Phenotypic Mutation 'Alfalfa'

• Allele: Alfalfa
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 71,373,728 bp (GRCm38)
• Base Change: T ⇒ A (forward strand)
• Gene: Cd8a
• Gene Name: CD8 antigen, alpha chain
• Synonym(s): Ly-35, Lyt-2, Ly-B, Ly-2
• Chromosomal Location: 71,373,427-71,379,173 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011] ; PHENOTYPE: Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Aspartic acid
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000068123] [ENSMUSP00000131873]
• AlphaFold: P01731
• PDB Structure: MURINE CD8AA ECTODOMAIN FRAGMENT IN COMPLEX WITH H-2KB/VSV8 [X-RAY DIFFRACTION] ; The Crystal Structure of a TL/CD8aa Complex at 2.1A resolution:Implications for Memory T cell Generation, Co-receptor Preference and Affinity [X-RAY DIFFRACTION] ; CD8alpha-alpha in complex with YTS 105.18 Fab [X-RAY DIFFRACTION] ; Crystal structure of a CD8ab heterodimer [X-RAY DIFFRACTION] ; Crystal structure of CD8alpha-beta in complex with YTS 156.7 FAB [X-RAY DIFFRACTION] ; Crystal structure of the CD8 alpha beta/H-2Dd complex [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000068123; Gene: ENSMUSG00000053977; AA Change: V59D

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
IG	38	148	1.46e-5	SMART
transmembrane domain	195	217	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
  (Using ENSMUST00000066747)
• SMART Domains: Protein: ENSMUSP00000131873; Gene: ENSMUSG00000053977; AA Change: V59D

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
IG	38	148	1.46e-5	SMART
transmembrane domain	195	217	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
  (Using ENSMUST00000172321)
• Meta Mutation Damage Score: 0.6467
• Is this an essential gene?: Probably nonessential (E-score: 0.073)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• MMRRC Submission: 038205-MU
• Last Updated: 2019-10-23 1:57 PM by Anne Murray
• Record Created: 2014-11-12 11:36 PM by Jin Huk Choi
• Record Posted: 2015-06-08
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Peter Jurek
• Authors: Ming Zeng, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001081110.2 (variant 1), NM_009857.1 (variant 2); MGI: 88346

Alleles Listed at MGI

All mutations/alleles(16) : Spontaneous(1) Targeted(13) Transgenic(2)

Phenotypic Description

Figure 1. Alfalfa mice exhibit reduced frequencies of peripheral CD8 + T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Alfalfa mice exhibit reduced frequencies of peripheral naïve CD8 + T cells in total CD8 + T cells. Flow cytometric analysis of peripheral blood was utilized to determine naïve CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Alfalfa mice exhibit increased frequencies of central memory CD8 + T cells in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine central memory CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Alfalfa mice exhibit increased frequencies of effector memory CD8 + T cells in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine effector memory CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Alfalfa mice exhibit elevated mean fluorescence intensity (MFI) of CD44 immunostaining on CD8 + T cells in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Alfalfa mice exhibit increased frequencies of CD4 + T cells in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine CD4 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Alfalfa mice exhibit increased frequencies of CD4 + T cells among CD3 + T cells in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine CD4 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Alfalfa mice exhibit an increased CD4:CD8 T cell ratio in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine CD4 + and CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Alfalfa mice exhibit an increased mouse cytomegalovirus (MCMV) titre in the spleen. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The alfalfa phenotype was identified among a subset of G3 mice of pedigree R1158 carrying ENU-induced mutations.  The phenotype was characterized by effects mainly on CD8⁺ T cells: greatly reduced frequencies of CD8⁺ T cells (~10% of C57BL/6J; Figure 1), reduced frequencies of naïve CD8⁺ T cells among total CD8⁺ T cells (Figure 2), elevated frequencies of central (Figure 3) and effector memory CD8⁺ T cells (Figure 4), and elevated mean fluorescence intensity of CD44 immunostaining on CD8⁺ T cells (Figure 5), all in the peripheral blood. In addition, increased frequencies of CD4⁺ T cells were observed among total cells (Figure 6) or CD3⁺ T cells (Figure 7) in the peripheral blood (~150% of C57BL/6J); the CD4:CD8 cell ratio was consequently elevated (Figure 8).  Five days after mouse cytomegalovirus (MCMV) infection, several mice displayed elevated MCMV titers in the spleen (Figure 9), suggesting increased susceptibility to the virus. With the exception of the CD4⁺ T cell phenotype, which was transmitted dominantly, all phenotypes were recessive with a detectable semidominant effect.

Nature of Mutation

Figure 10. Linkage mapping of the elevated CD4:CD8 T cell ratio using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 43 mutations (X-axis) identified in the G1 male of pedigree R1158. Normalized phenotype data were used for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, without or with Bonferroni correction, respectively.

