Phenotypic Mutation 'naughty' (pdf version)
Allelenaughty
Mutation Type splice site
Chromosome8
Coordinate76,908,668 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Nr3c2
Gene Name nuclear receptor subfamily 3, group C, member 2
Synonym(s) MR, aldosterone receptor, mineralocorticoid receptor, Mlr
Chromosomal Location 76,899,442-77,245,012 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001083906; MGI:99459

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000034031] [ENSMUSP00000105537] [ENSMUSP00000105538] [ENSMUSP00000105539] [ENSMUSP00000116008 ] [ENSMUSP00000122959 ] [ENSMUSP00000118222]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: I133V

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 675 1.89e-31 SMART
low complexity region 690 706 N/A INTRINSIC
HOLI 771 935 7.78e-33 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
(Using ENSMUST00000034031)
SMART Domains Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618
AA Change: I133V

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
HOLI 658 818 1.1e-23 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
(Using ENSMUST00000109911)
SMART Domains Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: I133V

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
(Using ENSMUST00000109912)
SMART Domains Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: I133V

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
(Using ENSMUST00000109913)
Predicted Effect probably null
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618
AA Change: I133V

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
(Using ENSMUST00000148106)
Meta Mutation Damage Score 0.1058 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased
growth/size
Candidate Explorer Status CE: not good candidate; Verification probability: 0.094; ML prob: 0.138; human score: -2
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(9) : Targeted(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Nr3c2 APN 8 76909590 missense possibly damaging 0.82
IGL01019:Nr3c2 APN 8 76909214 missense probably damaging 0.99
IGL01085:Nr3c2 APN 8 76908354 missense probably benign 0.02
IGL01395:Nr3c2 APN 8 76908848 missense possibly damaging 0.73
IGL01505:Nr3c2 APN 8 76909187 missense probably damaging 1.00
IGL01656:Nr3c2 APN 8 77187537 missense probably damaging 1.00
IGL01802:Nr3c2 APN 8 76908595 nonsense probably null
IGL02147:Nr3c2 APN 8 76909067 missense probably damaging 0.98
IGL02502:Nr3c2 APN 8 77242514 missense probably damaging 1.00
IGL02706:Nr3c2 APN 8 76908416 splice site probably null
IGL02945:Nr3c2 APN 8 76909659 missense probably damaging 1.00
IGL03034:Nr3c2 APN 8 77187638 nonsense probably null
IGL03162:Nr3c2 APN 8 77217584 missense probably damaging 0.99
R0141:Nr3c2 UTSW 8 76908408 missense probably damaging 0.99
R0422:Nr3c2 UTSW 8 77185967 missense probably benign
R0458:Nr3c2 UTSW 8 76909538 missense probably damaging 1.00
R0595:Nr3c2 UTSW 8 76909604 missense possibly damaging 0.93
R0615:Nr3c2 UTSW 8 77185889 missense probably benign 0.05
R0964:Nr3c2 UTSW 8 76908668 splice site probably null
R0989:Nr3c2 UTSW 8 77187564 missense probably damaging 0.97
R1532:Nr3c2 UTSW 8 76909104 missense probably damaging 0.99
R1624:Nr3c2 UTSW 8 76909944 missense probably damaging 1.00
R1737:Nr3c2 UTSW 8 76908329 missense probably benign 0.16
R1965:Nr3c2 UTSW 8 76909463 missense probably damaging 0.99
R2011:Nr3c2 UTSW 8 76909793 missense possibly damaging 0.53
R2110:Nr3c2 UTSW 8 76908527 missense possibly damaging 0.75
R2281:Nr3c2 UTSW 8 76909907 missense probably damaging 0.99
R3782:Nr3c2 UTSW 8 77085684 splice site probably null
R3808:Nr3c2 UTSW 8 76908714 missense probably damaging 1.00
R4133:Nr3c2 UTSW 8 76909749 missense probably damaging 1.00
R4433:Nr3c2 UTSW 8 77217467 missense probably damaging 1.00
R4738:Nr3c2 UTSW 8 76909307 missense possibly damaging 0.94
R4770:Nr3c2 UTSW 8 76908243 splice site probably null
R4884:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R5169:Nr3c2 UTSW 8 76909037 missense probably damaging 1.00
R5347:Nr3c2 UTSW 8 77210748 missense possibly damaging 0.92
R5857:Nr3c2 UTSW 8 76908867 missense possibly damaging 0.53
R5878:Nr3c2 UTSW 8 76908268 critical splice acceptor site probably null
R6262:Nr3c2 UTSW 8 76908633 missense possibly damaging 0.65
R6547:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R6820:Nr3c2 UTSW 8 77242457 missense probably damaging 0.98
R7180:Nr3c2 UTSW 8 76908963 missense probably damaging 0.99
R7672:Nr3c2 UTSW 8 76909209 missense probably damaging 1.00
R7741:Nr3c2 UTSW 8 77210646 missense probably damaging 0.97
R7776:Nr3c2 UTSW 8 76909545 missense possibly damaging 0.77
R7800:Nr3c2 UTSW 8 76909992 missense probably damaging 1.00
R8742:Nr3c2 UTSW 8 76908581 missense probably damaging 0.98
R8743:Nr3c2 UTSW 8 76909758 missense probably damaging 1.00
Z1088:Nr3c2 UTSW 8 76908632 missense possibly damaging 0.48
Z1176:Nr3c2 UTSW 8 76909700 missense probably damaging 0.97
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 038231-MU
Last Updated 2019-09-04 9:47 PM by Bruce Beutler
Record Created 2014-11-11 3:53 PM by Jeff SoRelle
Record Posted 2016-04-27
Phenotypic Description

