Phenotypic Mutation 'naughty' (pdf version)
Allele | naughty |
Mutation Type |
splice site
|
Chromosome | 8 |
Coordinate | 76,908,668 bp (GRCm38) |
Base Change | A ⇒ G (forward strand) |
Gene |
Nr3c2
|
Gene Name | nuclear receptor subfamily 3, group C, member 2 |
Synonym(s) | MR, aldosterone receptor, mineralocorticoid receptor, Mlr |
Chromosomal Location |
76,899,442-77,245,012 bp (+)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009] PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_001083906; MGI:99459
|
Mapped | Yes |
Amino Acid Change |
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000034031]
[ENSMUSP00000105537]
[ENSMUSP00000105538]
[ENSMUSP00000105539]
[ENSMUSP00000116008 †]
[ENSMUSP00000122959 †]
[ENSMUSP00000118222]
† probably from a misspliced transcript
|
---|
SMART Domains |
Protein: ENSMUSP00000034031 Gene: ENSMUSG00000031618 AA Change: I133V
Domain | Start | End | E-Value | Type |
low complexity region
|
212 |
222 |
N/A |
INTRINSIC |
low complexity region
|
259 |
277 |
N/A |
INTRINSIC |
low complexity region
|
280 |
300 |
N/A |
INTRINSIC |
low complexity region
|
346 |
354 |
N/A |
INTRINSIC |
low complexity region
|
584 |
598 |
N/A |
INTRINSIC |
ZnF_C4
|
600 |
675 |
1.89e-31 |
SMART |
low complexity region
|
690 |
706 |
N/A |
INTRINSIC |
HOLI
|
771 |
935 |
7.78e-33 |
SMART |
|
Predicted Effect |
probably benign
PolyPhen 2
Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
(Using ENSMUST00000034031)
|
SMART Domains |
Protein: ENSMUSP00000105537 Gene: ENSMUSG00000031618 AA Change: I133V
Domain | Start | End | E-Value | Type |
low complexity region
|
212 |
222 |
N/A |
INTRINSIC |
low complexity region
|
259 |
277 |
N/A |
INTRINSIC |
low complexity region
|
280 |
300 |
N/A |
INTRINSIC |
low complexity region
|
346 |
354 |
N/A |
INTRINSIC |
low complexity region
|
584 |
598 |
N/A |
INTRINSIC |
ZnF_C4
|
600 |
671 |
5.29e-35 |
SMART |
HOLI
|
658 |
818 |
1.1e-23 |
SMART |
|
Predicted Effect |
probably benign
PolyPhen 2
Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
(Using ENSMUST00000109911)
|
SMART Domains |
Protein: ENSMUSP00000105538 Gene: ENSMUSG00000031618 AA Change: I133V
Domain | Start | End | E-Value | Type |
low complexity region
|
212 |
222 |
N/A |
INTRINSIC |
low complexity region
|
259 |
277 |
N/A |
INTRINSIC |
low complexity region
|
280 |
300 |
N/A |
INTRINSIC |
low complexity region
|
346 |
354 |
N/A |
INTRINSIC |
low complexity region
|
584 |
598 |
N/A |
INTRINSIC |
ZnF_C4
|
600 |
671 |
5.29e-35 |
SMART |
low complexity region
|
686 |
702 |
N/A |
INTRINSIC |
HOLI
|
767 |
931 |
7.78e-33 |
SMART |
|
Predicted Effect |
probably benign
PolyPhen 2
Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
(Using ENSMUST00000109912)
|
SMART Domains |
Protein: ENSMUSP00000105539 Gene: ENSMUSG00000031618 AA Change: I133V
Domain | Start | End | E-Value | Type |
low complexity region
|
212 |
222 |
N/A |
INTRINSIC |
low complexity region
|
259 |
277 |
N/A |
INTRINSIC |
low complexity region
|
280 |
300 |
N/A |
INTRINSIC |
low complexity region
|
346 |
354 |
N/A |
INTRINSIC |
low complexity region
|
584 |
598 |
N/A |
INTRINSIC |
ZnF_C4
|
600 |
671 |
5.29e-35 |
SMART |
low complexity region
|
686 |
702 |
N/A |
INTRINSIC |
HOLI
|
767 |
931 |
7.78e-33 |
SMART |
|
Predicted Effect |
probably benign
PolyPhen 2
Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
(Using ENSMUST00000109913)
|
Predicted Effect |
probably null
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000118222 Gene: ENSMUSG00000031618 AA Change: I133V
Domain | Start | End | E-Value | Type |
low complexity region
|
212 |
222 |
N/A |
INTRINSIC |
low complexity region
|
259 |
277 |
N/A |
INTRINSIC |
low complexity region
|
280 |
300 |
N/A |
INTRINSIC |
low complexity region
|
346 |
354 |
N/A |
INTRINSIC |
low complexity region
|
584 |
598 |
N/A |
INTRINSIC |
ZnF_C4
|
600 |
671 |
5.29e-35 |
SMART |
|
Predicted Effect |
probably benign
PolyPhen 2
Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
(Using ENSMUST00000148106)
|
Meta Mutation Damage Score |
0.1058  |
Is this an essential gene? |
Essential (E-score: 1.000)  |
Phenotypic Category |
Phenotype |
Literature verified |
References |
Body Weight - decreased |
|
|
growth/size |
|
|
|
Candidate Explorer Status |
CE: not good candidate; Verification probability: 0.094; ML prob: 0.138; human score: -2
|
---|
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All mutations/alleles(9) : Targeted(9)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00691:Nr3c2
|
APN |
8 |
76909590 |
missense |
possibly damaging |
0.82 |
IGL01019:Nr3c2
|
APN |
8 |
76909214 |
missense |
probably damaging |
0.99 |
IGL01085:Nr3c2
|
APN |
8 |
76908354 |
missense |
probably benign |
0.02 |
IGL01395:Nr3c2
|
APN |
8 |
76908848 |
missense |
possibly damaging |
0.73 |
IGL01505:Nr3c2
|
APN |
8 |
76909187 |
missense |
probably damaging |
1.00 |
IGL01656:Nr3c2
|
APN |
8 |
77187537 |
missense |
probably damaging |
1.00 |
IGL01802:Nr3c2
|
APN |
8 |
76908595 |
nonsense |
probably null |
|
IGL02147:Nr3c2
|
APN |
8 |
76909067 |
missense |
probably damaging |
0.98 |
IGL02502:Nr3c2
|
APN |
8 |
77242514 |
missense |
probably damaging |
1.00 |
IGL02706:Nr3c2
|
APN |
8 |
76908416 |
splice site |
probably null |
|
IGL02945:Nr3c2
|
APN |
8 |
76909659 |
missense |
probably damaging |
1.00 |
IGL03034:Nr3c2
|
APN |
8 |
77187638 |
nonsense |
probably null |
|
IGL03162:Nr3c2
|
APN |
8 |
77217584 |
missense |
probably damaging |
0.99 |
R0141:Nr3c2
|
UTSW |
8 |
76908408 |
missense |
probably damaging |
0.99 |
R0422:Nr3c2
|
UTSW |
8 |
77185967 |
missense |
probably benign |
|
R0458:Nr3c2
|
UTSW |
8 |
76909538 |
missense |
probably damaging |
1.00 |