Whole exome HiSeq sequencing identified 43 mutations in the G1 grandsire of the alfalfa pedigree. Each of the alfalfa phenotypes was mapped as a quantitative trait to a missense mutation of Cd8a: a T to A transversion at base pair 71,373,728 on chromosome 6 (GRCm38), corresponding to base pair 20,957 of the genomic DNA sequence (NC_000072.6). The mutation is positioned in exon 2 out of 6 exons (variant 1) or 5 exons (variant 2). Strongest linkage was found with the elevated CD4:CD8 T cell ratio using a recessive transmission model, with 5 affected mice homozygous for the mutation and 22 unaffected mice heterozygous (n = 10) or homozygous (n = 12) for the reference allele (P = 1.993 x 10^-16; Figure 10).

The mutation affects nucleotide 302 of Cd8a mRNA variants 1 (NM_001081110.2) and 2 (NM_009857.1):

286 GAAGTGTTGGGGTCCGTTTCGCAAGGATGCTCT 54  -E--V--L--G--S--V--S--Q--G--C--S-

The mutated nucleotide is indicated in red. The mutation results in a valine (V) to aspartic acid (D) substitution at position 59 (V59D) of both variants of the CD8 antigen, α chain (CD8α) and is predicted “probably damaging” by PolyPhen-2 (score = 0.989) (1).

Protein Prediction

The CD8α chain (also known as Lyt-2) is a 34-37 kDa single pass type I transmembrane glycoprotein of the immunoglobulin (Ig) superfamily.  CD8α homodimerizes or heterodimerizes with CD8β (also known as Lyt-3) to form CD8αα or CD8αβ, respectively; CD8αα and CD8αβ display distinct expression patterns and functions.  CD8αβ functions as a coreceptor for the T cell receptor (TCR) [reviewed in (2)].  In contrast, the function of CD8αα is unknown; it has been speculated to function as a TCR corepressor that negatively regulates cellular activation (3).  Both CD8 isoforms bind to MHC class I molecules with equivalent affinity (4;5).

Figure 11. Domain structure of CD8α. Three complementarity-determining regions (CDR) mediate binding to peptide-MHCI complexes. SP, signal peptide; TMD, transmembrane domain; CYT, cytoplasmic tail. The alfalfa mutation results in a valine (V) to aspartic acid (D) substitution at position 59 (V59D) . This image is interactive; click to view additional mutations in CD8α.

The 247-amino acid mouse CD8α chain consists of an N-terminal hydrophobic signal sequence (amino acids (aa) 1-27), an extracellular Ig-like domain (aa 28-139) followed by a hinge or stalk region containing three O-linked glycosylation sites (aa 140-196), a transmembrane segment (aa 197-217), and a cytoplasmic tail (aa 218-247) [Figure 11; reviewed in (6)].  The human and mouse CD8α protein sequences share 50% identity overall, with the greatest frequency of conserved residues in the transmembrane and cytoplasmic domains (79% and 55%, respectively).  In mouse CD8α, cysteines 53 and 129 form an intramolecular disulfide bond that is characteristic of an Ig fold.  Disulfide linkage with the CD8β protein is mediated by cysteines 178 and 193.  The crystal structure of the Ig-like domains of mouse CD8αβ [Figure 12; PDB:2ATP] resembles the variable domain fragment (Fv) of an antibody, with each chain adopting a V-set type Ig fold (7;8); this structure is similar to that of the Ig-like domains in the CD8αα dimer (9;10).  The two chains of both dimers have similar conformations, including a disulfide bond between the B and F β-strands, and a tryptophan on the C strand. 

Figure 12. Crystal structure of the extracellular Ig-like domains of mouse CD8αβ. Here, the two ectodomains were covalently joined by a 29 amino acid linker. The BC loop (CDR1) containing the alfalfa mutation, the C’C” loop (CDR2), and the FG loop (CDR3) make contact with peptide-MHC1. Model is based on PDB 2ATP, Chang et al. Immunity. 23, 661-671 (2005). Click on the 3D structure to view it rotate.

Figure 13. Crystal structure of the CD8αβ Ig-like domains in complex with the extracellular region of H-2D^d (yellow), β2m (gray), and a bound 10 amino acid peptide (not shown). CD8β (orange) is proximal to the T cell membrane; CD8α (green) is distal. Model is based on PDB 3DMM, Wang et al. J. Immunol. 183, 2554-2564 (2009). Click on the 3D structure to view it rotate.

Figure 14. Crystal structure of the CD8αα Ig-like domains in complex with the extracellular region of H-2K^b (yellow), β2m (gray), and a bound 8 amino acid VSV peptide (not shown). CD8α1 (lime green) is proximal to the T cell membrane; CD8α2 (green) is distal. Model is based on PDB 1BQH, Kern et al. Immunity. 9, 519-530 (1998). Click on the 3D structure to view it rotate.

