Kidney Diseases. Proc Natl Acad Sci U S A. 108, 10679-10684.
33. Streets, A. J., Moon, D. J., Kane, M. E., Obara, T., and Ong, A. C. (2006) Identification of an N-Terminal Glycogen Synthase Kinase 3 Phosphorylation Site which Regulates the Functional Localization of Polycystin-2 in Vivo and in Vitro. Hum Mol Genet. 15, 1465-1473.
34. Cai, Y., Anyatonwu, G., Okuhara, D., Lee, K. B., Yu, Z., Onoe, T., Mei, C. L., Qian, Q., Geng, L., Wiztgall, R., Ehrlich, B. E., and Somlo, S. (2004) Calcium Dependence of Polycystin-2 Channel Activity is Modulated by Phosphorylation at Ser812. J Biol Chem. 279, 19987-19995.
35. Kottgen, M., Benzing, T., Simmen, T., Tauber, R., Buchholz, B., Feliciangeli, S., Huber, T. B., Schermer, B., Kramer-Zucker, A., Hopker, K., Simmen, K. C., Tschucke, C. C., Sandford, R., Kim, E., Thomas, G., and Walz, G. (2005) Trafficking of TRPP2 by PACS Proteins Represents a Novel Mechanism of Ion Channel Regulation. EMBO J. 24, 705-716.
36. Hofherr, A., Wagner, C., Fedeles, S., Somlo, S., and Kottgen, M. (2014) N-Glycosylation Determines the Abundance of the Transient Receptor Potential Channel TRPP2. J Biol Chem. 289, 14854-14867.
37. Hackmann, K., Markoff, A., Qian, F., Bogdanova, N., Germino, G. G., Pennekamp, P., Dworniczak, B., Horst, J., and Gerke, V. (2005) A Splice Form of Polycystin-2, Lacking Exon 7, does Not Interact with Polycystin-1. Hum Mol Genet. 14, 3249-3262.
38. Pennekamp, P., Karcher, C., Fischer, A., Schweickert, A., Skryabin, B., Horst, J., Blum, M., and Dworniczak, B. (2002) The Ion Channel Polycystin-2 is Required for Left-Right Axis Determination in Mice. Curr Biol. 12, 938-943.
39. Garcia-Gonzalez, M. A., Outeda, P., Zhou, Q., Zhou, F., Menezes, L. F., Qian, F., Huso, D. L., Germino, G. G., Piontek, K. B., and Watnick, T. (2010) Pkd1 and Pkd2 are Required for Normal Placental Development. PLoS One. 5, 10.1371/journal.pone.0012821.
40. Qian, Q., Hunter, L. W., Li, M., Marin-Padilla, M., Prakash, Y. S., Somlo, S., Harris, P. C., Torres, V. E., and Sieck, G. C. (2003) Pkd2 Haploinsufficiency Alters Intracellular Calcium Regulation in Vascular Smooth Muscle Cells. Hum Mol Genet. 12, 1875-1880.
41. Markowitz, G. S., Cai, Y., Li, L., Wu, G., Ward, L. C., Somlo, S., and D'Agati, V. D. (1999) Polycystin-2 Expression is Developmentally Regulated. Am J Physiol. 277, F17-25.
42. Torres, V. E., Cai, Y., Chen, X., Wu, G. Q., Geng, L., Cleghorn, K. A., Johnson, C. M., and Somlo, S. (2001) Vascular Expression of Polycystin-2. J Am Soc Nephrol. 12, 1-9.
43. Volk, T., Schwoerer, A. P., Thiessen, S., Schultz, J. H., and Ehmke, H. (2003) A Polycystin-2-Like Large Conductance Cation Channel in Rat Left Ventricular Myocytes. Cardiovasc Res. 58, 76-88.
44. Khonsari, R. H., Ohazama, A., Raouf, R., Kawasaki, M., Kawasaki, K., Porntaveetus, T., Ghafoor, S., Hammond, P., Suttie, M., Odri, G. A., Sandford, R. N., Wood, J. N., and Sharpe, P. T. (2013) Multiple Postnatal Craniofacial Anomalies are Characterized by Conditional Loss of Polycystic Kidney Disease 2 (Pkd2). Hum Mol Genet. 22, 1873-1885.
45. Luo, Y., Vassilev, P. M., Li, X., Kawanabe, Y., and Zhou, J. (2003) Native Polycystin 2 Functions as a Plasma Membrane Ca2+-Permeable Cation Channel in Renal Epithelia. Mol Cell Biol. 23, 2600-2607.
49. van de Graaf, S. F., Rescher, U., Hoenderop, J. G., Verkaart, S., Bindels, R. J., and Gerke, V. (2008) TRPV5 is Internalized Via Clathrin-Dependent Endocytosis to Enter a Ca2+-Controlled Recycling Pathway. J Biol Chem. 283, 4077-4086.
51. Paavola, J., Schliffke, S., Rossetti, S., Kuo, I. Y., Yuan, S., Sun, Z., Harris, P. C., Torres, V. E., and Ehrlich, B. E. (2013) Polycystin-2 Mutations Lead to Impaired Calcium Cycling in the Heart and Predispose to Dilated Cardiomyopathy. J Mol Cell Cardiol. 58, 199-208.
52. Nonaka, S., Tanaka, Y., Okada, Y., Takeda, S., Harada, A., Kanai, Y., Kido, M., and Hirokawa, N. (1998) Randomization of Left-Right Asymmetry due to Loss of Nodal Cilia Generating Leftward Flow of Extraembryonic Fluid in Mice Lacking KIF3B Motor Protein. Cell. 95, 829-837.