Figure 1. Naughty mice exhibited reduced body weights compared to wild-type controls. Weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The naughty phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0964, some of which exhibited reduced body weights compared to wild-type controls (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 55 mutations (X-axis) identified in the G1 male of pedigree R0964. Weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 55 mutations. The body weight phenotype was linked to a mutation in Nr2c3: an A to G transition at base pair 76,908,668 (v38) on chromosome 8, or base pair 9,408 in the GenBank genomic region NC_000074 encoding Nr2c3. Three genes on chromosome 8 (Nr3c2, Lphn1, and Trmt1) exhibited linkage with a recessive model of inheritance (P = 6.956 x 10-5), wherein 4 variant homozygotes departed phenotypically from 9 homozygous reference mice and 17 heterozygous mice (Figure 2). The mutation in Nr2c3 was presumed to be causative because the naughty phenotype mimics that of a null allele of Nr3c2 [Nr3c2tm1Gsc; MGI:2441654; (1)].

 

The mutation corresponds to residue 432 in the NM_001083906 mRNA sequence in exon 2 of 9 total exons. 

 

417 CTGAGCCCGGCAAAGATTTATCAAAACATGGAG

128 -L--S--P--A--K--I--Y--Q--N--M--E-

 

The mutated nucleotide is indicated in red. The mutation results in an isoleucine (I) to valine (V) substitution at position 133 (I133V) in the encoded protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.054) (2).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Protein domains of the MR. Helices 3, 4, 5, and 12 of the AF-2 domain are indicated (see Figure 4). The naughty mutation results in an isoleucine (I) to valine (V) substitution at position 133 (I133V). Abbreviations: NTD, N-terminal domain; AF1a/b, activator function region 1a/b; DBD, DNA-binding domain; ZF, zinc fingers. The ligand-binding domain is amino acids 727-978.

Figure 4. Crystal structure of the human AF-2 domain. The AF-2 domain is formed by four α-helices 3, 4, 5 and 12 as well as the four β-strands that comprise the LBD (amino acids 727-978 in the mouse). The figure is modeled after Bledsoe et al. (2005) and PDB:2AA2. The image is interactive; click to rotate.

Nr3c2 (nuclear receptor subfamily 3, group C, member 2) encodes the mineralocorticoid receptor (MR; alternatively, aldosterone receptor), a member of the nuclear receptor superfamily that also includes the androgen receptor, progesterone receptor, and the glucocorticoid receptor (GR) (3). The MR responds to two ligands: the mineralocorticoid aldosterone and the glucocorticoid cortisol (alternatively, corticosterone in rodents); progesterone is a MR antagonist, and may also be a physiological ligand.  In epithelial tissues (e.g., nephron, colon, trachea, inner ear, and salivary glands), MR is associated with the 11β-hydroxysteroid dehydrogenase 2 (11β-HSD2), which allows the selectivity of MR binding to aldosterone by converting glucocorticoids to their inactive form (i.e., cortisol into cortisone, or corticosterone into 11-dehydrocotricosterone in rodents). In non-ephithelial tissues (e.g., myocytes, adipocytes, leukocytes, or keratinocytes), 11β-HSD2 is not expressed, indicating that glucocorticoids are the principal ligand of MR.