Either CD4 (see thoth) or CD8 and the TCR (αβ unless otherwise indicated) mediate T cell recognition of antigen-MHC complexes on the surface of antigen presenting cells.  Expression of CD4 versus CD8αβ by a given T cell restricts TCR recognition of peptides to those bound to either MHCII or MHCI, respectively.  CD4 and CD8αβ contact a conserved membrane-proximal region of their MHC target to enforce MHC class restriction [reviewed in (11)].  The molecular details of the interaction between CD8αα or CD8αβ with the peptide-MHCI complex (pMHCI) have been investigated by X-ray crystallography (8-10;12).  The 3D structures revealed that the extracellular Ig-like domain of both CD8 dimers contact the α3 domain of the MHCI heavy chain, whereas CD8αα additionally contacts the α2 domain and β2-microglobulin (Figure 13; PDB:3DMM and Figure 14; PDB:1BQH), .  Three complementarity-determining regions (CDRs), consisting of the BC loop (CDR1), the C’C” loop (CDR2), and the FG loop (CDR3), are involved in binding to the α3 domain of pMHCI, and in the case of CD8αα also to β2m.  The CD8β subunit of CD8αβ is positioned next to the T cell membrane, while the CD8α subunit is distal from the T cell and close to the C-terminus of the MHCI α3 domain.  Differences exist between the CD8αα/pMHCI interface and the CD8αβ/pMHCI interface despite the fact that overall conformations are quite similar.  Importantly, nearly all MHCI residues making key contacts with CD8αα and CD8αβ are non-polymorphic; thus CD8αα and CD8αβ bind to different MHCI alleles with only subtly different affinities (4;13).  However, reports suggest that CD8αβ is a more effective coreceptor than CD8αα in enhancing the range and sensitivity to peptide antigens and alloantigens recognized by TCRs (14-17).  The stalk or intracellular region of CD8β may facilitate a configuration that promotes this augmented function (17-20).

Connecting the Ig-like domain to the transmembrane domain, the stalk region of CD8α contains numerous threonine, serine, and proline residues and is heavily O-glycosylated (21-23).  CD8β is also O-glycosylated in its stalk region, and within the CD8αβ dimer; O-glycosylation of CD8β is developmentally regulated such that immature double positive thymocytes display lower levels than mature thymocytes (24-26).  This relative difference influences thymocyte selection in that decreased levels of CD8β O-glycosylation in immature thymocytes correlate with increased affinity for pMHCI; the enhanced CD8-pMHCI binding promotes elimination of autoreactive T cells in the thymus (25;26).  In contrast, higher levels of O-glycosylation in mature T cells reduce CD8 affinity for pMHCI, thereby requiring stronger TCR-pMHCI binding for T cell activation.  The structural mechanism by which O-glycosylation alters CD8 affinity for pMHCI is unknown (27); in published 3D crystal structures the stalk region has been disordered.  O-glycosylation has been reported to increase the rigidity of polypeptides, as observed in mucins, and may limit the mobility of the Ig-like domains of CD8αα and CD8αβ [reviewed in (2)].  O-glycosylation of CD8α does not appear to be developmentally regulated (24). 

The cytoplasmic domain of CD8α binds to the Src family kinase Lck (see iconoclast) (28;29).  Two cysteines in the CD8α cytoplasmic domain (C227 and C229 in mouse) are necessary for this interaction (30;31).

The alfalfa mutation lies within the extracellular Ig-like domain of CD8α, in the CDR1 which consists of the connecting loop between β-strand B and β-strand C.

Expression/Localization

CD8αβ is expressed primarily on TCRαβ⁺ thymocytes and peripheral cytotoxic T cells (32;33); the cell surface expression of CD8β requires association with CD8α (34;35).  CD8αα is found on intestinal intraepithelial lymphocytes (36;37), TCRγδ⁺ T cells, and some natural killer (NK) cells and dendritic cells (DCs) (38).  CD8αα is reportedly expressed on terminally differentiated human CD8⁺ T cells that have expanded during chronic viral infection (39).

Background

T cells become activated when the TCR engages a peptide antigen in complex with an MHC molecule on the surface of a target or antigen-presenting cell.  However, TCR-pMHC interaction is not by itself sufficient to induce an effective T cell response.  Rather, engagement of pMHC by the TCR and either the CD4 or CD8 coreceptor is necessary for optimal T cell stimulation (40;41).  For cytotoxic T cells, the interaction of CD8 with MCHI enhances the antigen sensitivity and response of the T cells to pMHC ligands (42).  As discussed above, CD8 contacts invariant sites on the membrane-proximal region of the MHCI molecule in the context of the composite pMHCI complex.  These sites are distinct and physically distant from the sites bound by the TCR, permitting both coreceptor and TCR to bind the same pMHCI complex (10).  Absent CD8-pMHCI interaction, MHC class I-restricted immune responses including cytokine production and cytotoxic effector function are impaired (40;41).  However, high-affinity pMHC/TCR interactions can in some cases compensate for a lack of CD8 engagement in terms of Lck activation, T cell proliferation, and cytotoxic T lymphocyte (CTL) activity (43).  Discussed here is the TCR coreceptor function of the CD8αβ heterodimer; the function of CD8αα is unknown although it is suggested to act as a TCR corepressor (3).