R0595:Nr3c2
|
UTSW |
8 |
76909604 |
missense |
possibly damaging |
0.93 |
R0615:Nr3c2
|
UTSW |
8 |
77185889 |
missense |
probably benign |
0.05 |
R0964:Nr3c2
|
UTSW |
8 |
76908668 |
splice site |
probably null |
|
R0989:Nr3c2
|
UTSW |
8 |
77187564 |
missense |
probably damaging |
0.97 |
R1532:Nr3c2
|
UTSW |
8 |
76909104 |
missense |
probably damaging |
0.99 |
R1624:Nr3c2
|
UTSW |
8 |
76909944 |
missense |
probably damaging |
1.00 |
R1737:Nr3c2
|
UTSW |
8 |
76908329 |
missense |
probably benign |
0.16 |
R1965:Nr3c2
|
UTSW |
8 |
76909463 |
missense |
probably damaging |
0.99 |
R2011:Nr3c2
|
UTSW |
8 |
76909793 |
missense |
possibly damaging |
0.53 |
R2110:Nr3c2
|
UTSW |
8 |
76908527 |
missense |
possibly damaging |
0.75 |
R2281:Nr3c2
|
UTSW |
8 |
76909907 |
missense |
probably damaging |
0.99 |
R3782:Nr3c2
|
UTSW |
8 |
77085684 |
splice site |
probably null |
|
R3808:Nr3c2
|
UTSW |
8 |
76908714 |
missense |
probably damaging |
1.00 |
R4133:Nr3c2
|
UTSW |
8 |
76909749 |
missense |
probably damaging |
1.00 |
R4433:Nr3c2
|
UTSW |
8 |
77217467 |
missense |
probably damaging |
1.00 |
R4738:Nr3c2
|
UTSW |
8 |
76909307 |
missense |
possibly damaging |
0.94 |
R4770:Nr3c2
|
UTSW |
8 |
76908243 |
splice site |
probably null |
|
R4884:Nr3c2
|
UTSW |
8 |
76908809 |
missense |
possibly damaging |
0.53 |
R5169:Nr3c2
|
UTSW |
8 |
76909037 |
missense |
probably damaging |
1.00 |
R5347:Nr3c2
|
UTSW |
8 |
77210748 |
missense |
possibly damaging |
0.92 |
R5857:Nr3c2
|
UTSW |
8 |
76908867 |
missense |
possibly damaging |
0.53 |
R5878:Nr3c2
|
UTSW |
8 |
76908268 |
critical splice acceptor site |
probably null |
|
R6262:Nr3c2
|
UTSW |
8 |
76908633 |
missense |
possibly damaging |
0.65 |
R6547:Nr3c2
|
UTSW |
8 |
76908809 |
missense |
possibly damaging |
0.53 |
R6820:Nr3c2
|
UTSW |
8 |
77242457 |
missense |
probably damaging |
0.98 |
R7180:Nr3c2
|
UTSW |
8 |
76908963 |
missense |
probably damaging |
0.99 |
R7672:Nr3c2
|
UTSW |
8 |
76909209 |
missense |
probably damaging |
1.00 |
R7741:Nr3c2
|
UTSW |
8 |
77210646 |
missense |
probably damaging |
0.97 |
R7776:Nr3c2
|
UTSW |
8 |
76909545 |
missense |
possibly damaging |
0.77 |
R7800:Nr3c2
|
UTSW |
8 |
76909992 |
missense |
probably damaging |
1.00 |
R8742:Nr3c2
|
UTSW |
8 |
76908581 |
missense |
probably damaging |
0.98 |
R8743:Nr3c2
|
UTSW |
8 |
76909758 |
missense |
probably damaging |
1.00 |
Z1088:Nr3c2
|
UTSW |
8 |
76908632 |
missense |
possibly damaging |
0.48 |
Z1176:Nr3c2
|
UTSW |
8 |
76909700 |
missense |
probably damaging |
0.97 |
|
Mode of Inheritance |
Autosomal Recessive |
Local Stock | Live Mice, Sperm, gDNA |
MMRRC Submission |
038231-MU
|
Last Updated |
2019-09-04 9:47 PM
by Bruce Beutler
|
Record Created |
2014-11-11 3:53 PM
by Jeff SoRelle
|
Record Posted |
2016-04-27 |
Phenotypic Description |
The naughty phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0964, some of which exhibited reduced body weights compared to wild-type controls (Figure 1).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 55 mutations. The body weight phenotype was linked to a mutation in Nr2c3: an A to G transition at base pair 76,908,668 (v38) on chromosome 8, or base pair 9,408 in the GenBank genomic region NC_000074 encoding Nr2c3. Three genes on chromosome 8 (Nr3c2, Lphn1, and Trmt1) exhibited linkage with a recessive model of inheritance (P = 6.956 x 10-5), wherein 4 variant homozygotes departed phenotypically from 9 homozygous reference mice and 17 heterozygous mice (Figure 2). The mutation in Nr2c3 was presumed to be causative because the naughty phenotype mimics that of a null allele of Nr3c2 [Nr3c2tm1Gsc; MGI:2441654; (1)].
The mutation corresponds to residue 432 in the NM_001083906 mRNA sequence in exon 2 of 9 total exons.
417 CTGAGCCCGGCAAAGATTTATCAAAACATGGAG
128 -L--S--P--A--K--I--Y--Q--N--M--E-
|
The mutated nucleotide is indicated in red. The mutation results in an isoleucine (I) to valine (V) substitution at position 133 (I133V) in the encoded protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.054) (2).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Nr3c2 (nuclear receptor subfamily 3, group C, member 2) encodes the mineralocorticoid receptor (MR; alternatively, aldosterone receptor), a member of the nuclear receptor superfamily that also includes the androgen receptor, progesterone receptor, and the glucocorticoid receptor (GR) (3). The MR responds to two ligands: the mineralocorticoid aldosterone and the glucocorticoid cortisol (alternatively, corticosterone in rodents); progesterone is a MR antagonist, and may also be a physiological ligand. In epithelial tissues (e.g., nephron, colon, trachea, inner ear, and salivary glands), MR is associated with the 11β-hydroxysteroid dehydrogenase 2 (11β-HSD2), which allows the selectivity of MR binding to aldosterone by converting glucocorticoids to their inactive form (i.e., cortisol into cortisone, or corticosterone into 11-dehydrocotricosterone in rodents). In non-ephithelial tissues (e.g., myocytes, adipocytes, leukocytes, or keratinocytes), 11β-HSD2 is not expressed, indicating that glucocorticoids are the principal ligand of MR.
The MR shares similar domain organization with the other nuclear receptors, including an unstructured N-terminal domain (NTD; amino acids 1-602), a highly conserved central DNA-binding domain (DBD; amino acids 603-666), and a C-terminal ligand-binding domain (LBD; amino acids 727-978). A hinge domain (amino acids 667-726) of unknown function connects the DBD to the LBD. Residues 711-733 within the hinge domain in human MR are essential for binding of Hsp90 and to maintain the receptor in its ligand-binding competent state [Figure 3; (4)].