 

The MR shares similar domain organization with the other nuclear receptors, including an unstructured N-terminal domain (NTD; amino acids 1-602), a highly conserved central DNA-binding domain (DBD; amino acids 603-666), and a C-terminal ligand-binding domain (LBD; amino acids 727-978). A hinge domain (amino acids 667-726) of unknown function connects the DBD to the LBD. Residues 711-733 within the hinge domain in human MR are essential for binding of Hsp90 and to maintain the receptor in its ligand-binding competent state [Figure 3; (4)].

 

The NTD has an activation function region (designated AF-1) that can be subdivided into AF1a (amino acids 1-167) and AF1b (amino acids 445-602). The AF-1a and AF-1b regions regulate the interaction of MR with the transcriptional apparatus by coordinating with coactivators and corepressors at glucocorticoid response element (GRE) sites on target DNA (5). The LBD has an activation function region, AF-2, which mediates binding to co-regulatory molecules that contain a L-x-x-L-L motif (where L is leucine and x is any other amino acid) (6-8). The AF-2 is formed by four α-helices 3, 4, 5 and 12 as well as the four β-strands that comprise the LBD [Figure 4; PDB:2AA2; (9-11)]. Upon binding of a ligand, helix 12 closes over the ligand pocket and helices 3, 5, and 11 bend to form a hydrophobic cleft on the surface of the LBD. The loop between helices 11 and 12 are essential for folding the receptor into a ligand binding-competent state as well as to stabilize the active receptor conformation (12). Several residues within the LBD are essential for the stabilization of the ligand once it associates with the MR. Gln776 and Arg817 form hydrogen bonds with the A-ring ketone of aldosterone to stabilize the steroid. There is also a hydrogen bond between Gln776 and Ser810 (9). Asn770 forms a hydrogen bond with the C-18 hydroxyl (9). Thr945 forms a hydrogen bond between the aldosterone C-21 hydroxyl and the C-20 ketone (9). Amino acids 820-844 confer ligand specificity; changes in the confirmation of this region conferred differences in affinity due to interactions with the Hsp-90 complex (13). Upon aldosterone binding to the MR, the hinge domain interacts with the LBD; cortisol also induces an interaction between the two domains, albeit a much weaker interaction than that with aldosterone (14).

 

Within the DBD of the MR are two nuclear receptor C4-type zinc fingers (amino acids 603-623 and 637-661). The first zinc finger mediates tight binding to the minor groove of the DNA, while the second zinc finger regulates receptor dimerization. The crystal structure of the human MR DBD in complex with a GRE DNA fragment (MR-GRE) has been solved [PDB:4TNT; (15)]. The MR-GRE structure contained a DBD dimer bound to the GRE through interactions at two DNA half sites. The nitrogen of Lys624 forms a hydrogen bond with the N7 position of guanine 3. On the opposite DNA strand, Val25 forms van der Waals contacts with C7 of thymine 13, and Arg629 has two interactions with guanine 12 at the O6 and N7 positions.

 

Three nuclear localization signals, NLS0 (amino acids 590-602), NLS1 within the C-terminal region of the DBD, and NLS2 within the LBD drive the nuclear translocation of the MR upon ligand binding (16;17). A nuclear export signal is present between the two zinc fingers of the DBD in the proximity of the NLS1 (18).

 

Two splice variants of human NR3C2 (α and β) have been described (19-21). The first two exons (1α and 1β) consist of different 5′-untranslated sequences, whereas the other 8 exons encode the translated protein. Alternative transcription of the two 5′-untranslated exons generates different mRNA isoforms (21). The two mRNAs encode identical proteins, but the differences in the 5’-UTR may differentially regulate the expression of the individual transcripts. Another alternative splice variant exhibits loss of exon 5 and 6 (22). A splice variant identified in rat and human has a 12-base pair insertion resulting in coding of four amino acids within the DBD (23). The function of the alternative isoform has not been assessed.

 

The naughty mutation results in an isoleucine (I) to valine (V) substitution at position 133 (I133V) in the AF-1a region of the N-terminal domain.