Figure15. TCR signaling pathway. Together with CD4 or CD8 (depicted here), TCRs are responsible for the recognition of major histocompatibility complex (MHC) class II and I, respectively, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR, and CD4/8 engagement of MHC, initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca²⁺) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP₂) to inositol-1,4,5-trisphosphate (IP₃) and DAG resulting in Ca²⁺-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB (NF-κB) activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors.

The affinity of CD8αβ for pMHCI is 10- to 100-fold weaker than TCR-pMHC1 affinities [(5); reviewed in (2;44)].  During T cell activation, an ordered engagement in which TCR-pMHC interaction precedes CD8-pMHC binding dictates that contact between the TCR and pMHC prevails in T cell-antigen engagement (45;46).  Rather than physically promoting initial TCR-pMHCI binding, the major function of CD8αβ is to recruit the kinase Lck to the TCR-MHC interaction site where it can phosphorylate immunoreceptor tyrosine-based activation motifs (ITAMs) on the cytoplasmic tails of associated CD3 proteins (see tumormouse, a mutation of Cd3e, and allia, a mutation of Cd247) (47;48).  Their phosphorylation recruits and activates other proteins including ZAP-70 (ζ-chain-associated protein of 70 kDa; see murdock), SLP-76 (SH2 domain-containing leukocyte protein of 76 kDa), and LAT (linker for activation of T cells) necessary for signaling leading to T cell activation, proliferation, and differentiation (Figure 15; also see iconoclast for a description of TCR signaling).  CD8α serves as a Lck docking site (28;29) through a ‘zinc clasp’ structure that tethers Lck to the CD8α cytoplasmic tail (49).  A secondary function of the CD8-pMHCI interaction is to synergistically stabilize TCR-pMHCI interactions (46).  However, it has also been reported that CD8αβ can play a critical role in promoting TCR-pMHCI binding, particularly for multimeric low-affinity pMHCI ligands (50;51).

Figure 16. Thymocyte differentiation. CD4 + and CD8 + T cells expressing αβ TCRs begin their development as double negative CD4 - CD8 - precursor thymocytes in the capsule of the thymus. After TCRβ rearrangement, progression to the double positive CD4 + CD8 + stage, and TCRα rearrangement (in the cortex of the thymus), the yet immature TCRαβ + CD4 + CD8 + thymocytes are then subject to positive or negative selection to generate mature CD4 + helper T cells and CD8 + cytotoxic T cells in the medulla of the thymus.

TCR signaling is necessary for both adaptive immune responses and for thymocyte differentiation (Figure 16).  Thymocytes are classified based on CD4 and CD8 expression, with the earliest thymocytes being CD4^-CD8^- (DN, double negative).  DN thymocytes differentiate into CD4⁺CD8⁺ double positive (DP) cells, which undergo positive and negative selection following TCR-mediated interactions with self peptide-MHC complexes.  During positive selection, DP cells with intermediate affinity for self-MHC mature into CD4⁺8^- or CD4^-8⁺ single positive (SP) cells, whereas strongly self-reactive DP cells undergo apoptosis during negative selection.  CD8αβ is required for both positive and negative selection of DP cells in the thymus (52-54).  Mice deficient in CD8α and/or CD8β displayed diminished or absent CD8⁺ T cells in the periphery, although thymocyte differentiation to the DP stage was intact.  Consequently, cytotoxic responses against alloantigens and viral antigens were reduced in T cells from these mice.  The interaction of CD8α with Lck is critical for positive selection, because Lck^-/- mice expressing a mutated transgenic Lck incapable of interacting with CD8 failed to develop mature CD8 T cells (55).  The CD8-Lck interaction is also necessary for negative selection (55). 

More generally, the association of Lck with either the CD4 or CD8 coreceptor has been reported to underlie thymic selection of an MHC-restricted TCR repertoire (56).  It was proposed that only MHC ligands can activate productive TCR signaling by co-engagement of TCR and Lck-associated coreceptors, but that non-MHC ligands that fail to engage coreceptors cannot activate Lck and consequent TCR signaling (57).  Thus, DP thymocytes bearing MHC-independent TCRs cannot be signaled and subsequently die of neglect.  This hypothesis was predicated on limiting amounts of coreceptors such that no free Lck is available in DP cells (58).  Experimental data showed that TCRs in mice lacking both coreceptors and MHC possessed antibody-like specificities with no MHC dependence (57;59).  Moreover, mice in which Lck bears mutations of the two cysteines that mediate interaction with CD4 and CD8 in the thymus generated an MHC-independent TCR repertoire, and thymic selection of those TCRs depended on coreceptor-non-associated Lck but not on MHC (56).

The lineage choice of a DP cell for either the CD4⁺ or CD8⁺ fate depends on the MHC restriction specificity of its TCR, with MHC1-restricted T cells developing into CD8 cells and MHCII-restricted T cells developing into CD4 cells (60).  A “kinetic signaling model” has been proposed to explain the mechanism of lineage choice, which involves changes in coreceptor transcription driven by the persistence or termination of TCR-mediated positive selection signaling and by IL-7 receptor signaling [reviewed in (61)].  For CD8α, transcription factors including RUNX3 and Ikaros act on developmental stage-specific enhancer elements to induce its expression in CD8 T cells (62-64).