The NTD has an activation function region (designated AF-1) that can be subdivided into AF1a (amino acids 1-167) and AF1b (amino acids 445-602). The AF-1a and AF-1b regions regulate the interaction of MR with the transcriptional apparatus by coordinating with coactivators and corepressors at glucocorticoid response element (GRE) sites on target DNA (5). The LBD has an activation function region, AF-2, which mediates binding to co-regulatory molecules that contain a L-x-x-L-L motif (where L is leucine and x is any other amino acid) (6-8). The AF-2 is formed by four α-helices 3, 4, 5 and 12 as well as the four β-strands that comprise the LBD [Figure 4; PDB:2AA2; (9-11)]. Upon binding of a ligand, helix 12 closes over the ligand pocket and helices 3, 5, and 11 bend to form a hydrophobic cleft on the surface of the LBD. The loop between helices 11 and 12 are essential for folding the receptor into a ligand binding-competent state as well as to stabilize the active receptor conformation (12). Several residues within the LBD are essential for the stabilization of the ligand once it associates with the MR. Gln776 and Arg817 form hydrogen bonds with the A-ring ketone of aldosterone to stabilize the steroid. There is also a hydrogen bond between Gln776 and Ser810 (9). Asn770 forms a hydrogen bond with the C-18 hydroxyl (9). Thr945 forms a hydrogen bond between the aldosterone C-21 hydroxyl and the C-20 ketone (9). Amino acids 820-844 confer ligand specificity; changes in the confirmation of this region conferred differences in affinity due to interactions with the Hsp-90 complex (13). Upon aldosterone binding to the MR, the hinge domain interacts with the LBD; cortisol also induces an interaction between the two domains, albeit a much weaker interaction than that with aldosterone (14).
Within the DBD of the MR are two nuclear receptor C4-type zinc fingers (amino acids 603-623 and 637-661). The first zinc finger mediates tight binding to the minor groove of the DNA, while the second zinc finger regulates receptor dimerization. The crystal structure of the human MR DBD in complex with a GRE DNA fragment (MR-GRE) has been solved [PDB:4TNT; (15)]. The MR-GRE structure contained a DBD dimer bound to the GRE through interactions at two DNA half sites. The nitrogen of Lys624 forms a hydrogen bond with the N7 position of guanine 3. On the opposite DNA strand, Val25 forms van der Waals contacts with C7 of thymine 13, and Arg629 has two interactions with guanine 12 at the O6 and N7 positions.
Three nuclear localization signals, NLS0 (amino acids 590-602), NLS1 within the C-terminal region of the DBD, and NLS2 within the LBD drive the nuclear translocation of the MR upon ligand binding (16;17). A nuclear export signal is present between the two zinc fingers of the DBD in the proximity of the NLS1 (18).
Two splice variants of human NR3C2 (α and β) have been described (19-21). The first two exons (1α and 1β) consist of different 5′-untranslated sequences, whereas the other 8 exons encode the translated protein. Alternative transcription of the two 5′-untranslated exons generates different mRNA isoforms (21). The two mRNAs encode identical proteins, but the differences in the 5’-UTR may differentially regulate the expression of the individual transcripts. Another alternative splice variant exhibits loss of exon 5 and 6 (22). A splice variant identified in rat and human has a 12-base pair insertion resulting in coding of four amino acids within the DBD (23). The function of the alternative isoform has not been assessed.
The naughty mutation results in an isoleucine (I) to valine (V) substitution at position 133 (I133V) in the AF-1a region of the N-terminal domain.
MR Regulation
MR can be regulated at several levels including the amount of ligand available, interacting proteins in the cytoplasm and in the nucleus, the shuttling from the cytoplasm to the nucleus, cross-talk with other signaling pathways, and post-translational modifications [reviewed in (24)].
Steroid receptors associate with several proteins in the cytoplasm including chaperone proteins (e.g., Hsp90, Hsp40, Hsp60, Hsp70) and Hsp90 co-chaperone proteins [e.g., the immunophilins FKBP51 and FKBP52 as well as protein phosphatase 5 (pp5)] that maintain the receptors in an inactive form (13;25;25-27). The Hsp90 co-chaperone proteins regulate the affinity of the steroid receptors for their ligands. Upon ligand binding, MR dissociates from the protein complex and translocates to the nucleus.
The MR has several phosphorylation sites that are targets of ERK1/2 (Ser196, Ser227, Ser238, Ser263, Ser287, Ser361), cyclin-dependent kinase 5 (CDK5; Ser128, Thr159, Ser250), PKA (Ser601), or casein kinase-1 (Ser601), and unidentified kinases (Ser8, Ser129, Ser183, Ser255, Ser259, Ser262, Ser274, Ser283, Ser299, Ser311, Ser424, Ser543, Ser703, Thr735, Ser737, Ser843) (28). The MR is phosphorylated rapidly after aldosterone stimulation by protein kinase Cα (PKCα); the precise locations of PKCα-induced phosphorylation are unknown (16;29). ERK1/2-mediated MR phosphorylation regulates stability. Loss of ERK1/2-assocated phosphorylation resulted in reduced aldosterone-induced proteasomal degradation of the MR (30). Phosphorylation of the CDK5 target sites interfere with MR transcriptional activity without affecting receptor nuclear accumulation (31). Phosphorylation of Ser843 inactivates the MR by preventing ligand binding (32).
The ubiquitin ligase CHIP interacts with the cytosolic non-activated MR upon changes in Hsp90 activity, subsequently reducing the expression level of the MR (33). Aldosterone stimulation of the MR induces polyubiquitination of the MR and targeting of the MR to the ubiquitin proteasome system (34). Under basal conditions, the MR is monoubiquitinated, which is proposed to stabilize the MR (30). Aldosterone-induced ERK1/2-associated MR phosphorylation removes the monoubiquitination and leads to receptor destabilization. In the presence of ligand, the MR is SUMOylated by the SUMO E3 ligase PIAS1 (protein inhibitor of activated signal transducer 1) (24). MR is acetylated within the KxKK motif in the NLS1. Acetylation inhibits the transcriptional activity of MR by preventing the recruitment of RNA polymerase II to target gene promoters (35). Oxidation of MR prevents aldosterone binding (36).
|
Expression/Localization | The MR is expressed in epithelia of the distal convoluted tubules and cortical collecting ducts of the kidney (37), distal colon (38), airway epithelia of the lung (39), hippocampus (40), hypothalamus, heart (41), smooth muscle (42), eyes (43), adipocytes (44), salivary glands, sweat glands (45), uterus, testis (46), placenta (47), pancreas (48), keratinocytes (49), leukocytes, and macrophages (50;51)) [reviewed in (52)]. Inactive MR is localized in the cytosol, while active MR translocates to the nucleus.