 

MR Regulation

MR can be regulated at several levels including the amount of ligand available, interacting proteins in the cytoplasm and in the nucleus, the shuttling from the cytoplasm to the nucleus, cross-talk with other signaling pathways, and post-translational modifications [reviewed in (24)].

 

Steroid receptors associate with several proteins in the cytoplasm including chaperone proteins (e.g., Hsp90, Hsp40, Hsp60, Hsp70) and Hsp90 co-chaperone proteins [e.g., the immunophilins FKBP51 and FKBP52 as well as protein phosphatase 5 (pp5)] that maintain the receptors in an inactive form (13;25;25-27). The Hsp90 co-chaperone proteins regulate the affinity of the steroid receptors for their ligands. Upon ligand binding, MR dissociates from the protein complex and translocates to the nucleus.

 

The MR has several phosphorylation sites that are targets of ERK1/2 (Ser196, Ser227, Ser238, Ser263, Ser287, Ser361), cyclin-dependent kinase 5 (CDK5; Ser128, Thr159, Ser250), PKA (Ser601), or casein kinase-1 (Ser601), and unidentified kinases (Ser8, Ser129, Ser183, Ser255, Ser259, Ser262, Ser274, Ser283, Ser299, Ser311, Ser424, Ser543, Ser703, Thr735, Ser737, Ser843) (28). The MR is phosphorylated rapidly after aldosterone stimulation by protein kinase Cα (PKCα); the precise locations of PKCα-induced phosphorylation are unknown (16;29). ERK1/2-mediated MR phosphorylation regulates stability. Loss of ERK1/2-assocated phosphorylation resulted in reduced aldosterone-induced proteasomal degradation of the MR (30). Phosphorylation of the CDK5 target sites interfere with MR transcriptional activity without affecting receptor nuclear accumulation (31). Phosphorylation of Ser843 inactivates the MR by preventing ligand binding (32).

 

The ubiquitin ligase CHIP interacts with the cytosolic non-activated MR upon changes in Hsp90 activity, subsequently reducing the expression level of the MR (33). Aldosterone stimulation of the MR induces polyubiquitination of the MR and targeting of the MR to the ubiquitin proteasome system (34). Under basal conditions, the MR is monoubiquitinated, which is proposed to stabilize the MR (30). Aldosterone-induced ERK1/2-associated MR phosphorylation removes the monoubiquitination and leads to receptor destabilization. In the presence of ligand, the MR is SUMOylated by the SUMO E3 ligase PIAS1 (protein inhibitor of activated signal transducer 1) (24). MR is acetylated within the KxKK motif in the NLS1. Acetylation inhibits the transcriptional activity of MR by preventing the recruitment of RNA polymerase II to target gene promoters (35). Oxidation of MR prevents aldosterone binding (36).

Expression/Localization

The MR is expressed in epithelia of the distal convoluted tubules and cortical collecting ducts of the kidney (37), distal colon (38), airway epithelia of the lung (39), hippocampus (40), hypothalamus, heart (41), smooth muscle (42), eyes (43), adipocytes (44), salivary glands, sweat glands (45), uterus, testis (46), placenta (47), pancreas (48), keratinocytes (49), leukocytes, and macrophages (50;51)) [reviewed in (52)]. Inactive MR is localized in the cytosol, while active MR translocates to the nucleus.

 

MR expression is developmentally regulated in several tissues, including the brain, kidney, lung, and heart (53). In the mouse, Nr3c2 expression increases after birth in the pituitary, and then stabilizes up to adulthood. In the heart, MR expression is reduced from day 80 of gestation to the postnatal stage in the left but not right ventricle (54). Expression of the α and β isoforms are differentially regulated during brain development (55). Expression of the α isoform is stable during development, while expression of the β isoform is expressed during the first two weeks of life.

Background
Figure 5. The function of the MR. The MR and GR act as ligand activated transcription factors that reside primarily in the cytoplasm bound to chaperone and scaffolding proteins when not bound to an agonist. Upon ligand binding they are transported to the nucleus where they form homodimers and heterodimers that bind hormone response elements on the chromosomes and associate with coactivator and corepressor proteins to modulate the transcription of effector proteins. Some chaperone and co-activator proteins bind both receptors. MR and GR associated with the plasma membrane within caveoli initiate rapid nonnuclear effects through classic cell signaling mechanisms. 11β-HSD enzymes within the endoplasmic reticulum modulate glucocorticoid concentrations for both the GR and MR. Figure and legend adapted from Gomez-Sanchez, E. and Gomez-Sanchez, C.E. Compr Physiol. 2014 Jul; 4(3): 965–994.