Putative Mechanism

The alfalfa mutation lies within CDR1 that mediates binding to pMHC1.  It is likely that the alfalfa mutation impairs the binding of CD8αβ to pMHC1, leading to diminished numbers and frequencies of CD8 T cells in the blood as a result of defective positive selection.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Li, Y., Yin, Y., and Mariuzza, R. A. (2013) Structural and Biophysical Insights into the Role of CD4 and CD8 in T Cell Activation. Front Immunol. 4, 206.

  3. Cheroutre, H., and Lambolez, F. (2008) Doubting the TCR Coreceptor Function of CD8alphaalpha. Immunity. 28, 149-159.

  4. Garcia, K. C., Scott, C. A., Brunmark, A., Carbone, F. R., Peterson, P. A., Wilson, I. A., and Teyton, L. (1996) CD8 Enhances Formation of Stable T-Cell receptor/MHC Class I Molecule Complexes. Nature. 384, 577-581.

  5. Huang, J., Edwards, L. J., Evavold, B. D., and Zhu, C. (2007) Kinetics of MHC-CD8 Interaction at the T Cell Membrane. J Immunol. 179, 7653-7662.

  6. Littman, D. R. (1987) The Structure of the CD4 and CD8 Genes. Annu Rev Immunol. 5, 561-584.

  7. Chang, H. C., Tan, K., Ouyang, J., Parisini, E., Liu, J. H., Le, Y., Wang, X., Reinherz, E. L., and Wang, J. H. (2005) Structural and Mutational Analyses of a CD8alphabeta Heterodimer and Comparison with the CD8alphaalpha Homodimer. Immunity. 23, 661-671.

  8. Wang, R., Natarajan, K., and Margulies, D. H. (2009) Structural Basis of the CD8 Alpha beta/MHC Class I Interaction: Focused Recognition Orients CD8 Beta to a T Cell Proximal Position. J Immunol. 183, 2554-2564.

  9. Kern, P. S., Teng, M. K., Smolyar, A., Liu, J. H., Liu, J., Hussey, R. E., Spoerl, R., Chang, H. C., Reinherz, E. L., and Wang, J. H. (1998) Structural Basis of CD8 Coreceptor Function Revealed by Crystallographic Analysis of a Murine CD8alphaalpha Ectodomain Fragment in Complex with H-2Kb. Immunity. 9, 519-530.

  10. Gao, G. F., Tormo, J., Gerth, U. C., Wyer, J. R., McMichael, A. J., Stuart, D. I., Bell, J. I., Jones, E. Y., and Jakobsen, B. K. (1997) Crystal Structure of the Complex between Human CD8alpha(Alpha) and HLA-A2. Nature. 387, 630-634.

  11. Liu, J. L., Coschigano, K. T., Robertson, K., Lipsett, M., Guo, Y., Kopchick, J. J., Kumar, U., and Liu, Y. L. (2004) Disruption of Growth Hormone Receptor Gene Causes Diminished Pancreatic Islet Size and Increased Insulin Sensitivity in Mice. Am J Physiol Endocrinol Metab. 287, E405-13.

  12. Shi, Y., Qi, J., Iwamoto, A., and Gao, G. F. (2011) Plasticity of Human CD8alphaalpha Binding to Peptide-HLA-A*2402. Mol Immunol. 48, 2198-2202.

  13. Gao, G. F., Willcox, B. E., Wyer, J. R., Boulter, J. M., O'Callaghan, C. A., Maenaka, K., Stuart, D. I., Jones, E. Y., Van Der Merwe, P. A., Bell, J. I., and Jakobsen, B. K. (2000) Classical and Nonclassical Class I Major Histocompatibility Complex Molecules Exhibit Subtle Conformational Differences that Affect Binding to CD8alphaalpha. J Biol Chem. 275, 15232-15238.

  14. Wheeler, C. J., von Hoegen, P., and Parnes, J. R. (1992) An Immunological Role for the CD8 Beta-Chain. Nature. 357, 247-249.

  15. Karaki, S., Tanabe, M., Nakauchi, H., and Takiguchi, M. (1992) Beta-Chain Broadens Range of CD8 Recognition for MHC Class I Molecule. J Immunol. 149, 1613-1618.

  16. Renard, V., Romero, P., Vivier, E., Malissen, B., and Luescher, I. F. (1996) CD8 Beta Increases CD8 Coreceptor Function and Participation in TCR-Ligand Binding. J Exp Med. 184, 2439-2444.

  17. Witte, T., Spoerl, R., and Chang, H. C. (1999) The CD8beta Ectodomain Contributes to the Augmented Coreceptor Function of CD8alphabeta Heterodimers Relative to CD8alphaalpha Homodimers. Cell Immunol. 191, 90-96.

  18. Kern, P., Hussey, R. E., Spoerl, R., Reinherz, E. L., and Chang, H. C. (1999) Expression, Purification, and Functional Analysis of Murine Ectodomain Fragments of CD8alphaalpha and CD8alphabeta Dimers. J Biol Chem. 274, 27237-27243.