MR expression is developmentally regulated in several tissues, including the brain, kidney, lung, and heart (53). In the mouse, Nr3c2 expression increases after birth in the pituitary, and then stabilizes up to adulthood. In the heart, MR expression is reduced from day 80 of gestation to the postnatal stage in the left but not right ventricle (54). Expression of the α and β isoforms are differentially regulated during brain development (55). Expression of the α isoform is stable during development, while expression of the β isoform is expressed during the first two weeks of life.
|
Background |
The mineralocorticoids (e.g., aldosterone) and glucocorticoid are hormones secreted by the cortex of the adrenal glands; mineralocorticoids are secreted from the zona glomerulosa, while the glucocorticoids are secreted from the zona fasciculata. Mineralocorticoids mediate electrolyte and fluid homeostasis, while glucocorticoids mediate immediate energy requirements and reduce inflammatory responses during a stress response as well as regulate bone, carbohydrate, and lipid metabolism (Figure 5) (56).
Upon ligand binding and receptor translocation to the nucleus, the MR dimerizes, and binds GREs on target genes. The DNA-bound MR recruits coregulatory complexes (e.g., members of the large steroid receptor coactivator family (SRC), PBP/TRAP220, small ubiquitin-related modifier-1 (SUMO-1), ubiquitin9, steroid receptor coactivator-1 (SRC-1), and CREB-binding protein (CBP) as coactivators, and NCoR and SMRT as corepressors), which link the receptor to the transcriptional apparatus, subsequently leading to either activation or repression of target gene expression (57). MR target genes include those that function in water-electrolyte homeostasis, blood pressure regulation, inflammation, oxidative stress, and fibrosis (58). A brief list of known MR target genes are outlined in Table 1. The MR also has functions in the regulation of signaling pathways including the epidermal growth factor (EGF)/EGFR and Ang II/type 1 Ang II receptor (AT1R) pathways (58). The activated MR regulates signaling pathways at the cell membrane to modulate the response of second messenger signaling pathways.
Table 1. Select target genes of the MR [adapted from (59)]
|
Target gene
|
Tissues
|
Brief Description of Function
|
References
|
Epithelial target genes
|
ENaC subunits
|
Kidney, inner ear, colon
|
Na+ transport
|
(60)
|
Na+/K+-ATPase pump
|
Kidney, colon
|
Na+ transport
|
(61)
|
CHIF (channel-inducing factor)
|
Kidney, colon
|
Na+ transport
|
(62)
|
K-ras2
|
Colon
|
Unknown
|
(63)
|
ELL (eleven-nineteen lysine-rich leukemia)
|
Kidney
|
Elongation factor
|
(64)
|
SGK1
|
Kidney, colon
|
Na+ transport; Nedd-4-2 phosphorylation; ENaC trafficking
|
(65)
|
GILZ (glucocorticoid-induced leucine zipper protein)
|
Kidney
|
Na+ transport; inhibition of the ERK signaling cascade
|
(66)
|
Usp2-45
|
Kidney, colon
|
ENaC deubiquitylation
|
(67)
|
KS-WNK1 (With No lysine K)
|
Kidney
|
Na+ transport
|
(68)
|
NDRG2 (N-Myc downstream regulated gene 2)
|
Kidney, colon
|
Putative ENaC activation
|
(69)
|
ET-1 (endothelin-1)
|
Kidney, colon
|
Vasoconstriction
|
(70)
|
PAI-1 (plasminogen activator inhibitor-1)
|
Kidney
|
Inhibition of glomerulosclerosis
|
(71)
|
Non-epithelial target genes
|
Osteopontin
|
Aortic endothelium
|
Initiation of inflammation and fibrosis
|
(72)
|
ACE (angiotensin converting enzyme)
|
Aortic endothelium
|
Endothelial dysfunction; vascular injury
|
(73)
|
MDM2
|
Smooth muscle
|
Cell proliferation
|
(74)
|
EGFR
|
Smooth muscle
|
Increase in fibronectin abundance
|
(75)
|
Collagen I, III, IV
|
Cardiac fibroblasts, renal fibroblasts
|
Progression of myocardial and/or tubulinterstitial fibrosis
|
(76)
|
TNX, ADAMTS1, PAI-1, Orm-1, RGS2, adrenodullin
|
Heart
|
Cardiac remodeling; regulation of blood pressure
|
(77)
|
G6PD
|
Coronary artery endothelium
|
Impairment of vascular reactivity
|
(78)
|
UPAR; HAS2
|
Heart
|
Cardiac remodeling; regulation of blood pressure
|
(77)
|
UCP1, UCP3
|
Brown adipocytes
|
Thermogenesis
|
(79)
|
The function of the MR in epithelial tissues is mainly to regulate ion transport and water resorption, while in non-epithelial tissues, MR signaling induces a tissue-specific response (e.g., adipocyte differentiation (44), regulation of membrane excitability in neurons and muscle cells, blood pressure regulation (80;81), epidermal regulation (49)), and neuronal responses needed for learning, memory, and responses to stress [reviewed in (56)]. Several functions of the MR are discussed in more detail, below.
Epithelial sodium transport
Upon recognition of aldosterone, the MR regulates epithelial sodium transport in the distal nephron and the distal colon to maintain sodium homeostasis (82). Aldosterone increases apical membrane sodium permeability through MR-associated changes in transcription and activity of the epithelial sodium channel (ENaC) and the Na+/K+-ATPase pump. Nr3c2AQP2-Cre mice have MR inactivation solely in renal cells. The Nr3c2AQP2-Cre mice have normal renal sodium excretion on a standard diet, but on a low-sodium diet, the mice quickly lose sodium (83;84). Nr3c2-deficient (Nr3c2-/-) mice die around postnatal day (P) 10 due to extreme salt and water loss (1). Prior to death, newborn mice exhibit weight loss. The mice exhibit hyperkalemia and hyponatremia at P8, which corresponds to the end of renal maturation. Newborn mice can be rescued by sodium chloride (NaCl) injections followed by oral supplementation after weaning (85).
The HPA axis
With the exception of hypothalamic sites in the regulation of salt-appetite (86), the MR is activated by glucocorticoid rather than aldosterone in the central nervous system. In the hippocampus, the MR regulates the hypothalamic-pituitary-adrenocortical (HPA) axis (87). The HPA axis controls reactions to stress and regulates several physiological processes including digestion, the immune system, emotions, and energy storage and expenditure. In the hippocampus, the MR functions in cell excitability and long-term potentiation, which are factors essential for learning ability and memory (82;88). Conditional knockout of Nr3c2 in the forebrain results in impaired spatial learning and reduced working memory as well as the emergence of behavioral stereotypes (e.g., emotional arousal and anxiety-related disorders) (89-92). The mice also exhibited deficits in stimulus-response tasks compared to wild-type mice (92). In contrast, targeted Nr3c2 overexpression in the forebrain reduced anxiety-like behavior (93).