The mineralocorticoids (e.g., aldosterone) and glucocorticoid are hormones secreted by the cortex of the adrenal glands; mineralocorticoids are secreted from the zona glomerulosa, while the glucocorticoids are secreted from the zona fasciculata. Mineralocorticoids mediate electrolyte and fluid homeostasis, while glucocorticoids mediate immediate energy requirements and reduce inflammatory responses during a stress response as well as regulate bone, carbohydrate, and lipid metabolism (Figure 5) (56).

 

Upon ligand binding and receptor translocation to the nucleus, the MR dimerizes, and binds GREs on target genes. The DNA-bound MR recruits coregulatory complexes (e.g., members of the large steroid receptor coactivator family (SRC), PBP/TRAP220, small ubiquitin-related modifier-1 (SUMO-1), ubiquitin9, steroid receptor coactivator-1 (SRC-1), and CREB-binding protein (CBP) as coactivators, and NCoR and SMRT as corepressors), which link the receptor to the transcriptional apparatus, subsequently leading to either activation or repression of target gene expression (57). MR target genes include those that function in water-electrolyte homeostasis, blood pressure regulation, inflammation, oxidative stress, and fibrosis (58). A brief list of known MR target genes are outlined in Table 1. The MR also has functions in the regulation of signaling pathways including the epidermal growth factor (EGF)/EGFR and Ang II/type 1 Ang II receptor (AT1R) pathways (58). The activated MR regulates signaling pathways at the cell membrane to modulate the response of second messenger signaling pathways.

 

Table 1. Select target genes of the MR [adapted from (59)]

 

Target gene

Tissues

Brief Description of Function

References

Epithelial target genes

ENaC subunits

Kidney, inner ear, colon

Na+ transport

(60)

Na+/K+-ATPase pump

Kidney, colon

Na+ transport

(61)

CHIF (channel-inducing factor)

Kidney, colon

Na+ transport

(62)

K-ras2

Colon

Unknown

(63)

ELL (eleven-nineteen lysine-rich leukemia)

Kidney

Elongation factor

(64)

SGK1

Kidney, colon

Na+ transport; Nedd-4-2 phosphorylation; ENaC trafficking

(65)

GILZ (glucocorticoid-induced leucine zipper protein)

Kidney

Na+ transport; inhibition of the ERK signaling cascade

(66)

Usp2-45

Kidney, colon

ENaC deubiquitylation

(67)

KS-WNK1 (With No lysine K)

Kidney

Na+ transport

(68)

NDRG2 (N-Myc downstream regulated gene 2)

Kidney, colon

Putative ENaC activation

(69)

ET-1 (endothelin-1)

Kidney, colon

Vasoconstriction

(70)

PAI-1 (plasminogen activator inhibitor-1)

Kidney

Inhibition of glomerulosclerosis

(71)

Non-epithelial target genes

Osteopontin

Aortic endothelium

Initiation of inflammation and fibrosis

(72)

ACE (angiotensin converting enzyme)

Aortic endothelium

Endothelial dysfunction; vascular injury

(73)

MDM2

Smooth muscle

Cell proliferation

(74)

EGFR

Smooth muscle

Increase in fibronectin abundance

(75)

Collagen I, III, IV

Cardiac fibroblasts, renal fibroblasts

Progression of myocardial and/or tubulinterstitial fibrosis

(76)

TNX, ADAMTS1, PAI-1, Orm-1, RGS2, adrenodullin

Heart

Cardiac remodeling; regulation of blood pressure

(77)

G6PD

Coronary artery endothelium

Impairment of vascular reactivity

(78)

UPAR; HAS2

Heart

Cardiac remodeling; regulation of blood pressure

(77)

UCP1, UCP3

Brown adipocytes

Thermogenesis

(79)

 

The function of the MR in epithelial tissues is mainly to regulate ion transport and water resorption, while in non-epithelial tissues, MR signaling induces a tissue-specific response (e.g., adipocyte differentiation (44), regulation of membrane excitability in neurons and muscle cells, blood pressure regulation (80;81), epidermal regulation (49)), and neuronal responses needed for learning, memory, and responses to stress [reviewed in (56)]. Several functions of the MR are discussed in more detail, below.