  19. Wong, J. S., Wang, X., Witte, T., Nie, L., Carvou, N., Kern, P., and Chang, H. C. (2003) Stalk Region of Beta-Chain Enhances the Coreceptor Function of CD8. J Immunol. 171, 867-874.

  20. Rettig, L., McNeill, L., Sarner, N., Guillaume, P., Luescher, I., Tolaini, M., Kioussis, D., and Zamoyska, R. (2009) An Essential Role for the Stalk Region of CD8 Beta in the Coreceptor Function of CD8. J Immunol. 182, 121-129.

  21. Snow, P. M., Van de Rijn, M., and Terhorst, C. (1985) Association between the Human Thymic Differentiation Antigens T6 and T8. Eur J Immunol. 15, 529-532.

  22. Classon, B. J., Brown, M. H., Garnett, D., Somoza, C., Barclay, A. N., Willis, A. C., and Williams, A. F. (1992) The Hinge Region of the CD8 Alpha Chain: Structure, Antigenicity, and Utility in Expression of Immunoglobulin Superfamily Domains. Int Immunol. 4, 215-225.

  23. Pascale, M. C., Erra, M. C., Malagolini, N., Serafini-Cessi, F., Leone, A., and Bonatti, S. (1992) Post-Translational Processing of an O-Glycosylated Protein, the Human CD8 Glycoprotein, during the Intracellular Transport to the Plasma Membrane. J Biol Chem. 267, 25196-25201.

  24. Casabo, L. G., Mamalaki, C., Kioussis, D., and Zamoyska, R. (1994) T Cell Activation Results in Physical Modification of the Mouse CD8 Beta Chain. J Immunol. 152, 397-404.

  25. Daniels, M. A., Devine, L., Miller, J. D., Moser, J. M., Lukacher, A. E., Altman, J. D., Kavathas, P., Hogquist, K. A., and Jameson, S. C. (2001) CD8 Binding to MHC Class I Molecules is Influenced by T Cell Maturation and Glycosylation. Immunity. 15, 1051-1061.

  26. Moody, A. M., Chui, D., Reche, P. A., Priatel, J. J., Marth, J. D., and Reinherz, E. L. (2001) Developmentally Regulated Glycosylation of the CD8alphabeta Coreceptor Stalk Modulates Ligand Binding. Cell. 107, 501-512.

  27. Merry, A. H., Gilbert, R. J., Shore, D. A., Royle, L., Miroshnychenko, O., Vuong, M., Wormald, M. R., Harvey, D. J., Dwek, R. A., Classon, B. J., Rudd, P. M., and Davis, S. J. (2003) O-Glycan Sialylation and the Structure of the Stalk-Like Region of the T Cell Co-Receptor CD8. J Biol Chem. 278, 27119-27128.

  28. Barber, E. K., Dasgupta, J. D., Schlossman, S. F., Trevillyan, J. M., and Rudd, C. E. (1989) The CD4 and CD8 Antigens are Coupled to a Protein-Tyrosine Kinase (p56lck) that Phosphorylates the CD3 Complex. Proc Natl Acad Sci U S A. 86, 3277-3281.

  29. Veillette, A., Bookman, M. A., Horak, E. M., and Bolen, J. B. (1988) The CD4 and CD8 T Cell Surface Antigens are Associated with the Internal Membrane Tyrosine-Protein Kinase p56lck. Cell. 55, 301-308.

  30. Shaw, A. S., Chalupny, J., Whitney, J. A., Hammond, C., Amrein, K. E., Kavathas, P., Sefton, B. M., and Rose, J. K. (1990) Short Related Sequences in the Cytoplasmic Domains of CD4 and CD8 Mediate Binding to the Amino-Terminal Domain of the p56lck Tyrosine Protein Kinase. Mol Cell Biol. 10, 1853-1862.

  31. Turner, J. M., Brodsky, M. H., Irving, B. A., Levin, S. D., Perlmutter, R. M., and Littman, D. R. (1990) Interaction of the Unique N-Terminal Region of Tyrosine Kinase p56lck with Cytoplasmic Domains of CD4 and CD8 is Mediated by Cysteine Motifs. Cell. 60, 755-765.

  32. Terry, L. A., DiSanto, J. P., Small, T. N., and Flomenberg, N. (1990) Differential Expression and Regulation of the Human CD8 Alpha and CD8 Beta Chains. Tissue Antigens. 35, 82-91.

  33. Moebius, U., Kober, G., Griscelli, A. L., Hercend, T., and Meuer, S. C. (1991) Expression of Different CD8 Isoforms on Distinct Human Lymphocyte Subpopulations. Eur J Immunol. 21, 1793-1800.

  34. DiSanto, J. P., Knowles, R. W., and Flomenberg, N. (1988) The Human Lyt-3 Molecule Requires CD8 for Cell Surface Expression. EMBO J. 7, 3465-3470.