Vascular remodeling
During vascular remodeling, aldosterone binds to endothelial MR to regulate the expression of several genes including intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and glucose-6-phosphate dehydrogenase (G6PD). In addition, the MR may transactivate the EGFR, subsequently initiating a signaling cascade that includes non-receptor tyrosine kinase c-Src and/or phosphoinositide 3-kinase (PI3K). The c-Src activates NADPH oxidases through Rac1 and may also activate protein phosphatase 2A (PP2A). PP2A can reduce the expression of endothelial nitric oxide synthase (eNOS; alternatively NOS3; see the record for paul) and the production of nitric oxide. In endothelial cells, the MR can ultimately lead to inflammation, oxidative stress, endothelial cell dysfunction, and subsequent vascular remodeling [reviewed in (94)]. Cardiomyocyte-specific deletion of Nr2c3 did not display aberrant cardiac morphology and function; however, the mice exhibited improved infarct healing and prevention of adverse cardiac remodeling, contractile dysfunctions observed in ischemic heart failure (95). Transgenic mice overexpressing human NR3C2 in aldosterone target tissues (e.g., distal nephron, brain, and heart) exhibited enlarged kidneys, renal tubular dilation, normal blood pressure, and progressive mild dilated cardiomyopathy and arrhythmia (96). Targeted overexpression of Nr3c2 in the heart resulted in life-threatening arrhythmias (97).
Cardiac inflammation
Activation of the MR results in the infiltration of inflammatory cells (e.g., monocytes, macrophages, and lymphocytes) in the vasculature. Infiltration of inflammatory cells is a key feature of cardiac inflammation (98). Infiltrating macrophages function in the prolonged inflammatory response in the myocardium through the secretion of cytokines that stimulate fibroblast differentiation and collagen production. In addition, MR activation results in increased activity and expression of NADPH oxidases, the production of reactive oxygen species, and mitochondrial electron transport uncoupling. Macrophage/monocyte-specific deletion of Nr3c2 expression results in protection against salt-induced cardiac fibrosis and increased blood pressure (81).
Human conditions associated with the MR
Mutations in NR3C2 are linked to autosomal dominant early-onset hypertension (OMIM: #605115) (99) and autosomal dominant pseudohypoaldosteronism type I (PHA1; OMIM: #177735) (100;101). PHA1 is caused by mineralocorticoid resistance. Patients with PHA1 have increased risk of stroke and myocardial infarction. Patients with PHA1 often exhibit overt dehydration and hyponatremia (i.e., low sodium concentration in the blood) due to systemic salt loss and hyperkalemia (i.e., high potassium levels in the blood). In addition, patients with PHA1 often have insufficient weight gain due to chronic dehydration. Overactive MR signaling is also associated with renal and cardiac injuries (102), cerebral aneurysm (103), chorioretinopathy (104), and epidemis abnormalities (105).
|
Putative Mechanism |
The MR functions in both brown and white adipocytes to mediate corticosteroid-induced adipogenesis (Figure 6) (44;106). During adipocyte differentiation, the gene expression changes determine the phenotype of mature adipocytes. Aldosterone promotes adipogenesis by inhibiting the expression and function of uncoupling protein-1 (UCP-1), a mitochondrial protein that functions in thermogenesis and energy expenditure regulation (107). MR signaling in brown adipose tissue promotes lipid storage at the expense of heat production. In white adipose tissue, MR expression is induced during adipose conversion (108). Both mineralocorticoids and glucocorticoids induce adipose differentiation in 3T3-L1 cells (44).
In contrast to Nr3c2-deficient mice, the naughty mice survive until adulthood, indicating that MRnaughty retains some function. However, the function of MRnaughty in adipogenesis appears to be reduced. The other functions of MR have not been examined in the naughty mice.
|
Primers |
PCR Primer
naughty_pcr_F: ACAATAGTCGGTCTGGGATTTTGCC
naughty_pcr_R: TGCACTGGGAAACTGCCAAAGC
Sequencing Primer
naughty_seq_F: GCCATCAGATATTAAAACTGAGCTG
naughty_seq_R: ACATGGAGTTGATGCCCG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 448 nucleotides is amplified (chromosome 8, + strand):
1 acaatagtcg gtctgggatt ttgccatcag atattaaaac tgagctggaa tccaaggaac 61 tttcagccac ggtggctgag tccatgggtt tatacatgga ttctgtgaga gatgccgagt 121 acacttatga tcagcaaaac caacaaggaa gcctgagccc ggcaaagatt tatcaaaaca 181 tggagcagct ggtgaagttt tacaaagaga atggtcacag gtcctccaca ctgagtgcta 241 taagcaggcc tttgaggtca ttcatgcctg actctgggac ctccatgaat ggtggggcct 301 tgcgtgccat cgttaagagc ccaatcatct gtcatgagaa gagcccctct gtttgcagcc 361 cgctcaacat gccgtcttca gtatgcagcc ccgcgggcat caactccatg tcctcctcca 421 cagctagctt tggcagtttc ccagtgca
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Berger, S., Bleich, M., Schmid, W., Cole, T. J., Peters, J., Watanabe, H., Kriz, W., Warth, R., Greger, R., and Schutz, G. (1998) Mineralocorticoid Receptor Knockout Mice: Pathophysiology of Na+ Metabolism. Proc Natl Acad Sci U S A. 95, 9424-9429.
2. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.
3. Arriza, J. L., Weinberger, C., Cerelli, G., Glaser, T. M., Handelin, B. L., Housman, D. E., and Evans, R. M. (1987) Cloning of Human Mineralocorticoid Receptor Complementary DNA: Structural and Functional Kinship with the Glucocorticoid Receptor. Science. 237, 268-275.
4. Couette, B., Jalaguier, S., Hellal-Levy, C., Lupo, B., Fagart, J., Auzou, G., and Rafestin-Oblin, M. E. (1998) Folding Requirements of the Ligand-Binding Domain of the Human Mineralocorticoid Receptor. Mol Endocrinol. 12, 855-863.
7. Nolte, R. T., Wisely, G. B., Westin, S., Cobb, J. E., Lambert, M. H., Kurokawa, R., Rosenfeld, M. G., Willson, T. M., Glass, C. K., and Milburn, M. V. (1998) Ligand Binding and Co-Activator Assembly of the Peroxisome Proliferator-Activated Receptor-Gamma. Nature. 395, 137-143.
8. Kauppi, B., Jakob, C., Farnegardh, M., Yang, J., Ahola, H., Alarcon, M., Calles, K., Engstrom, O., Harlan, J., Muchmore, S., Ramqvist, A. K., Thorell, S., Ohman, L., Greer, J., Gustafsson, J. A., Carlstedt-Duke, J., and Carlquist, M. (2003) The Three-Dimensional Structures of Antagonistic and Agonistic Forms of the Glucocorticoid Receptor Ligand-Binding Domain: RU-486 Induces a Transconformation that Leads to Active Antagonism. J Biol Chem. 278, 22748-22754.
9. Bledsoe, R. K., Madauss, K. P., Holt, J. A., Apolito, C. J., Lambert, M. H., Pearce, K. H., Stanley, T. B., Stewart, E. L., Trump, R. P., Willson, T. M., and Williams, S. P. (2005) A Ligand-Mediated Hydrogen Bond Network Required for the Activation of the Mineralocorticoid Receptor. J Biol Chem. 280, 31283-31293.