53. Kawasumi, A., Nakamura, T., Iwai, N., Yashiro, K., Saijoh, Y., Belo, J. A., Shiratori, H., and Hamada, H. (2011) Left-Right Asymmetry in the Level of Active Nodal Protein Produced in the Node is Translated into Left-Right Asymmetry in the Lateral Plate of Mouse Embryos. Dev Biol. 353, 321-330.
54. Lowe, L. A., Supp, D. M., Sampath, K., Yokoyama, T., Wright, C. V., Potter, S. S., Overbeek, P., and Kuehn, M. R. (1996) Conserved Left-Right Asymmetry of Nodal Expression and Alterations in Murine Situs Inversus. Nature. 381, 158-161.
55. Takao, D., Nemoto, T., Abe, T., Kiyonari, H., Kajiura-Kobayashi, H., Shiratori, H., and Nonaka, S. (2013) Asymmetric Distribution of Dynamic Calcium Signals in the Node of Mouse Embryo during Left-Right Axis Formation. Dev Biol. 376, 23-30.
56. Bataille, S., Demoulin, N., Devuyst, O., Audrezet, M. P., Dahan, K., Godin, M., Fontes, M., Pirson, Y., and Burtey, S. (2011) Association of PKD2 (Polycystin 2) Mutations with Left-Right Laterality Defects. Am J Kidney Dis. 58, 456-460.
57. Ermakov, A., Stevens, J. L., Whitehill, E., Robson, J. E., Pieles, G., Brooker, D., Goggolidou, P., Powles-Glover, N., Hacker, T., Young, S. R., Dear, N., Hirst, E., Tymowska-Lalanne, Z., Briscoe, J., Bhattacharya, S., and Norris, D. P. (2009) Mouse Mutagenesis Identifies Novel Roles for Left-Right Patterning Genes in Pulmonary, Craniofacial, Ocular, and Limb Development. Dev Dyn. 238, 581-594.
58. Yoshiba, S., Shiratori, H., Kuo, I. Y., Kawasumi, A., Shinohara, K., Nonaka, S., Asai, Y., Sasaki, G., Belo, J. A., Sasaki, H., Nakai, J., Dworniczak, B., Ehrlich, B. E., Pennekamp, P., and Hamada, H. (2012) Cilia at the Node of Mouse Embryos Sense Fluid Flow for Left-Right Determination Via Pkd2. Science. 338, 226-231.
59. Field, S., Riley, K. L., Grimes, D. T., Hilton, H., Simon, M., Powles-Glover, N., Siggers, P., Bogani, D., Greenfield, A., and Norris, D. P. (2011) Pkd1l1 Establishes Left-Right Asymmetry and Physically Interacts with Pkd2. Development. 138, 1131-1142.
60. Gonzalez-Perrett, S., Kim, K., Ibarra, C., Damiano, A. E., Zotta, E., Batelli, M., Harris, P. C., Reisin, I. L., Arnaout, M. A., and Cantiello, H. F. (2001) Polycystin-2, the Protein Mutated in Autosomal Dominant Polycystic Kidney Disease (ADPKD), is a Ca2+-Permeable Nonselective Cation Channel. Proc Natl Acad Sci U S A. 98, 1182-1187.
61. Karihaloo, A., O'Rourke, D. A., Nickel, C., Spokes, K., and Cantley, L. G. (2001) Differential MAPK Pathways Utilized for HGF- and EGF-Dependent Renal Epithelial Morphogenesis. J Biol Chem. 276, 9166-9173.
62. Grimm, D. H., Karihaloo, A., Cai, Y., Somlo, S., Cantley, L. G., and Caplan, M. J. (2006) Polycystin-2 Regulates Proliferation and Branching Morphogenesis in Kidney Epithelial Cells. J Biol Chem. 281, 137-144.
63. Bergmann, C., Bruchle, N. O., Frank, V., Rehder, H., and Zerres, K. (2008) Perinatal Deaths in a Family with Autosomal Dominant Polycystic Kidney Disease and a PKD2 Mutation. N Engl J Med. 359, 318-319.
64. Koptides, M., Hadjimichael, C., Koupepidou, P., Pierides, A., and Constantinou Deltas, C. (1999) Germinal and Somatic Mutations in the PKD2 Gene of Renal Cysts in Autosomal Dominant Polycystic Kidney Disease. Hum Mol Genet. 8, 509-513.
65. Veldhuisen, B., Saris, J. J., de Haij, S., Hayashi, T., Reynolds, D. M., Mochizuki, T., Elles, R., Fossdal, R., Bogdanova, N., van Dijk, M. A., Coto, E., Ravine, D., Norby, S., Verellen-Dumoulin, C., Breuning, M. H., Somlo, S., and Peters, D. J. (1997) A Spectrum of Mutations in the Second Gene for Autosomal Dominant Polycystic Kidney Disease (PKD2). Am J Hum Genet. 61, 547-555.
66. Wu, G., Markowitz, G. S., Li, L., D'Agati, V. D., Factor, S. M., Geng, L., Tibara, S., Tuchman, J., Cai, Y., Park, J. H., van Adelsberg, J., Hou, H.,Jr, Kucherlapati, R., Edelmann, W., and Somlo, S. (2000) Cardiac Defects and Renal Failure in Mice with Targeted Mutations in Pkd2. Nat Genet. 24, 75-78.
67. Wu, G., D'Agati, V., Cai, Y., Markowitz, G., Park, J. H., Reynolds, D. M., Maeda, Y., Le, T. C., Hou, H.,Jr, Kucherlapati, R., Edelmann, W., and Somlo, S. (1998) Somatic Inactivation of Pkd2 Results in Polycystic Kidney Disease. Cell. 93, 177-188.
|
Science Writers | Anne Murray |
Illustrators | Peter Jurek |
Authors | Lauren Prince, Jamie Russell, and Bruce Beutler |