  35. Gorman, S. D., Sun, Y. H., Zamoyska, R., and Parnes, J. R. (1988) Molecular Linkage of the Ly-3 and Ly-2 Genes. Requirement of Ly-2 for Ly-3 Surface Expression. J Immunol. 140, 3646-3653.

  36. Mayans, S., Stepniak, D., Palida, S. F., Larange, A., Dreux, J., Arlian, B. M., Shinnakasu, R., Kronenberg, M., Cheroutre, H., and Lambolez, F. (2014) AlphabetaT Cell Receptors Expressed by CD4(-)CD8alphabeta(-) Intraepithelial T Cells Drive their Fate into a Unique Lineage with Unusual MHC Reactivities. Immunity. 41, 207-218.

  37. Van Kaer, L., Algood, H. M., Singh, K., Parekh, V. V., Greer, M. J., Piazuelo, M. B., Weitkamp, J. H., Matta, P., Chaturvedi, R., Wilson, K. T., and Olivares-Villagomez, D. (2014) CD8alphaalpha(+) Innate-Type Lymphocytes in the Intestinal Epithelium Mediate Mucosal Immunity. Immunity. 41, 451-464.

  38. Torres-Nagel, N., Kraus, E., Brown, M. H., Tiefenthaler, G., Mitnacht, R., Williams, A. F., and Hunig, T. (1992) Differential Thymus Dependence of Rat CD8 Isoform Expression. Eur J Immunol. 22, 2841-2848.

  39. Walker, L. J., Marrinan, E., Muenchhoff, M., Ferguson, J., Kloverpris, H., Cheroutre, H., Barnes, E., Goulder, P., and Klenerman, P. (2013) CD8alphaalpha Expression Marks Terminally Differentiated Human CD8+ T Cells Expanded in Chronic Viral Infection. Front Immunol. 4, 223.

  40. Connolly, J. M., Hansen, T. H., Ingold, A. L., and Potter, T. A. (1990) Recognition by CD8 on Cytotoxic T Lymphocytes is Ablated by several Substitutions in the Class I Alpha 3 Domain: CD8 and the T-Cell Receptor Recognize the Same Class I Molecule. Proc Natl Acad Sci U S A. 87, 2137-2141.

  41. Salter, R. D., Benjamin, R. J., Wesley, P. K., Buxton, S. E., Garrett, T. P., Clayberger, C., Krensky, A. M., Norment, A. M., Littman, D. R., and Parham, P. (1990) A Binding Site for the T-Cell Co-Receptor CD8 on the Alpha 3 Domain of HLA-A2. Nature. 345, 41-46.

  42. Holler, P. D., and Kranz, D. M. (2003) Quantitative Analysis of the Contribution of TCR/pepMHC Affinity and CD8 to T Cell Activation. Immunity. 18, 255-264.

  43. Kerry, S. E., Buslepp, J., Cramer, L. A., Maile, R., Hensley, L. L., Nielsen, A. I., Kavathas, P., Vilen, B. J., Collins, E. J., and Frelinger, J. A. (2003) Interplay between TCR Affinity and Necessity of Coreceptor Ligation: High-Affinity Peptide-MHC/TCR Interaction Overcomes Lack of CD8 Engagement. J Immunol. 171, 4493-4503.

  44. Wang, J. H., and Reinherz, E. L. (2012) The Structural Basis of Alphabeta T-Lineage Immune Recognition: TCR Docking Topologies, Mechanotransduction, and Co-Receptor Function. Immunol Rev. 250, 102-119.

  45. Yachi, P. P., Ampudia, J., Zal, T., and Gascoigne, N. R. (2006) Altered Peptide Ligands Induce Delayed CD8-T Cell Receptor Interaction--a Role for CD8 in Distinguishing Antigen Quality. Immunity. 25, 203-211.

  46. Jiang, N., Huang, J., Edwards, L. J., Liu, B., Zhang, Y., Beal, C. D., Evavold, B. D., and Zhu, C. (2011) Two-Stage Cooperative T Cell Receptor-Peptide Major Histocompatibility Complex-CD8 Trimolecular Interactions Amplify Antigen Discrimination. Immunity. 34, 13-23.

  47. Purbhoo, M. A., Boulter, J. M., Price, D. A., Vuidepot, A. L., Hourigan, C. S., Dunbar, P. R., Olson, K., Dawson, S. J., Phillips, R. E., Jakobsen, B. K., Bell, J. I., and Sewell, A. K. (2001) The Human CD8 Coreceptor Effects Cytotoxic T Cell Activation and Antigen Sensitivity Primarily by Mediating Complete Phosphorylation of the T Cell Receptor Zeta Chain. J Biol Chem. 276, 32786-32792.

  48. Artyomov, M. N., Lis, M., Devadas, S., Davis, M. M., and Chakraborty, A. K. (2010) CD4 and CD8 Binding to MHC Molecules Primarily Acts to Enhance Lck Delivery. Proc Natl Acad Sci U S A. 107, 16916-16921.

  49. Kim, P. W., Sun, Z. Y., Blacklow, S. C., Wagner, G., and Eck, M. J. (2003) A Zinc Clasp Structure Tethers Lck to T Cell Coreceptors CD4 and CD8. Science. 301, 1725-1728.