10. Fagart, J., Huyet, J., Pinon, G. M., Rochel, M., Mayer, C., and Rafestin-Oblin, M. E. (2005) Crystal Structure of a Mutant Mineralocorticoid Receptor Responsible for Hypertension. Nat Struct Mol Biol. 12, 554-555.
12. Hellal-Levy, C., Fagart, J., Souque, A., Wurtz, J. M., Moras, D., and Rafestin-Oblin, M. E. (2000) Crucial Role of the H11-H12 Loop in Stabilizing the Active Conformation of the Human Mineralocorticoid Receptor. Mol Endocrinol. 14, 1210-1221.
13. Bruner, K. L., Derfoul, A., Robertson, N. M., Guerriero, G., Fernandes-Alnemri, T., Alnemri, E. S., and Litwack, G. (1997) The Unliganded Mineralocorticoid Receptor is Associated with Heat Shock Proteins 70 and 90 and the Immunophilin FKBP-52. Recept Signal Transduct. 7, 85-98.
16. Walther, R. F., Atlas, E., Carrigan, A., Rouleau, Y., Edgecombe, A., Visentin, L., Lamprecht, C., Addicks, G. C., Hache, R. J., and Lefebvre, Y. A. (2005) A serine/threonine-Rich Motif is One of Three Nuclear Localization Signals that Determine Unidirectional Transport of the Mineralocorticoid Receptor to the Nucleus. J Biol Chem. 280, 17549-17561.
20. Kwak, S. P., Patel, P. D., Thompson, R. C., Akil, H., and Watson, S. J. (1993) 5'-Heterogeneity of the Mineralocorticoid Receptor Messenger Ribonucleic Acid: Differential Expression and Regulation of Splice Variants within the Rat Hippocampus. Endocrinology. 133, 2344-2350.
21. Zennaro, M. C., Keightley, M. C., Kotelevtsev, Y., Conway, G. S., Soubrier, F., and Fuller, P. J. (1995) Human Mineralocorticoid Receptor Genomic Structure and Identification of Expressed Isoforms. J Biol Chem. 270, 21016-21020.
22. Zennaro, M. C., Souque, A., Viengchareun, S., Poisson, E., and Lombes, M. (2001) A New Human MR Splice Variant is a Ligand-Independent Transactivator Modulating Corticosteroid Action. Mol Endocrinol. 15, 1586-1598.
26. Couette, B., Fagart, J., Jalaguier, S., Lombes, M., Souque, A., and Rafestin-Oblin, M. E. (1996) Ligand-Induced Conformational Change in the Human Mineralocorticoid Receptor Occurs within its Hetero-Oligomeric Structure. Biochem J. 315 ( Pt 2), 421-427.
28. Olsen, J. V., Blagoev, B., Gnad, F., Macek, B., Kumar, C., Mortensen, P., and Mann, M. (2006) Global, in Vivo, and Site-Specific Phosphorylation Dynamics in Signaling Networks. Cell. 127, 635-648.
29. Hirschberg, D., Jagerbrink, T., Samskog, J., Gustafsson, M., Stahlberg, M., Alvelius, G., Husman, B., Carlquist, M., Jornvall, H., and Bergman, T. (2004) Detection of Phosphorylated Peptides in Proteomic Analyses using Microfluidic Compact Disk Technology. Anal Chem. 76, 5864-5871.
30. Kino, T., Jaffe, H., Amin, N. D., Chakrabarti, M., Zheng, Y. L., Chrousos, G. P., and Pant, H. C. (2010) Cyclin-Dependent Kinase 5 Modulates the Transcriptional Activity of the Mineralocorticoid Receptor and Regulates Expression of Brain-Derived Neurotrophic Factor. Mol Endocrinol. 24, 941-952.
32. Shibata, S., Rinehart, J., Zhang, J., Moeckel, G., Castaneda-Bueno, M., Stiegler, A. L., Boggon, T. J., Gamba, G., and Lifton, R. P. (2013) Mineralocorticoid Receptor Phosphorylation Regulates Ligand Binding and Renal Response to Volume Depletion and Hyperkalemia. Cell Metab. 18, 660-671.
33. Faresse, N., Ruffieux-Daidie, D., Salamin, M., Gomez-Sanchez, C. E., and Staub, O. (2010) Mineralocorticoid Receptor Degradation is Promoted by Hsp90 Inhibition and the Ubiquitin-Protein Ligase CHIP. Am J Physiol Renal Physiol. 299, F1462-72.
34. Yokota, K., Shibata, H., Kobayashi, S., Suda, N., Murai, A., Kurihara, I., Saito, I., and Saruta, T. (2004) Proteasome-Mediated Mineralocorticoid Receptor Degradation Attenuates Transcriptional Response to Aldosterone. Endocr Res. 30, 611-616.
35. Lee, H. A., Lee, D. Y., Cho, H. M., Kim, S. Y., Iwasaki, Y., and Kim, I. K. (2013) Histone Deacetylase Inhibition Attenuates Transcriptional Activity of Mineralocorticoid Receptor through its Acetylation and Prevents Development of Hypertension. Circ Res. 112, 1004-1012.
37. Krozowski, Z. S., Rundle, S. E., Wallace, C., Castell, M. J., Shen, J. H., Dowling, J., Funder, J. W., and Smith, A. I. (1989) Immunolocalization of Renal Mineralocorticoid Receptors with an Antiserum Against a Peptide Deduced from the Complementary Deoxyribonucleic Acid Sequence. Endocrinology. 125, 192-198.
43. Mirshahi, M., Mirshahi, A., Sedighian, R., Hecquet, C., Faure, J. P., and Agarwal, M. K. (1997) Immunochemical Demonstration of the Mineralocorticoid Receptor in Ocular Tissues. Neuroendocrinology. 65, 70-78.
44. Caprio, M., Feve, B., Claes, A., Viengchareun, S., Lombes, M., and Zennaro, M. C. (2007) Pivotal Role of the Mineralocorticoid Receptor in Corticosteroid-Induced Adipogenesis. FASEB J. 21, 2185-2194.
45. Kenouch, S., Lombes, M., Delahaye, F., Eugene, E., Bonvalet, J. P., and Farman, N. (1994) Human Skin as Target for Aldosterone: Coexpression of Mineralocorticoid Receptors and 11 Beta-Hydroxysteroid Dehydrogenase. J Clin Endocrinol Metab. 79, 1334-1341.
46. Le Menuet, D., Viengchareun, S., Penfornis, P., Walker, F., Zennaro, M. C., and Lombes, M. (2000) Targeted Oncogenesis Reveals a Distinct Tissue-Specific Utilization of Alternative Promoters of the Human Mineralocorticoid Receptor Gene in Transgenic Mice. J Biol Chem. 275, 7878-7886.
47. Hirasawa, G., Takeyama, J., Sasano, H., Fukushima, K., Suzuki, T., Muramatu, Y., Darnel, A. D., Kaneko, C., Hiwatashi, N., Toyota, T., Nagura, H., and Krozowski, Z. S. (2000) 11Beta-Hydroxysteroid Dehydrogenase Type II and Mineralocorticoid Receptor in Human Placenta. J Clin Endocrinol Metab. 85, 1306-1309.