 

Epithelial sodium transport

Upon recognition of aldosterone, the MR regulates epithelial sodium transport in the distal nephron and the distal colon to maintain sodium homeostasis (82). Aldosterone increases apical membrane sodium permeability through MR-associated changes in transcription and activity of the epithelial sodium channel (ENaC) and the Na+/K+-ATPase pump. Nr3c2AQP2-Cre mice have MR inactivation solely in renal cells. The Nr3c2AQP2-Cre mice have normal renal sodium excretion on a standard diet, but on a low-sodium diet, the mice quickly lose sodium (83;84). Nr3c2-deficient (Nr3c2-/-) mice die around postnatal day (P) 10 due to extreme salt and water loss (1). Prior to death, newborn mice exhibit weight loss. The mice exhibit hyperkalemia and hyponatremia at P8, which corresponds to the end of renal maturation. Newborn mice can be rescued by sodium chloride (NaCl) injections followed by oral supplementation after weaning (85).

 

The HPA axis

With the exception of hypothalamic sites in the regulation of salt-appetite (86), the MR is activated by glucocorticoid rather than aldosterone in the central nervous system. In the hippocampus, the MR regulates the hypothalamic-pituitary-adrenocortical (HPA) axis (87). The HPA axis controls reactions to stress and regulates several physiological processes including digestion, the immune system, emotions, and energy storage and expenditure. In the hippocampus, the MR functions in cell excitability and long-term potentiation, which are factors essential for learning ability and memory (82;88). Conditional knockout of Nr3c2 in the forebrain results in impaired spatial learning and reduced working memory as well as the emergence of behavioral stereotypes (e.g., emotional arousal and anxiety-related disorders) (89-92). The mice also exhibited deficits in stimulus-response tasks compared to wild-type mice (92). In contrast, targeted Nr3c2 overexpression in the forebrain reduced anxiety-like behavior (93).

 

Vascular remodeling

During vascular remodeling, aldosterone binds to endothelial MR to regulate the expression of several genes including intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and glucose-6-phosphate dehydrogenase (G6PD). In addition, the MR may transactivate the EGFR, subsequently initiating a signaling cascade that includes non-receptor tyrosine kinase c-Src and/or phosphoinositide 3-kinase (PI3K). The c-Src activates NADPH oxidases through Rac1 and may also activate protein phosphatase 2A (PP2A). PP2A can reduce the expression of endothelial nitric oxide synthase (eNOS; alternatively NOS3; see the record for paul) and the production of nitric oxide. In endothelial cells, the MR can ultimately lead to inflammation, oxidative stress, endothelial cell dysfunction, and subsequent vascular remodeling [reviewed in (94)]. Cardiomyocyte-specific deletion of Nr2c3 did not display aberrant cardiac morphology and function; however, the mice exhibited improved infarct healing and prevention of adverse cardiac remodeling, contractile dysfunctions observed in ischemic heart failure (95). Transgenic mice overexpressing human NR3C2 in aldosterone target tissues (e.g., distal nephron, brain, and heart) exhibited enlarged kidneys, renal tubular dilation, normal blood pressure, and progressive mild dilated cardiomyopathy and arrhythmia (96). Targeted overexpression of Nr3c2 in the heart resulted in life-threatening arrhythmias (97).

 

Cardiac inflammation

Activation of the MR results in the infiltration of inflammatory cells (e.g., monocytes, macrophages, and lymphocytes) in the vasculature. Infiltration of inflammatory cells is a key feature of cardiac inflammation (98). Infiltrating macrophages function in the prolonged inflammatory response in the myocardium through the secretion of cytokines that stimulate fibroblast differentiation and collagen production. In addition, MR activation results in increased activity and expression of NADPH oxidases, the production of reactive oxygen species, and mitochondrial electron transport uncoupling. Macrophage/monocyte-specific deletion of Nr3c2 expression results in protection against salt-induced cardiac fibrosis and increased blood pressure (81).