  50. Daniels, M. A., and Jameson, S. C. (2000) Critical Role for CD8 in T Cell Receptor Binding and Activation by peptide/major Histocompatibility Complex Multimers. J Exp Med. 191, 335-346.

  51. Denkberg, G., Cohen, C. J., and Reiter, Y. (2001) Critical Role for CD8 in Binding of MHC Tetramers to TCR: CD8 Antibodies Block Specific Binding of Human Tumor-Specific MHC-Peptide Tetramers to TCR. J Immunol. 167, 270-276.

  52. Fung-Leung, W. P., Schilham, M. W., Rahemtulla, A., Kundig, T. M., Vollenweider, M., Potter, J., van Ewijk, W., and Mak, T. W. (1991) CD8 is Needed for Development of Cytotoxic T Cells but Not Helper T Cells. Cell. 65, 443-449.

  53. Crooks, M. E., and Littman, D. R. (1994) Disruption of T Lymphocyte Positive and Negative Selection in Mice Lacking the CD8 Beta Chain. Immunity. 1, 277-285.

  54. Nakayama, K., Nakayama, K., Negishi, I., Kuida, K., Louie, M. C., Kanagawa, O., Nakauchi, H., and Loh, D. Y. (1994) Requirement for CD8 Beta Chain in Positive Selection of CD8-Lineage T Cells. Science. 263, 1131-1133.

  55. Trobridge, P. A., Forbush, K. A., and Levin, S. D. (2001) Positive and Negative Selection of Thymocytes Depends on Lck Interaction with the CD4 and CD8 Coreceptors. J Immunol. 166, 809-818.

  56. Van Laethem, F., Tikhonova, A. N., Pobezinsky, L. A., Tai, X., Kimura, M. Y., Le Saout, C., Guinter, T. I., Adams, A., Sharrow, S. O., Bernhardt, G., Feigenbaum, L., and Singer, A. (2013) Lck Availability during Thymic Selection Determines the Recognition Specificity of the T Cell Repertoire. Cell. 154, 1326-1341.

  57. Van Laethem, F., Sarafova, S. D., Park, J. H., Tai, X., Pobezinsky, L., Guinter, T. I., Adoro, S., Adams, A., Sharrow, S. O., Feigenbaum, L., and Singer, A. (2007) Deletion of CD4 and CD8 Coreceptors Permits Generation of alphabetaT Cells that Recognize Antigens Independently of the MHC. Immunity. 27, 735-750.

  58. Wiest, D. L., Ashe, J. M., Abe, R., Bolen, J. B., and Singer, A. (1996) TCR Activation of ZAP70 is Impaired in CD4+CD8+ Thymocytes as a Consequence of Intrathymic Interactions that Diminish Available p56lck. Immunity. 4, 495-504.

  59. Tikhonova, A. N., Van Laethem, F., Hanada, K., Lu, J., Pobezinsky, L. A., Hong, C., Guinter, T. I., Jeurling, S. K., Bernhardt, G., Park, J. H., Yang, J. C., Sun, P. D., and Singer, A. (2012) Alphabeta T Cell Receptors that do Not Undergo Major Histocompatibility Complex-Specific Thymic Selection Possess Antibody-Like Recognition Specificities. Immunity. 36, 79-91.

  60. Teh, H. S., Kisielow, P., Scott, B., Kishi, H., Uematsu, Y., Bluthmann, H., and von Boehmer, H. (1988) Thymic Major Histocompatibility Complex Antigens and the Alpha Beta T-Cell Receptor Determine the CD4/CD8 Phenotype of T Cells. Nature. 335, 229-233.

  61. Singer, A., Adoro, S., and Park, J. H. (2008) Lineage Fate and Intense Debate: Myths, Models and Mechanisms of CD4- Versus CD8-Lineage Choice. Nat Rev Immunol. 8, 788-801.

  62. Harker, N., Naito, T., Cortes, M., Hostert, A., Hirschberg, S., Tolaini, M., Roderick, K., Georgopoulos, K., and Kioussis, D. (2002) The CD8alpha Gene Locus is Regulated by the Ikaros Family of Proteins. Mol Cell. 10, 1403-1415.

  63. Sato, T., Ohno, S., Hayashi, T., Sato, C., Kohu, K., Satake, M., and Habu, S. (2005) Dual Functions of Runx Proteins for Reactivating CD8 and Silencing CD4 at the Commitment Process into CD8 Thymocytes. Immunity. 22, 317-328.

  64. Grueter, B., Petter, M., Egawa, T., Laule-Kilian, K., Aldrian, C. J., Wuerch, A., Ludwig, Y., Fukuyama, H., Wardemann, H., Waldschuetz, R., Moroy, T., Taniuchi, I., Steimle, V., Littman, D. R., and Ehlers, M. (2005) Runx3 Regulates Integrin Alpha E/CD103 and CD4 Expression during Development of CD4-/CD8+ T Cells. J Immunol. 175, 1694-1705.