48. Chuang, J. C., Cha, J. Y., Garmey, J. C., Mirmira, R. G., and Repa, J. J. (2008) Research Resource: Nuclear Hormone Receptor Expression in the Endocrine Pancreas. Mol Endocrinol. 22, 2353-2363.
49. Sainte Marie, Y., Toulon, A., Paus, R., Maubec, E., Cherfa, A., Grossin, M., Descamps, V., Clemessy, M., Gasc, J. M., Peuchmaur, M., Glick, A., Farman, N., and Jaisser, F. (2007) Targeted Skin Overexpression of the Mineralocorticoid Receptor in Mice Causes Epidermal Atrophy, Premature Skin Barrier Formation, Eye Abnormalities, and Alopecia. Am J Pathol. 171, 846-860.
53. Brown, R. W., Diaz, R., Robson, A. C., Kotelevtsev, Y. V., Mullins, J. J., Kaufman, M. H., and Seckl, J. R. (1996) The Ontogeny of 11 Beta-Hydroxysteroid Dehydrogenase Type 2 and Mineralocorticoid Receptor Gene Expression Reveal Intricate Control of Glucocorticoid Action in Development. Endocrinology. 137, 794-797.
55. Vazquez, D. M., Lopez, J. F., Morano, M. I., Kwak, S. P., Watson, S. J., and Akil, H. (1998) Alpha, Beta, and Gamma Mineralocorticoid Receptor Messenger Ribonucleic Acid Splice Variants: Differential Expression and Rapid Regulation in the Developing Hippocampus. Endocrinology. 139, 3165-3177.
58. Lastra, G., Dhuper, S., Johnson, M. S., and Sowers, J. R. (2010) Salt, Aldosterone, and Insulin Resistance: Impact on the Cardiovascular System. Nat Rev Cardiol. 7, 577-584.
59. Viengchareun, S., Le Menuet, D., Martinerie, L., Munier, M., Pascual-Le Tallec, L., and Lombes, M. (2007) The Mineralocorticoid Receptor: Insights into its Molecular and (Patho)Physiological Biology. Nucl Recept Signal. 5, e012.
60. Epple, H. J., Amasheh, S., Mankertz, J., Goltz, M., Schulzke, J. D., and Fromm, M. (2000) Early Aldosterone Effect in Distal Colon by Transcriptional Regulation of ENaC Subunits. Am J Physiol Gastrointest Liver Physiol. 278, G718-24.
64. Pascual-Le Tallec, L., Simone, F., Viengchareun, S., Meduri, G., Thirman, M. J., and Lombes, M. (2005) The Elongation Factor ELL (Eleven-Nineteen Lysine-Rich Leukemia) is a Selective Coregulator for Steroid Receptor Functions. Mol Endocrinol. 19, 1158-1169.
65. Naray-Fejes-Toth, A., Canessa, C., Cleaveland, E. S., Aldrich, G., and Fejes-Toth, G. (1999) Sgk is an Aldosterone-Induced Kinase in the Renal Collecting Duct. Effects on Epithelial Na+ Channels. J Biol Chem. 274, 16973-16978.
66. Soundararajan, R., Zhang, T. T., Wang, J., Vandewalle, A., and Pearce, D. (2005) A Novel Role for Glucocorticoid-Induced Leucine Zipper Protein in Epithelial Sodium Channel-Mediated Sodium Transport. J Biol Chem. 280, 39970-39981.
67. Fakitsas, P., Adam, G., Daidie, D., van Bemmelen, M. X., Fouladkou, F., Patrignani, A., Wagner, U., Warth, R., Camargo, S. M., Staub, O., and Verrey, F. (2007) Early Aldosterone-Induced Gene Product Regulates the Epithelial Sodium Channel by Deubiquitylation. J Am Soc Nephrol. 18, 1084-1092.
69. Boulkroun, S., Fay, M., Zennaro, M. C., Escoubet, B., Jaisser, F., Blot-Chabaud, M., Farman, N., and Courtois-Coutry, N. (2002) Characterization of Rat NDRG2 (N-Myc Downstream Regulated Gene 2), a Novel Early Mineralocorticoid-Specific Induced Gene. J Biol Chem. 277, 31506-31515.
70. Wong, S., Brennan, F. E., Young, M. J., Fuller, P. J., and Cole, T. J. (2007) A Direct Effect of Aldosterone on Endothelin-1 Gene Expression in Vivo. Endocrinology. 148, 1511-1517.
72. Sugiyama, T., Yoshimoto, T., Hirono, Y., Suzuki, N., Sakurada, M., Tsuchiya, K., Minami, I., Iwashima, F., Sakai, H., Tateno, T., Sato, R., and Hirata, Y. (2005) Aldosterone Increases Osteopontin Gene Expression in Rat Endothelial Cells. Biochem Biophys Res Commun. 336, 163-167.
73. Sugiyama, T., Yoshimoto, T., Tsuchiya, K., Gochou, N., Hirono, Y., Tateno, T., Fukai, N., Shichiri, M., and Hirata, Y. (2005) Aldosterone Induces Angiotensin Converting Enzyme Gene Expression Via a JAK2-Dependent Pathway in Rat Endothelial Cells. Endocrinology. 146, 3900-3906.
74. Nakamura, Y., Suzuki, S., Suzuki, T., Ono, K., Miura, I., Satoh, F., Moriya, T., Saito, H., Yamada, S., Ito, S., and Sasano, H. (2006) MDM2: A Novel Mineralocorticoid-Responsive Gene Involved in Aldosterone-Induced Human Vascular Structural Remodeling. Am J Pathol. 169, 362-371.
75. Grossmann, C., Krug, A. W., Freudinger, R., Mildenberger, S., Voelker, K., and Gekle, M. (2007) Aldosterone-Induced EGFR Expression: Interaction between the Human Mineralocorticoid Receptor and the Human EGFR Promoter. Am J Physiol Endocrinol Metab. 292, E1790-800.
78. Leopold, J. A., Dam, A., Maron, B. A., Scribner, A. W., Liao, R., Handy, D. E., Stanton, R. C., Pitt, B., and Loscalzo, J. (2007) Aldosterone Impairs Vascular Reactivity by Decreasing Glucose-6-Phosphate Dehydrogenase Activity. Nat Med. 13, 189-197.
80. McCurley, A., Pires, P. W., Bender, S. B., Aronovitz, M., Zhao, M. J., Metzger, D., Chambon, P., Hill, M. A., Dorrance, A. M., Mendelsohn, M. E., and Jaffe, I. Z. (2012) Direct Regulation of Blood Pressure by Smooth Muscle Cell Mineralocorticoid Receptors. Nat Med. 18, 1429-1433.
81. Rickard, A. J., Morgan, J., Tesch, G., Funder, J. W., Fuller, P. J., and Young, M. J. (2009) Deletion of Mineralocorticoid Receptors from Macrophages Protects Against deoxycorticosterone/salt-Induced Cardiac Fibrosis and Increased Blood Pressure. Hypertension. 54, 537-543.