 

Human conditions associated with the MR

Mutations in NR3C2 are linked to autosomal dominant early-onset hypertension (OMIM: #605115) (99) and autosomal dominant pseudohypoaldosteronism type I (PHA1; OMIM: #177735) (100;101). PHA1 is caused by mineralocorticoid resistance. Patients with PHA1 have increased risk of stroke and myocardial infarction. Patients with PHA1 often exhibit overt dehydration and hyponatremia (i.e., low sodium concentration in the blood) due to systemic salt loss and hyperkalemia (i.e., high potassium levels in the blood). In addition, patients with PHA1 often have insufficient weight gain due to chronic dehydration. Overactive MR signaling is also associated with renal and cardiac injuries (102), cerebral aneurysm (103), chorioretinopathy (104), and epidemis abnormalities (105).

Putative Mechanism

Figure 6. MR activation in white and brown fat cell differentiation and function. In the the renin-angiotensin-aldosterone system (RAAS), renin stimulates the cleavage of angiotensinogen to form angiotensin I. Angiotensin converting enzyme (ACE) converts angiotensin I to angiotensin II. In the adrenal gland angiotensin II receptor (AT1) activation by the angiotensin II results in the release of aldosterone. Aldosterone stimulates the activation of the mineralocorticoid receptor (MR). Aldosterone causes an increase in the expression of adipogenic genes including lipoprotein lipase (LPL), peroxisome proliferator-activated receptor (PPARγ), and adipocyte-specific fatty acid binding protein (aP2). In brown preadipocytes, MR activation inducing the accumulation of intracytoplasmic lipid droplets and promoting cell differentiation through increased expression of LPL, PPARγ and aP2. Aldosterone also inhibits the expression and function of uncoupling protein-1 (UCP-1), a mitochondrial protein that plays a critical role in the regulation of thermogenesis and energy expenditure, thus promoting the adipose differentiation process. MR gene expression is induced during adipose conversion in white adipose tissue. Aldosterone promotes adipogenesis. MR also functions in adipose differentiation induced by minteralocorticoids and glucocorticoids. In white preadipocytes, MR activation induces cell proliferation and subsequently triggers the adipogenic transcriptional machinery, up-regulating C/EBPα and PPARγ gene expression, with a subsequent increase in intracellular triglyceride accumulation and adipokine expression. Moreover, MR activation induces the expression of pro-inflammatory genes such as TNF-α, IL-6, and MCP-1, promoting macrophage infiltration and providing the environmental conditions for inflammation.

The MR functions in both brown and white adipocytes to mediate corticosteroid-induced adipogenesis (Figure 6) (44;106). During adipocyte differentiation, the gene expression changes determine the phenotype of mature adipocytes. Aldosterone promotes adipogenesis by inhibiting the expression and function of uncoupling protein-1 (UCP-1), a mitochondrial protein that functions in thermogenesis and energy expenditure regulation (107). MR signaling in brown adipose tissue promotes lipid storage at the expense of heat production. In white adipose tissue, MR expression is induced during adipose conversion (108). Both mineralocorticoids and glucocorticoids induce adipose differentiation in 3T3-L1 cells (44).

 

In contrast to Nr3c2-deficient mice, the naughty mice survive until adulthood, indicating that MRnaughty retains some function. However, the function of MRnaughty in adipogenesis appears to be reduced. The other functions of MR have not been examined in the naughty mice.

Primers PCR Primer
naughty_pcr_F: ACAATAGTCGGTCTGGGATTTTGCC
naughty_pcr_R: TGCACTGGGAAACTGCCAAAGC

Sequencing Primer
naughty_seq_F: GCCATCAGATATTAAAACTGAGCTG
naughty_seq_R: ACATGGAGTTGATGCCCG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 448 nucleotides is amplified (chromosome 8, + strand):


1   acaatagtcg gtctgggatt ttgccatcag atattaaaac tgagctggaa tccaaggaac
61  tttcagccac ggtggctgag tccatgggtt tatacatgga ttctgtgaga gatgccgagt
121 acacttatga tcagcaaaac caacaaggaa gcctgagccc ggcaaagatt tatcaaaaca
181 tggagcagct ggtgaagttt tacaaagaga atggtcacag gtcctccaca ctgagtgcta
241 taagcaggcc tttgaggtca ttcatgcctg actctgggac ctccatgaat ggtggggcct
301 tgcgtgccat cgttaagagc ccaatcatct gtcatgagaa gagcccctct gtttgcagcc
361 cgctcaacat gccgtcttca gtatgcagcc ccgcgggcat caactccatg tcctcctcca
421 cagctagctt tggcagtttc ccagtgca


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsZhe Chen, Jeff SoRelle, and Bruce Beutler