83. Ronzaud, C., Loffing, J., Bleich, M., Gretz, N., Grone, H. J., Schutz, G., and Berger, S. (2007) Impairment of Sodium Balance in Mice Deficient in Renal Principal Cell Mineralocorticoid Receptor. J Am Soc Nephrol. 18, 1679-1687.
84. Ronzaud, C., Loffing, J., Gretz, N., Schutz, G., and Berger, S. (2011) Inducible Renal Principal Cell-Specific Mineralocorticoid Receptor Gene Inactivation in Mice. Am J Physiol Renal Physiol. 300, F756-60.
88. Berger, S., Wolfer, D. P., Selbach, O., Alter, H., Erdmann, G., Reichardt, H. M., Chepkova, A. N., Welzl, H., Haas, H. L., Lipp, H. P., and Schutz, G. (2006) Loss of the Limbic Mineralocorticoid Receptor Impairs Behavioral Plasticity. Proc Natl Acad Sci U S A. 103, 195-200.
89. Zhou, M., Bakker, E. H., Velzing, E. H., Berger, S., Oitzl, M., Joels, M., and Krugers, H. J. (2010) Both Mineralocorticoid and Glucocorticoid Receptors Regulate Emotional Memory in Mice. Neurobiol Learn Mem. 94, 530-537.
90. Brinks, V., Berger, S., Gass, P., de Kloet, E. R., and Oitzl, M. S. (2009) Mineralocorticoid Receptors in Control of Emotional Arousal and Fear Memory. Horm Behav. 56, 232-238.
91. Arp, J. M., ter Horst, J. P., Kanatsou, S., Fernandez, G., Joels, M., Krugers, H. J., and Oitzl, M. S. (2014) Mineralocorticoid Receptors Guide Spatial and Stimulus-Response Learning in Mice. PLoS One. 9, e86236.
94. Fraccarollo, D., Berger, S., Galuppo, P., Kneitz, S., Hein, L., Schutz, G., Frantz, S., Ertl, G., and Bauersachs, J. (2011) Deletion of Cardiomyocyte Mineralocorticoid Receptor Ameliorates Adverse Remodeling After Myocardial Infarction. Circulation. 123, 400-408.
95. Le Menuet, D., Isnard, R., Bichara, M., Viengchareun, S., Muffat-Joly, M., Walker, F., Zennaro, M. C., and Lombes, M. (2001) Alteration of Cardiac and Renal Functions in Transgenic Mice Overexpressing Human Mineralocorticoid Receptor. J Biol Chem. 276, 38911-38920.
96. Ouvrard-Pascaud, A., Sainte-Marie, Y., Benitah, J. P., Perrier, R., Soukaseum, C., Nguyen Dinh Cat, A., Royer, A., Le Quang, K., Charpentier, F., Demolombe, S., Mechta-Grigoriou, F., Beggah, A. T., Maison-Blanche, P., Oblin, M. E., Delcayre, C., Fishman, G. I., Farman, N., Escoubet, B., and Jaisser, F. (2005) Conditional Mineralocorticoid Receptor Expression in the Heart Leads to Life-Threatening Arrhythmias. Circulation. 111, 3025-3033.
97. Bienvenu, L. A., Morgan, J., Rickard, A. J., Tesch, G. H., Cranston, G. A., Fletcher, E. K., Delbridge, L. M., and Young, M. J. (2012) Macrophage Mineralocorticoid Receptor Signaling Plays a Key Role in Aldosterone-Independent Cardiac Fibrosis. Endocrinology. 153, 3416-3425.
98. Geller, D. S., Farhi, A., Pinkerton, N., Fradley, M., Moritz, M., Spitzer, A., Meinke, G., Tsai, F. T., Sigler, P. B., and Lifton, R. P. (2000) Activating Mineralocorticoid Receptor Mutation in Hypertension Exacerbated by Pregnancy. Science. 289, 119-123.
99. Geller, D. S., Rodriguez-Soriano, J., Vallo Boado, A., Schifter, S., Bayer, M., Chang, S. S., and Lifton, R. P. (1998) Mutations in the Mineralocorticoid Receptor Gene Cause Autosomal Dominant Pseudohypoaldosteronism Type I. Nat Genet. 19, 279-281.
100. Arai, K., Nakagomi, Y., Iketani, M., Shimura, Y., Amemiya, S., Ohyama, K., and Shibasaki, T. (2003) Functional Polymorphisms in the Mineralocorticoid Receptor and Amirolide-Sensitive Sodium Channel Genes in a Patient with Sporadic Pseudohypoaldosteronism. Hum Genet. 112, 91-97.
101. Luther, J. M., Luo, P., Wang, Z., Cohen, S. E., Kim, H. S., Fogo, A. B., and Brown, N. J. (2012) Aldosterone Deficiency and Mineralocorticoid Receptor Antagonism Prevent Angiotensin II-Induced Cardiac, Renal, and Vascular Injury. Kidney Int. 82, 643-651.
102. Tada, Y., Yagi, K., Kitazato, K. T., Tamura, T., Kinouchi, T., Shimada, K., Matsushita, N., Nakajima, N., Satomi, J., Kageji, T., and Nagahiro, S. (2010) Reduction of Endothelial Tight Junction Proteins is Related to Cerebral Aneurysm Formation in Rats. J Hypertens. 28, 1883-1891.
103. Zhao, M., Celerier, I., Bousquet, E., Jeanny, J. C., Jonet, L., Savoldelli, M., Offret, O., Curan, A., Farman, N., Jaisser, F., and Behar-Cohen, F. (2012) Mineralocorticoid Receptor is Involved in Rat and Human Ocular Chorioretinopathy. J Clin Invest. 122, 2672-2679.
104. Farman, N., Maubec, E., Poeggeler, B., Klatte, J. E., Jaisser, F., and Paus, R. (2010) The Mineralocorticoid Receptor as a Novel Player in Skin Biology: Beyond the Renal Horizon? Exp Dermatol. 19, 100-107.
105. Bleich, M., Warth, R., Schmidt-Hieber, M., Schulz-Baldes, A., Hasselblatt, P., Fisch, D., Berger, S., Kunzelmann, K., Kriz, W., Schutz, G., and Greger, R. (1999) Rescue of the Mineralocorticoid Receptor Knock-Out Mouse. Pflugers Arch. 438, 245-254.
106. Zennaro, M. C., Le Menuet, D., Viengchareun, S., Walker, F., Ricquier, D., and Lombes, M. (1998) Hibernoma Development in Transgenic Mice Identifies Brown Adipose Tissue as a Novel Target of Aldosterone Action. J Clin Invest. 101, 1254-1260.
108. Fu, M., Sun, T., Bookout, A. L., Downes, M., Yu, R. T., Evans, R. M., and Mangelsdorf, D. J. (2005) A Nuclear Receptor Atlas: 3T3-L1 Adipogenesis. Mol Endocrinol. 19, 2437-2450.
|
Science Writers | Anne Murray |
Illustrators | Peter Jurek |
Authors | Zhe Chen, Jeff SoRelle, and Bruce Beutler |